AAV peptide display library generation and subsequent validation through the barcoding of candidates with novel properties for the creation of next-generation AAVs.
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
AAV peptide display library generation and subsequent validation through the barcoding of candidates with novel properties for the creation of next-generation AAVs.
Gene delivery vectors derived from Adeno-associated virus (AAV) are one of the most promising tools for the treatment of genetic diseases, evidenced by encouraging clinical data and the approval of several AAV gene therapies. Two major reasons for the success of AAV vectors are (i) the prior isolation of various naturally occurring viral serotypes with distinct properties, and (ii) the subsequent establishment of powerful technologies for their molecular engineering and repurposing in high throughput. Further boosting the potential of these techniques are recently implemented strategies for barcoding selected AAV capsids on the DNA and RNA level, permitting their comprehensive and parallel in vivo stratification in all major organs and cell types in a single animal. Here, we present a basic pipeline encompassing this set of complementary avenues, using AAV peptide display to represent the diverse arsenal of available capsid engineering technologies. Accordingly, we first describe the pivotal steps for the generation of an AAV peptide display library for the in vivo selection of candidates with desired properties, followed by a demonstration of how to barcode the most interesting capsid variants for secondary in vivo screening. Next, we exemplify the methodology for the creation of libraries for next-generation sequencing (NGS), including barcode amplification and adaptor ligation, before concluding with an overview of the most critical steps during NGS data analysis. As the protocols reported here are versatile and adaptable, researchers can easily harness them to enrich the optimal AAV capsid variants in their favorite disease model and for gene therapy applications.
Gene transfer therapy is the introduction of genetic material in cells to repair, replace, or alter the cellular genetic material to prevent, treat, cure, or ameliorate disease. Gene transfer, both in vivo and ex vivo, relies on different delivery systems, non-viral and viral. Viruses have evolved naturally to efficiently transduce their target cells and can be used as delivery vectors. Amongst the different types of viral vectors employed in gene therapy, adeno-associated viruses have been increasingly used, owing to their lack of pathogenicity, safety, low immunogenicity, and most importantly their ability to sustain long-term, non-integrating expression1,2,3. AAV gene therapy has yielded considerable achievements over the past decade; three therapies have been approved by the European Medicines Agency and the US Food and Drug Administration for use in humans3,4. Several clinical trials are also underway to treat a variety of diseases, such as hemophilia, muscular, cardiac, and neurological diseases, as reviewed elsewhere3. Despite decades of advancement, the field of gene therapy has experienced a series of setbacks in recent years4, most importantly deaths in clinical trials5 that have been put on hold due to dose-limiting toxicities, particularly for tissues that are massive, such as muscle, or difficult to reach, such as brain6.
The AAV vectors currently being used in clinical trials belong to the natural serotypes with a few exceptions1. AAV engineering offers the opportunity to develop vectors with superior organ- or cell-specificity and efficiency. In the past two decades, several approaches have been successfully applied, such as peptide display, loop-swap, capsid DNA shuffling, error-prone PCR, and targeted design, to generate individual AAV variants or libraries thereof with diverse properties7. These are then subjected to multiple rounds of directed evolution to select the variants within them with the desired properties, as reviewed elsewhere1,3. Of all the capsid evolution strategies, peptide display AAV libraries have been the most widely used, due to some unique properties: they are relatively easy to generate, and they can achieve high diversity and high-throughput sequencing, which allows trailing their evolution.
The first successful peptide insertion AAV libraries were described almost 20 years ago. In one of the first, Perabo et al.8 constructed a library of modified AAV2 capsids, in which a pool of randomly generated oligonucleotides was inserted in a plasmid at a position that corresponds to amino-acid 587 of the VP1 capsid protein, in the three-fold axis protruding from the capsid. Using adenovirus co-infection, the AAV library was evolved through multiple rounds of selection, and the final re-targeted variants were shown to be capable of transducing cell lines refractory to the parental AAV28. Shortly thereafter, Müller et al.9 introduced the two-step system for library production, a significant improvement to the protocol. Initially, the plasmid library, together with an adenoviral helper plasmid, are used to produce an AAV library that contains chimeric capsids. This AAV shuttle library is used to infect cells at low multiplicity of infection (MOI), with the aim to introduce one viral genome per cell. Co-infection with adenovirus ensures the production of AAVs with a matching genome and capsid9. About a decade later, Dalkara10 used in vivo directed evolution to create the 7m8 variant. This variant has a 10 amino-acid insertion (LALGETTRPA), three of which act as linkers, and efficiently targets the outer retina after intravitreal injection10. This engineered capsid is an exceptional success story, as it is one of the few engineered capsids to make it to the clinic thus far11.
The field experienced a second boost with the introduction of next-generation sequencing (NGS) techniques. Two publications from Adachi et al.12 in 2014 and from Marsic et al.13 in 2015, showcased the power of NGS to track the distribution of barcoded AAV capsid libraries with high accuracy. A few years later, the NGS of barcoded regions was adapted to the peptide insertion region to follow the capsid evolution. Körbelin et al.14 performed an NGS-guided screening to identify a pulmonary-targeted AAV2-based capsid. The NGS analysis helped calculate three rating scores: the enrichment score between selection rounds, the general specificity score to determine tissue specificity, and finally the combined score14. The Gradinaru lab15 published the Cre-recombination-based AAV targeted evolution (CREATE) system in the same year, which facilitates a cell-type-specific selection. In this system, the capsid library carries a Cre-invertible switch, as the polyA signal is flanked by two loxP sites. The AAV library is then injected in Cre mice, where the polyA signal is inverted only in Cre+ cells, providing the template for binding of a reverse PCR primer with the forward primer within the capsid gene. This highly specific PCR rescue enabled the identification of the AAV-PHP.B variant that can cross the blood-brain barrier15. This system was further evolved into M-CREATE (Multiplexed-CREATE), in which NGS and synthetic library generation were integrated in the pipeline16.
An improved RNA-based version of this system from the Maguire lab17, iTransduce, allows selection on the DNA level of capsids that functionally transduce cells and express their genomes. The viral genome of the peptide display library comprises a Cre gene under the control of a ubiquitous promoter and the capsid gene under the control of the p41 promoter. The library is injected in mice that have a loxP-STOP-loxP cassette upstream of tdTomato. Cells transduced with AAV variants that express the viral genome and therefore Cre express tdTomato and, in combination with cell markers, can be sorted and selected17. Similarly, Nonnenmacher et al.18 and Tabebordbar et al.19 placed the capsid gene library under the control of tissue-specific promoters. After injection in different animal models, viral RNA was used to isolate the capsid variants.
An alternative approach is to use barcoding to tag capsid libraries. The Björklund lab20 used this approach to barcode peptide insertion capsid libraries and developed the barcoded rational AAV vector evolution (BRAVE). In one plasmid, the Rep2Cap cassette is cloned next to an inverted terminal repeats (ITR)-flanked, yellow fluorescent protein (YFP)-expressing, barcode-tagged transgene. Using loxP sites between the end of cap and the beginning of the barcode, an in vitro Cre recombination generates a fragment small enough for NGS, thereby allowing the association of peptide insertion with the unique barcode (look-up table, LUT). AAV production is performed using the plasmid library and the barcodes expressed in the mRNA are screened after in vivo application, again with NGS20. When the capsid libraries comprise variants of the whole capsid gene (i.e., shuffled libraries), long-read sequencing needs to be used. Several groups have used barcodes to tag these diverse libraries, which enables NGS with higher read depth. The Kay lab21 tagged highly diverse capsid shuffled libraries with barcodes downstream of the cap polyA signal. In a first step, a barcoded plasmid library was generated, and the shuffled capsid gene library was cloned into it. Then a combination of MiSeq (short read, higher read depth) and PacBio (long read, lower read depth) NGS as well as Sanger sequencing was used to generate their LUT21. In 2019, Ogden and colleagues from the Church lab22 delineated the AAV2 capsid fitness for multiple functions using libraries that had single point mutations, insertions, and deletions in every position, which ultimately enabled machine-guided design. For the generation of the library, smaller fragments of the capsid gene were synthesized, tagged with a barcode, next-generation sequenced, and then cloned into the full capsid gene. The NGS data were used to generate a LUT. The library was then screened using just the barcodes and short read sequencing, which in turn allows higher read depth22.
Barcoded libraries have been predominantly used to screen a pool of known, natural, and engineered variants following several rounds of selection of capsid libraries or independent of a capsid evolution study. The advantage of such libraries is the opportunity to screen multiple capsids, whilst reducing animal numbers and minimizing variation between animals. The first studies that introduced this technology to the AAV field were published almost a decade ago. The Nakai lab12 tagged 191 double alanine mutants covering amino acids 356 to 736 on the VP1 from AAV9 with a pair of 12-nucleotide barcodes. Using NGS, the library was screened in vivo for galactose binding and other properties12. Marsic and colleagues delineated the biodistribution of AAV variants using also a double-barcorded analysis 1 year later13. A more recent study in non-human primates compared the biodistribution in the central nervous system of 29 capsids using different routes of delivery23. Our lab has recently published barcoded AAV library screens of 183 variants that included natural and engineered AAVs. These screens on the DNA and RNA level led to the identification of a highly myotropic AAV variant24 in mice as well as others displaying a high cell-type specificity in the mouse brain25.
Here, we describe the methodology used in this work and expand on it to include screening of AAV peptide display libraries. This comprises the generation of AAV2 peptide display libraries, a digital droplet PCR (dd-PCR) method for quantification, and finally an NGS pipeline to analyze the AAV variants, based in part on the work by Weinmann and colleagues24. Finally, a description of the generation of barcoded AAV libraries and the NGS pipeline used in the same publication is provided.
Access restricted. Please log in or start a trial to view this content.
1. AAV2 random 7-mer peptide display library preparation
NOTE: For the preparation of an AAV2 random peptide display library, synthesize the degenerate oligonucleotides as single-stranded DNA, convert it to double-stranded DNA, digest, ligate to the acceptor plasmid, and electroporate.


2. AAV2 random 7-mer peptide display library selection
3. Barcoded AAV capsid library preparation and analysis
NOTE: Following the identification of a set of potentially specific and efficient AAV capsids in the peptide display screen, verify the functionality of the identified peptide sequences and compare them with a set of commonly used or well-described reference AAV capsid variants. To do this, the capsid sequence is inserted into a Rep/Cap helper construct without ITRs.
Access restricted. Please log in or start a trial to view this content.
Generation of an AAV2 peptide display library. As a first step toward the selection of engineered AAVs, the generation of a plasmid library is described. The peptide insert is produced by using degenerate primers. Reducing the combination of codons in those from 64 to 20 has the advantages of eliminating stop codons and facilitating NGS analysis, by reducing library diversity on the DNA but not the protein level. The oligonucleotide insert is purchased as single-stranded DNA (Figure ...
Access restricted. Please log in or start a trial to view this content.
In this protocol, the steps needed for peptide display AAV capsid engineering and for barcoded AAV library screening, as well as for bioinformatic analysis of library composition and capsid performance, are outlined. This protocol focuses on the steps that facilitate the bioinformatic analysis of these types of libraries, because most virology laboratories lag in programming skills to match their proficiency in molecular biology techniques. Both types of libraries have been extensively described in the literature, as out...
Access restricted. Please log in or start a trial to view this content.
D.G. is a co-founder of AaviGen GmbH. D.G. and K.R. are inventors on a pending patent application related to the generation of immune-evading AAV capsid variants. The rest of the authors have nothing to disclose.
D.G. greatly appreciates support by the German Research Foundation (DFG) through the DFG Collaborative Research Centers SFB1129 (Projektnummer 240245660) and TRR179 (Projektnummer 272983813), as well as by the German Center for Infection Research (DZIF, BMBF; TTU-HIV 04.819).
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Amplification primer | ELLA Biotech (Munich, Germany) | - | Second-strand synthesis of oligonucleotide insert |
| Agilent DNA 1000 Reagents | Agilent Technologies (Santa Clara, CA, USA) | 5067-1504 | DNA fragment validation |
| Agilent 2100 Bioanalyzer System | Agilent Technologies (Santa Clara, CA, USA) | G2938C | DNA fragment validation |
| AllPrep DNA/RNA Mini Kit | Qiagen (Venlo, Netherlands) | 80204 | DNA/RNA extraction |
| Agilent DNA 1000 Reagents | Agilent Technologies (Santa Clara, CA, USA) | 5067-1504 | NGS Library preparation |
| Agilent 2100 Bioanalyzer System | Agilent Technologies (Santa Clara, CA, USA) | G2938C | NGS Library preparation |
| BC-seq fw: | IDT (San Joce, CA, CA, USA) | ATCACTCTCGGCATGGACGAGC | NGS Library preparation |
| BC-seq rv: | IDT (San Joce, CA, CA, USA) | GGCTGGCAACTAGAAGGCACA | NGS Library preparation |
| β-Mercaptoethanol | Millipore Sigma (Burlington, MA, USA) | 44-420-3250ML | DNA/RNA extraction |
| BglI | New England Biolabs (Ipswich, MA, USA) | R0143 | Digestion of double-stranded insert |
| C1000 Touch Thermal Cycler | Bio-Rad (Hercules, CA, USA) | 1851196 | dd-PCR cycler |
| dNTPS | New England Biolabs (Ipswich, MA, USA) | N0447S | NGS Library preparation |
| ddPCR Supermix for probes (no dUTP) | Bio-Rad (Hercules, CA, USA) | 1863024 | dd-PCR supermix |
| Droplet Generation Oil for Probes | Bio-Rad (Hercules, CA, USA) | 1863005 | dd-PCR droplet generation oil |
| DG8 Cartridges for QX100 / QX200 Droplet Generator | Bio-Rad (Hercules, CA, USA) | 1864008 | dd-PCR droplet generation cartridge |
| DG8 Cartridge Holder | Bio-Rad (Hercules, CA, USA) | 1863051 | dd-PCR cartridge holder |
| Droplet Generator DG8 Gasket | Bio-Rad (Hercules, CA, USA) | 1863009 | dd-PCR cover for cartridge |
| ddPCR Plates 96-Well, Semi-Skirted | Bio-Rad (Hercules, CA, USA) | 12001925 | dd-PCR 96-well plate |
| E.cloni 10G SUPREME Electrocompetent Cells | Lucigen (Middleton, WI, USA) | 60081-1 | Electrocompetent cells |
| Electroporation cuvettes, 1mm | Biozym Scientific (Oldendorf, Germany) | 748050 | Electroporation |
| GAPDH primer/probe mix | Thermo Fischer Scientific (Waltham, MA, USA) | Mm00186825_cn | Taqman qPCR primer |
| Genepulser Xcell | Bio-Rad (Hercules, CA, USA) | 1652660 | Electroporation |
| High-Capacity cDNA Reverse Transcription Kit | Applied Biosystems (Waltham, MA, USA) | 4368814 | cDNA reverse transcription |
| ITR_fw | IDT (San Joce, CA, USA) | GGAACCCCTAGTGATGGAGTT (https://signagen.com/blog/2019/10/25/qpcr-primer-and-probe-sequences-for-raav-titration/) | dd-PCR primer |
| ITR_rv | IDT (San Joce, CA, USA) | CGGCCTCAGTGAGCGA (https://signagen.com/blog/2019/10/25/qpcr-primer-and-probe-sequences-for-raav-titration/) | dd-PCR primer |
| ITR_probe | IDT (San Joce, CA, USA) | HEX-CACTCCCTCTCTGCGCGCTCG-BHQ1 (https://signagen.com/blog/2019/10/25/qpcr-primer-and-probe-sequences-for-raav-titration/) | dd-PCR probe |
| Illumina NextSeq 500 system | Illumina Inc (San Diego, CA, USA) | SY-415-1001 | NGS Library sequencing |
| KAPA HiFi HotStart ReadyMix (2X)* | Roche AG (Basel, Switzerland) | KK2600 07958919001 | NGS sample prepration |
| MagnaBot 96 Magnetic Separation Device | Promega GmbH (Madison, WI, USA) | V8151 | Sample prepration for NGS library |
| NanoDrop 2000 spectrophotometer | Thermo Fischer Scientific (Waltham, MA, USA) | ND-2000 | Digestion of double-stranded insert |
| NGS_frw | Sigma-Aldrich (Burlinght, MA, USA) | GTT CTG TAT CTA CCA ACC TC | NGS primer |
| NGS_rev | Sigma-Aldrich (Burlinght, MA, USA) | CGC CTT GTG TGT TGA CAT C | NGS primer |
| NextSeq 500/550 High Output Kit (75 cycles) | Illumina Inc (San Diego, CA, USA) | FC-404-2005 | NGS Library sequencing |
| Ovation Library System for Low Complexity Samples Kit | NuGEN Technologies, Inc. (San Carlos, CA, USA) | 9092-256 | NGS Library preparation |
| PX1 Plate Sealer | Bio-Rad (Hercules, CA, USA) | 1814000 | dd-PCR plate sealer |
| Pierceable Foil Heat Seal | Bio-Rad (Hercules, CA, USA) | 1814040 | dd-PCR sealing foil |
| Phusion High-Fidelity DNA-Polymerase | Thermo Fischer Scientific (Waltham, MA, USA) | F530S | Second-strand synthesis of oligonucleotide insert |
| PEI MAX - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000) | Polysciences, Inc. (Warrington, PA, USA) | 24765-1G | AAV library preparation |
| ProNex Size-Selective Purification System | Promega GmbH (Madison, WI, USA) | NG2002 | Sample prepration for NGS library |
| Phusion Hot Start II Polymerase | Thermo Fischer Scientific (Waltham, MA, USA) | F549L | NGS Library preparation |
| Proteinase K | Roche AG (Basel, Switzerland) | 5963117103 | DNA/RNA extraction |
| pRep2Cap2_PIS | ITR-Rep2Cap2-ITR vector. Peptide insertion site within the Cap2 ORF, manufactured/prepared in the lab | ||
| QX200 Droplet Generator | Bio-Rad (Hercules, CA, USA) | 1864002 | dd-PCR droplet generator |
| QX200 Droplet Reader | Bio-Rad (Hercules, CA, USA) | 1864003 | dd-PCR droplet analysis |
| QIAquick Nucleotide Removal Kit | Qiagen (Venlo, Netherlands) | 28306 | Second-strand synthesis of oligonucleotide insert purification |
| QIAquick Gel Extraction Kit | Qiagen (Venlo, Netherlands) | 28704 | Plasmid vector purification |
| QIAGEN Plasmid Maxi Kit | Qiagen (Venlo, Netherlands) | 12162 | Plasmid library DNA preparation |
| Qiaquick PCR Purification kit | Qiagen (Venlo, Netherlands) | 28104 | Sample prepration for NGS library |
| Qubit fluorometer | Invitrogen (Waltham, MA, USA) | Q32857 | NGS Library preparation |
| Qubit dsDNA HS | Thermo Fischer Scientific (Waltham, MA, USA) | Q32851 | NGS Library preparation |
| QuantiFast PCR Master Mix | Qiagen (Venlo, Netherlands) | 1044234 | Taqman qPCR |
| rep_fw | IDT (San Joce, CA, USA) | AAGTCCTCGGCCCAGATAGAC | dd-PCR primer |
| rep_rv | IDT (San Joce, CA, USA) | CAATCACGGCGCACATGT | dd-PCR primer |
| rep_probe | IDT (San Joce, CA, USA) | FAM-TGATCGTCACCTCCAACA-BHQ1 | dd-PCR probe |
| RNase-free DNase | Qiagen (Venlo, Netherlands) | 79254 | DNA/RNA extraction |
| SfiI | New England Biolabs (Ipswich, MA, USA) | R0123 | Digestion of vector |
| 5 mm, steel Beads | Qiagen (Venlo, Netherlands) | 69989 | DNA/RNA extraction |
| TRIMER-oligonucleotides | ELLA Biotech (Munich, Germany) | - | Degenerate oligonucleotide |
| T4 Ligase | New England Biolabs (Ipswich, MA, USA) | M0202L | Plasmid library ligation |
| TissueLyserLT | Qiagen (Venlo, Netherlands) | 85600 | DNA/RNA extraction |
| YFP_fw | IDT (San Joce, CA, USA) | GAGCGCACCATCTTCTTCAAG | dd-PCR primer |
| YFP_rv | IDT (San Joce, CA, USA) | TGTCGCCCTCGAACTTCAC | dd-PCR primer |
| YFP_probe | IDT (San Joce, CA, USA) | FAM-ACGACGGCAACTACA-BHQ1 | dd-PCR probe |
| Zymo DNA Clean & Concentrator-5 (Capped) | Zymo research (Irvine, CA, USA) | D4013 | Vector and Ligation purification |
Access restricted. Please log in or start a trial to view this content.