S1P exerts its diverse physiological effects through the S1P receptors (S1PRs) subfamily. Here, a pipeline is described to expound on the structures and function of S1PRs.
Method Article
* These authors contributed equally
S1P exerts its diverse physiological effects through the S1P receptors (S1PRs) subfamily. Here, a pipeline is described to expound on the structures and function of S1PRs.
Lysophospholipids (LPLs) are bioactive lipids that include sphingosine 1-phosphate (S1P), lysophosphatidic acid, etc. S1P, a metabolic product of sphingolipids in the cell membrane, is one of the best-characterized LPLs that regulates a variety of cellular physiological responses via signaling pathways mediated by sphingosine 1-phosphate receptors (S1PRs). This implicated that the S1P-S1PRs signaling system is a remarkable potential therapeutic target for disorders, including multiple sclerosis (MS), autoimmune disorders, cancer, inflammation, and even COVID-19. S1PRs, a small subset of the class A G-protein coupled receptor (GPCR) family, are composed of five subtypes: S1PR1, S1PR2, S1PR3, S1PR4, and S1PR5. The lack of detailed structural information, however, impedes the drug discovery targeting S1PRs. Here, we applied the cryo-electron microscopy method to solve the structure of the S1P-S1PRs complex, and elucidated the mechanism of activation, selective drug recognition, and G-protein coupling by using cell-based functional assays. Other lysophospholipid receptors (LPLRs) and GPCRs can also be studied using this strategy.
Sphingosine-1-phosphate (S1P), a metabolic product of sphingolipids in the cell membrane, is a ubiquitous lysophosphatidic signaling molecule that involves various biological activities, including lymphocyte trafficking, vascular development, endothelial integrity, and heart rate1,2,3. S1P exerts its diverse physiological effects through five S1P receptor subtypes (S1PRs 1-5); S1PRs are found in a variety of tissues and exhibit unique preferences for downstream G proteins4,5. S1PR1 is primarily coupled with the Gi protein, which subsequently inhibits cAMP production; S1PR2 and S1PR3 are coupled with Gi, Gq, and G12/13, and S1PR4 and S1PR5 transduce signal through Gi and G12/136.
S1P-S1PR signaling is a critical therapeutic target for multiple diseases, including autoimmune disorders7, inflammation8, cancer9, and even COVID-1910. In 2010, fingolimod (FTY720) was licensed as a first-in-class drug targeting S1PRs to treat relapse multiple sclerosis (MS)11. However, it is capable of binding to all S1PRs except S1PR2, while nonspecific binding to S1PR3 results in edema of the cerebral cortex, vascular and bronchial constriction, and lung epithelial leakage12. As an alternate strategy for increasing therapeutic selectivity, subtype-specific ligands for the receptor have been produced. Siponimod (BAF312) was approved in 2019 for the relapse MS treatment13; it effectively targets S1PR1 and S1PR5, whereas it has no affinity for S1PR3, exhibiting fewer side effects in clinical practice14. In 2020, the US Food and Drug Administration authorized ozanimod for MS therapy15. It has been reported that ozanimod holds a 25-fold greater selectivity for S1PR1 than for S1PR516. Notably, in the context of the current COVID-19 pandemic, it has been discovered that agonist drugs targeting S1PRs may be utilized to treat COVID-19 by using immunomodulatory therapy techniques17. In comparison with fingolimod, the ozanimod has shown superiority in lowering symptoms in COVID-19 patients and is now undergoing clinical trials10. Understanding the structural basis and function of S1PRs lays a significant foundation for developing a drug that selectively targets S1PRs18.
Many techniques are used to investigate the structural information of biomacromolecules, including X-ray crystallography, nuclear magnetic resonance (NMR), and electron microscopy (EM). As of March 2022, there are more than 180,000 structures deposited on the Protein Databank (PDB), and most of them have been resolved by X-ray crystallography. However, with the first near-atomic resolution structure of TPRV1 (3.4 Å resolution) reported by Yifan Cheng and David Julius in 201319, cryo-electron microscopy (cryo-EM) has become a mainstream technique for protein structures, and the total number of EM PDB structures was more than 10,000. The critical breakthrough areas are the development of new cameras for imaging known as direct electron detection cameras and new image processing algorithms. Cryo-EM has revolutionized structure biology and structure-based drug discovery in the past decade20. As understanding how macromolecular complexes fulfill their complicated roles in the living cell is a central theme in biological sciences, cryo-EM has the potential to reveal conformations of dynamic molecular complexes, particularly for transmembrane proteins21. G-protein coupled receptors (GPCRs) are the largest superfamily of transmembrane proteins and the targets of more than 30% of currently marketed pharmaceuticals22. The development of cryo-EM has contributed to a burst of high-resolution structures of GPCR-G protein complexes, enabling structural determination for 'intractable' targets that are still not accessible to X-ray crystallographic analysis in drug design23. Hence, the cryo-EM application provides a chance to determine the three-dimensional structure of GPCRs in near-native conditions at close to atomic resolution24. Advancements in cryo-EM make it possible to visualize mechanistic underpinnings of GPCR stimulation or inhibition, and further benefit in uncovering the novel binding sites for GPCR-targeted drug creation25.
Relying on the tremendous strides of cryo-EM technology, we have identified structures of agonized S1PR1-, S1PR3-, and S1PR5-Gi signaling complexes recently26,27. In humans, S1PRs are found in various tissues and exhibit unique preferences for downstream G proteins4,5. S1PR1 is primarily coupled with the Gi protein, which subsequently inhibits 3′,5′-cyclic adenosine monophosphate (cAMP) production. S1PR3 and S1PR5 are also capable of coupling with Gi6,28. Since Gi-coupled receptor activation decreases the production of cAMP29, a Gi-inhibition cAMP assay was introduced to measure cAMP inhibition effects for capturing functional alterations26,27. Using a mutant version of Photinus pyralis luciferase wherein a cAMP-binding protein moiety has been inserted, this cAMP assay offers a simple and reliable method for monitoring GPCR activity through changes in intracellular cAMP concentration30. It is a sensitive and non-radioactive functional assay and can be applied to monitor the real-time downstream signaling of a wide range of GPCRs for drug discovery purposes31.
Here, a summary is provided of the critical methods in resolving the activation and drug recognition modes of S1PRs, primarily including cryo-EM manipulations and a Gi-inhibition cAMP assay. This article aims to provide comprehensive experimental guidance for further explorations into the structures and functions of GPCRs.
1. Purification of S1PRs-G protein complex
2. Electron microscopy to resolve the S1PRs structure
3. S1PRs-Gi mediated cAMP inhibition assay
NOTE: The S1PRs-Gi mediated cAMP inhibition experiment was divided into several parts, and the following are detailed experimental procedures. The experimental principle and the general experimental process are shown in the form of a flow chart in Figure 1.

Figure 1: Schematic illustration of the experiment. A detailed step-wise guide for experimental setup and execution. In brief, the receptor and modified luciferase were transiently co-expressed in CHO-K1 cells by transfecting the receptor and Sensor plasmid into the cells with transfection reagent. The cells were suspended in HBSS solution with D-Luciferin-potassium salt, the luciferase substrate, and seeded into a 96-well plate after 24 h. To allow permeation into the cells, D-luciferin must be pre-equilibrated with the cells. The oxidative enzyme luciferase transforms luciferin to oxyluciferin and emits light. The modified luciferase, on the other hand, generates light via a chemical reaction only when bound to cAMP, and the intensity of light has a positive association with cAMP levels in cells. The levels of cAMP were regulated with GPCR activated by agonist. Gi-coupled receptors reduced the levels of cAMP, necessitating the addition of forskolin to activate the adenylyl cyclase in the Gi-inhibition cAMP experiment. Please click here to view a larger version of this figure.
Before freezing the sample of S1PRs-Gi complex, the purified sample needs to be separated by size-exclusion chromatography (SEC) and analyzed with gel filtration chromatography. Figure 2 shows the S1PR3-Gi complex as an example. The peak fraction of the homogeneous GPCR-G protein complex was usually located at ~10.5 mL of the size-exclusion chromatography (Figure 2A). SDS-page analysis of the S1PR3-Gi complex (Figure 2B) reveals four bands corresponding to the theoretical bands of S1PR3, Gαi, Gβ, and scFv16, and thus suggests that the complex was successfully purified. The receptor band was often found diffused owing to different degrees of modification (glycosylation or palmitoylation), and the band of Gγ was not found.

Figure 2: Analysis of protein purification results (A) Gel filtration chromatogram showing the peak fraction corresponding to the protein. (B) SDS-page gel electrophoresis pattern.This figure has been adapted from reference27. Please click here to view a larger version of this figure.
The complex fractions of the S1PR3-Gi complex were collected and concentrated for electron microscopy. The procedures for and representative results of grid vitrification and sample screening were discussed previously34. A flowchart (Figure 3) is presented to obtain a high-resolution structure of the S1PRs-G protein complex using two different processing platforms: RELION-3 and cryoSPARC v3.

Figure 3: Data processing workflow of the pFTY720-bound S1PR3-Gi-scFv16 complexes. Cryo-EM data processing flowchart of the pFTY720-S1PR3-Gi-scFv16 complex is shown. Representative cryo-EM micrograph auto-picking, 2D classification averages, 3D reconstructions, and Non-uniform Refinement of the pFTY720-S1PR3-Gi-scFv16 complex are shown in the figure. This figure has been modified from reference27. Please click here to view a larger version of this figure.
Movies were imported to RELION-3 firstly, and subsequently motion correction and CTF-estimation were performed to generate averaged micrographs. By picking particles and iterative 2D classification, better particles were gained for further processing. It is critical to select particles with well-defined 2D classes that clearly represent the secondary structural information of the S1PR3-Gi complex (Figure 4A), as poor-quality particles can obstruct subsequent processing stages (Figure 4B), resulting in a lower resolution reconstruction. Using 3D classification, the particles were further classified to exclude noise particles, distinguish different possible conformations, and yield multiple 3D reconstructions. Eventually, an S1PR3-Gi complex EM map (Figure 5A) was produced with good resolution via Fourier Shell Correlation (FSC) (Figure 5B), through Non-uniform Refinement.

Figure 4: Selecting 2D classes. (A,B) Results from 2D classification. (A) Select 2D class averages containing well-defined classes for further processing, and (B) reject partial particles or particles with low resolution and noise. Please click here to view a larger version of this figure.

Figure 5: High-resolution structure of the pFTY720-bound S1PR3-Gi-scFv16 complexes. (A) The high-resolution structure of the pFTY720 bound S1PR3 complex displays well-defined cryo-EM density representing S1PR3 and Gi protein structure elements. (B) Gold-standard Fourier shell correlation (FSC) curve for pFTY720- bound S1PR3-Gi complex. This figure has been adapted from reference27. Please click here to view a larger version of this figure.
By resolving the structures of the S1PRs-G protein complex with cryo-EM, we elucidated the mechanism of activation, selective drug recognition, and G-protein coupling by using functional assays in the cell. The Gi-inhibition cAMP assay measures the changes in the level of cAMP concentration in cells (Figure 1), and it was frequently used to validate the activation potency of receptors coupled with Gs or Gi.
The concentration ratio of receptor to Sensor plasmid in the experiment system is crucial for experimental viability. So, in order to perform functional analysis effectively and precisely, one must choose a plasmid concentration ratio with a maximum Emax value. In this experiment, three concentration ratios (1:1, 1:3, and 1:9) of receptor to Sensor plasmid were investigated. Results showed that a maximum Emax value was obtained when the concentration ratio of receptor to Sensor plasmid was 1:3 (Figure 6).

Figure 6: The effect of different concentration ratios of S1PR3 to Sensor plasmid on window period was explored in the CHO-K1 cell line. Data are presented as the means ± SEM of three independent experiments performed in triplicate. Please click here to view a larger version of this figure.
Besides the concentration ratio of the receptor to the Sensor plasmid, the cell lines employed in this experiment were also important. There was no substantial difference between HEK293 and CHO-K1 cell lines for most receptors. CHO-K1 cell lines, on the other hand, had a more realistic overall curve than HEK293 cells for S1PR3 (Figure 7). Therefore, CHO-K1 cells were chosen for the functional experiment verification of S1PR3.

Figure 7: The effect of different concentration ratios of S1PR3 to Sensor plasmid on window period was explored in the HEK293 cell line. Data are presented as the means ± SEM of three independent experiments performed in triplicate. Please click here to view a larger version of this figure.
This protocol describes a primary pipeline for determining the structures of S1PRs by cryo-EM and measuring the activation potency of S1PRs by Gi-mediated cAMP inhibition assay. Some steps are crucial to the experiment's success.
To purify the S1PRs-Gi complex, the quality of the virus and the health of sf9 cells should be paid more attention to. The expression of the receptor is dramatically reduced in poor sf9 cells. The health of sf9 cells was assessed by measuring their diameter. The healthy sf9 cell has a diameter of roughly 15 µm. The yield of the S1PRs-Gi complex is influenced by the volume ratio of the receptor, Gi, and Gβγ viruses which can be overcome by assembling the S1PRs-G protein complex in vitro42. In addition, GPCR-G protein complexes are not always stable, and thus the NanoBiT strategy was developed and has been frequently applied to stabilize the complex43.
The quality of the sample is the foundation for everything in the cryo-EM experiment. An aggregation or dissociation phenomenon has been frequently observed in specimen screening. Some approaches may be helpful in GPCR-G-protein complex stabilization. The C-terminus residues of S1PRs can cause sample aggregation in the S1PRs-Gi complex project26. The signaling pathway assay must be used to select an acceptable C-terminal end for S1PRs26,27. The concentration of the LMNG is the second most essential factor; excessive detergent concentrations can stabilize the GPCR-G protein complex, but they can also diminish its resolution, while low concentrations can do the opposite. The crucial aspect in stabilizing the complex is an optimal detergent concentration that is as low as possible. Besides, the concentration of the sample can occasionally influence the quantity of data collected. When vitrifying a sample, we frequently make a gradient. In data processing, the choice of algorithms in particle selection and 2D or 3D classification is important for solving the S1PRs-G protein complexes, especially for modeling the ligands and ECLs; the density of ECLs was found continuous in the S1PR1 structure resolved in the literature described by Shian Liu et al.42 and found discontinuous in S1PR5 structures26. While there is no universal solution to this problem for all GPCR complexes, any strategy that improves the EM density map should be tried. The crucial steps for vitrification, data collection, and image processing were described previously34,44.
An assay is required to evaluate the activation or inhibition potency of S1PR ligands after the structures of S1PRs have been determined by cryo-EM. Numerous approaches can be used. Gi-inhibition cAMP assay evaluates receptor activation potency by monitoring changes in cAMP levels in cells caused by agonists regularly. a) Cell culture, b) transfection, c) the mole ratio of plasmid receptor (or mutations) and Sensor plasmid, and d) the choice of cell type are all crucial for a successful experiment. The health of the cells can affect transfection efficiency and receptor or Sensor expression, which can have a significant impact on the experiment's signal-to-noise ratio. Cells are generally healthy after 20 generations, although this is not always the case. It is critical to always keep an eye on the state of the cells. The trypsin digestion period during cell passage must be tightly managed because the state of the cell has a significant impact over time. Transfection reagents affect receptor expression in several cell types, and an appropriate cell brand must be selected. The mole ratio of plasmid receptor to Sensor plasmid in the Gi-inhibition cAMP assay must be optimized. We often choose a series of mole ratios between receptor and Sensor plasmid and identify the highest variation of fluorescence intensity to ensure data accuracy for Gi-inhibition cAMP assay with receptor mutants.
Some other assays are used to monitor cellular cAMP levels in a variety of sample types, such as ELISA assay45 and NanoBiT46. The cAMP ELISA assay is used to measure the amount of the cAMP bound with the specific antibody. The cAMP-specific antibody is anchored onto a microtiter plate and the peroxidase cAMP tracer competes with cAMP for binding with the antibody. The amount of the peroxidase cAMP tracer bound to the plate is measured by using fluorometric tests which is inversely proportional to the amount of cAMP. In 2007, Jiang et al. developed a method to monitor the levels of cAMP in vivo quantitatively and rapidly by using Bioluminescence Resonance Energy Transfer (BRET) technology (cAMP sensor using YFP-Epac-RLuc)46. NanoBiT-based cAMP assay applies the cAMP sensor LgBiT-Epac-SmBiT, which replaces YFP and Rluc with LgBiT and SmBiT, respectively, and is used to measure the dissociation of the G-protein heterotrimer or coupling between the receptor and G-protein heterotrimer.
Authors have no conflicts of interest.
The data of the S1PRs-Gi complex were harvested at the West China Cryo-EM Center in Sichuan University and Cryo-EM Center at the Southern University of Science and Technology (SUSTech) and processed at Duyu High-Performance Computing Center in Sichuan University. This work was supported by the Natural Science Foundation of China (32100965 to L.C., 32100988 to W.Y., 31972916 to Z.S.) and the full-time Postdoctoral Research Fund of Sichuan University (2021SCU12003 to L.C.)
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| 0.05% trypsin-EDTA | GIBCO | Cat# 25300054 | |
| 0.22 µM filter | Thermo Fisher Scientific | Cat# 42213-PS | |
| 100 kDa cut-off concentrator | Thermo Fisher Scientific | Cat# 88533 | |
| 6-well plate | Corning | Cat# 43016 | |
| 96-well plate | Corning | Cat# 3917 | |
| Aprotinin | Sigma-Aldrich | Cat# 9087-70-1 | |
| Apyrase | NEB | Cat# M0398S | |
| Baculovirus transfection reagent | Thermo Fisher Scientific | Cat# 10362100 | For the preparation of P0 baculovirus |
| Benzamidine | Sigma-Aldrich | Cat# B6506 | |
| CHO-K1 | ATCC | N/A | |
| CHS | Sigma-Aldrich | Cat# C6512 | |
| CryoSPARC | Punjani, A., et al.,2017 | https://cryosparc.com/ | |
| DH5α competent E.coli | Thermo Fisher Scientific | Cat# EC0112 | |
| D-Luciferin-Potassium Salt | Sigma- Aldrich | Cat# 50227 | |
| DMSO | Sigma- Aldrich | Cat# D2438 | |
| EDTA | Thermo Fisher Scientific | Cat# S311-500 | |
| ESF921 cell culture medium | Expression Systems | Cat# 96-001 | |
| Excel | microsoft | N/A | |
| F12 medium | Invitrogen | Cat# 11765 | |
| FBS | Cell Box | Cat# SAG-01U-02 | |
| Flag resin | Sigma- Aldrich | Cat# A4596 | |
| Forskolin | APExBIO | Cat# B1421 | |
| Gctf | Zhang, 2016 | https://www.mrc-lmb.cam.ac.uk/kzhang/Gctf/ | |
| GDN | Anatrace | Cat# GDN101 | |
| Gel filtration column | GE healthcare | Cat# 28990944 | |
| Gen5 3.11 | BIO-TEK | N/A | |
| Gentamicin | Solarbio | Cat# L1312 | |
| GloSensor cAMP assay kit | Promega | Cat# E1291 | Gi-inhibition cAMP assay kit |
| GloSensor plasmid | Promega | Cat# E2301 | Sensor plasmid |
| Grace’s medium | GIBCO | Cat# 11595030 | |
| GraphPad Prism 8 | Graphpad | N/A | |
| HBSS | Thermo Fisher Scientific | Cat# 88284 | |
| HEPES | Sigma- Aldrich | Cat# H4034 | |
| jetPRIME Reagent | Polyplus Transfection | Cat# 114-15 | transfection reagent |
| Janamycin | Solarbio | Cat# K1030 | |
| LB medium | Invitrogen | Cat# 12780052 | |
| Leupeptin | Sigma-Aldrich | Cat# L2884 | |
| LMNG | Anatrace | Cat# NG310 | |
| MotionCor2 | (Zheng et al., 2017) | https://emcore.ucsf.edu/ucsf-software | |
| NanoCab | Thermo Fisher Scientific | Cat# 1121822 | |
| PBS | Invitrogen | Cat# 14190-144 | |
| pcDNA3.1-HA-FLAG-S1PRs | GenScript | N/A | |
| pFastBac1-Gαi | GenScript | N/A | |
| pFastBac1-HA-FLAG-T4L-S1PRs-His10 | GenScript | N/A | |
| pFastBacdual-Gβ1γ2 | GenScript | N/A | |
| PureLink HiPure Plasmid Miniprep Kit | Invitrogen | Cat# K210003 | For the preparation of plasmids and P0 baculovirus |
| Q5 site-Directed Mutagenesis kit | NEB | Cat# E0554S | For the preparation of plasmids |
| Quantifoil | Quantifoil | Cat# 251448 | |
| RELION-3.1 | (Zivanov et al., 2018) | https://www2.mrc-lmb.cam.ac.uk/relion | |
| S1PRs cDNA | addgene | N/A | |
| scFv16 | Invitrogen | Cat# 703976 | |
| Sf9 | Expression Systems | N/A | |
| Siponimod | Selleck | Cat# S7179 | |
| sodium cholate | Sigma-Aldrich | Cat# C1254 | |
| Synergy H1 microplate reader | BIO-TEK | N/A | |
| Synthetic T4L DNA (sequence) | N/A | N/A | Aacatcttcgagatgctgcgcatcgacgaagg cctgcgtctcaagatttacaagaataccgaagg ttattacacgattggcatcggccacctcctgaca aagagcccatcactcaacgctgccaagtctga actggacaaagccattggtcgcaacaccaac ggtgtcattacaaaggacgaggcggagaaac tcttcaaccaagatgtagatgcggctgtccgtgg catcctgcgtaatgccaagttgaagcccgtgt atgactcccttgatgctgttcgccgtgcagcctt gatcaacatggttttccaaatgggtgagaccgg agtggctggttttacgaactccctgcgcatgctcc agcagaagcgctgggacgaggccgcagtga atttggctaaatctcgctggtacaatcagacacc taaccgtgccaagcgtgtcatcactaccttccg tactggaacttgggacgcttac |
| TCEP | Thermo Fisher Scientific | Cat# 77720 | |
| Tetracycline | Solarbio | Cat# T8180 | |
| Vitrobot Mark IV | Thermo Fisher Scientific | N/A |