A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Establishing 3D Endometrial Organoids from the Mouse Uterus

7.9K views

DOI:

10.3791/64448

January 6th, 2023

In This Article

Summary

This protocol describes methodologies to establish mouse endometrial epithelial organoids for gene expression and histological analyses.

Abstract

Endometrial tissue lines the inner cavity of the uterus and is under the cyclical control of estrogen and progesterone. It is a tissue that is composed of luminal and glandular epithelium, a stromal compartment, a vascular network, and a complex immune cell population. Mouse models have been a powerful tool to study the endometrium, revealing critical mechanisms that control implantation, placentation, and cancer. The recent development of 3D endometrial organoid cultures presents a state-of-the-art model to dissect the signaling pathways that underlie endometrial biology. Establishing endometrial organoids from genetically engineered mouse models, analyzing their transcriptomes, and visualizing their morphology at a single-cell resolution are crucial tools for the study of endometrial diseases. This paper outlines methods to establish 3D cultures of endometrial epithelium from mice and describes techniques to quantify gene expression and analyze the histology of the organoids. The goal is to provide a resource that can be used to establish, culture, and study the gene expression and morphological characteristics of endometrial epithelial organoids.

Introduction

The endometrium - the inner lining mucosal tissue of the uterine cavity - is a unique and highly dynamic tissue that plays critical roles in a woman's reproductive health. During the reproductive lifespan, the endometrium holds the potential to undergo hundreds of cycles of proliferation, differentiation, and breakdown, coordinated by the concerted action of the ovarian hormones - estrogen and progesterone. Studies of genetically engineered mice have uncovered basic biological mechanisms underpinning the endometrial response to hormones and control of embryo implantation, stromal cell decidualization, and pregnancy1. In vitro studies, however, have been limited due to difficulties in maintaining non-transformed primary mouse endometrial tissues in traditional 2D cell cultures2,3. Recent advances in the culture of endometrial tissues as 3D organ systems, or organoids, present a novel opportunity to investigate biological pathways that control endometrial cell regeneration and differentiation. Mouse and human endometrial organoid systems have been developed from pure endometrial epithelium encapsulated in various matrices4,5, while human endometrium has been cultured as scaffold-free epithelial/stromal co-cultures6,7, and more recently as collagen-encapsulated epithelial/stromal assembloids8. The growth and regenerative potential of epithelial organoid cultures is supported by a defined cocktail of growth factors and small molecule inhibitors that have been empirically determined to maximize growth and regeneration of the organoids4,5,9. Furthermore, the ability to freeze and thaw endometrial organoids permits the long-term banking of endometrial organoids from mice and humans for future studies.

Genetically engineered mice have revealed the complex signaling pathways that control early pregnancy and decidualization, and have been used as models of pregnancy loss, endometrial cancer, and endometriosis. These genetic studies have been largely achieved with cell-specific deletion of loxP flanked alleles ("floxed") using cre recombinases that are specifically active in female reproductive tissues. These mouse models include the widely used progesterone receptor-cre10, which has strong recombinase activity in the endometrial epithelial and stromal tissues, lactoferrin i-cre, which induces endometrial epithelial recombination in adult mice11, or Wnt7a-cre, which triggers epithelial-specific deletion in Müllerian-derived tissues12. Culturing endometrial tissues from genetically engineered mouse models as 3D organoids has provided an excellent opportunity to investigate endometrial biology and facilitate the identification of growth factors and signaling pathways that control endometrial cell renewal and differentiation13,14. Methods for the isolation and culture of mouse endometrial tissue are described in the literature and report the use of various enzymatic strategies for the isolation of uterine epithelium for subsequent culturing of endometrial epithelial organoids4. While previous literature provides a critical framework for endometrial epithelial organoid culture protocols4,5,6, this paper provides a clear, comprehensive method for generating, maintaining, processing, and analyzing these organoids. Standardization of these techniques is important for accelerating advancements in the field of women's reproductive biology. Here, we report a detailed methodology for the enzymatic and mechanical purification of mouse endometrial epithelial tissue for the subsequent culture of endometrial organoids in a gel matrix scaffold. We also describe the methodologies for downstream histological and molecular analyses of the gel matrix-encapsulated mouse endometrial epithelial organoids.

Access restricted. Please log in or start a trial to view this content.

Protocol

Mouse handling and experimental studies were performed under protocols approved by the Institutional Animal Care and Use Committee (IACUC) of Baylor College of Medicine and guidelines established by the NIH Guide for the Care and Use of Laboratory Animals.

1. Isolation of uterine epithelium from mice using enzymatic and mechanical methods

NOTE: This section describes the steps required to establish, passage, freeze, and thaw epithelial endometrial organoids from mice using a gel matrix scaffold. Previous studies have determined that optimal cultures of mouse endometrial organoids are established from mice during the estrus phase4, which can be determined by cytological examination of a vaginal swab15. Adult female WT mice (6-8 weeks old, hybrid C57BL/6J and 129S5/SvEvBrd) were used for all experiments. The mice were humanely euthanized according to IACUC-approved guidelines using isoflurane sedation followed by cervical disarticulation. Once the mice are euthanized, the following steps should be followed. See the Table of Materials for details related to materials and solutions used in this protocol.

  1. Allow the gel matrix to thaw on ice for approximately 1-2 h before use.
  2. To dissect the mouse, use scissors to make a mid-line incision on the abdomen and gently peel back the skin to expose the underlying peritoneal layer. Use forceps to hold up the peritoneal layer and make lateral incisions with the scissors to expose the abdominal contents.
    1. Locate the uterine horns by gently moving the abdominal fat pads aside. Dissect them by first holding them at the cervical junction and using scissors to cut along the mesenteric fat. Following the dissection of the mouse uterus, thoroughly remove fat tissue from the uterine horn with small scissors.
      NOTE: Maintain sterility during the cell isolation by sterilizing all surgery tools before use, spray the mouse abdomen with 70% ethanol, and perform all steps following dissection under a sterile tissue culture hood.
  3. Cut each uterine horn into small fragments, each measuring approximately 4-5 mm.
  4. Place all the uterine fragments from one uterus into one well of a 24-well plate containing 0.5 mL of 1% Trypsin. Allow the enzymatic solution to enter the uterine lumen, causing enzymatic separation of the endometrial epithelium from the underlying stroma.
  5. Incubate the 24-well plate in a 37 ˚C humidified tissue culture incubator for approximately 1 h.
  6. After the 1 h incubation, transfer the uterine fragments to a 35 mm tissue culture plate containing 1 mL of Dulbecco's phosphate-buffered solution (DPBS).
  7. Under a dissection microscope, use fine forceps and a 1 mL pipette to mechanically separate the uterine epithelium from the uterine tube. While holding down one end of a uterine fragment with the forceps, gently run the pipette tip longitudinally across the fragment, squeezing the epithelium out of the other end of the uterine tube. Observe the separated epithelial sheets from the uterine fragment under the dissection microscope.
  8. Use the 1 mL pipette to collect and gently transfer the epithelial sheets into a 1.5 mL tube.
  9. Repeat the process for the remaining uterine fragments, transferring all the epithelial sheets to the same collection tube.
  10. Pellet the dissociated epithelial sheets by centrifugation for 5 min at 375 × g.
  11. Carefully remove the supernatant to avoid disturbing the cell pellet.
  12. Resuspend the cell pellet in 0.5 mL of 2.5 mg/mL collagenase + 2 mg/mL DNase solution. Pipette up and down approximately 10x, or until a single-cell suspension is achieved.
  13. Add 0.5 mL of DMEM/F12 + 10% fetal bovine serum (FBS) + antibiotics, and centrifuge the cells for 5 min at 375 × g.
    ​NOTE: For additional information on the broad-spectrum antibiotic used for cell culture, refer to the Table of Materials.
  14. Carefully remove the supernatant and resuspend the cells in 1 mL of DMEM/F12 + 10% FBS + antibiotics. Centrifuge the cells for 5 min at 375 × g.

2. Processing of the stromal compartment

NOTE: This section outlines the protocols necessary for isolating the stromal compartment of the mouse endometrium. Given the increasing interest in epithelial/stromal co-culture experiments, it is important to be able to process the stromal cell populations in addition to the epithelial cells that will generate organoids.

  1. Once all the epithelium has been enzymatically and mechanically separated from the uterine fragments, the remaining tube-like structures are the "stromal/myometrial" compartments. Collect this tissue in a 2.5 mg/mL collagenase + 2 mg/mL DNase in HBSS solution.
  2. Incubate the stromal/myometrial sample on a 37 ˚C shaker for 15 min.
  3. Following incubation, add 500 µL of DMEM/F12 + 10% FBS + antibiotics per mouse, and filter the non-dissociated fragments through a 40 µm cell filter.
  4. Pellet the cells by centrifugation for 5 min at 375 × g.
  5. Carefully remove the supernatant and resuspend the cell pellet in 1 mL of DMEM/F12 + 10% FBS + antibiotics. Add the mixture dropwise to 10 mL of DMEM/F12 + 10% FBS + antibiotics in a 10 cm cell culture plate. Incubate the plate at 37 ˚C in a humidified cell culture incubator.
  6. To generate co-cultures of mouse endometrial epithelial and stromal cells, follow the methods described for human endometrial organoids using scaffold-free or collagen matrix systems6,8.
    ​NOTE: While these techniques have not yet been published for mice, they can be adapted based on the published protocols with human endometrium.

3. Encapsulation of uterine epithelium into gel matrix to establish organoids

NOTE: Keep the gel matrix on ice until it is ready to be used.

  1. Remove the supernatant and resuspend the cell pellet in a volume of gel matrix that is 20x that of the cell pellet (i.e., if the cell pellet is 20 µL, resuspend the cells with 400 µL of gel matrix). Resuspend the pellet carefully to avoid introducing bubbles.
  2. Allow the gel matrix/cell suspension to settle at room temperature for ~10 min.
  3. Once the gel matrix/cell suspension becomes a semi-solid gel, use a P200 micropipette with a wide bore 200 µL tip to gently aspirate 25 µL of the gel matrix/cell suspension. Dispense three separate 25 µL domes per well of a 12-well plate, and allow the gel matrix to cure for 15 min in a 37 ˚C humidified tissue culture incubator.
  4. After the gel matrix has cured, add 750 µL of organoid medium to each well containing gel matrix domes. Incubate at 37 ˚C in a humidified tissue culture incubator.
    ​NOTE: Organoid media formulation is noted in the Table of Materials. Organoids typically form within 4 days of initial culture.

4. Gene expression analysis of endometrial organoids following treatment with estradiol

NOTE: This section describes the methods used to profile the gene expression of endometrial epithelial organoids using real-time qPCR following treatment with estradiol (E2; see Table 1). Because the endometrium is under the cyclical control of the ovarian hormone E2, testing the responsiveness of the organoids to E2 is an important measure of physiological function. We have obtained high-quality RNA and generated sufficient mRNA to profile gene expression using qPCR and/or RNA-sequencing from our endometrial epithelial organoids. This section describes how to collect organoids and process them for downstream analysis of gene expression. The selected treatment medium reflects the one used to treat cultured endometrial cells. However, it should be noted that this treatment medium can be optimized accordingly, as done for the treating of human endometrial 3D cultures with hormones8,16,17.

  1. Culture the endometrial organoids as described above.
  2. Remove the organoid medium and replace it with 750 µL of starvation medium four days after seeding. Incubate overnight.
  3. The following morning, remove the starvation medium. Add 750 µL of treatment medium containing either vehicle or 10 nM E2. Incubate for 48 h.
  4. Proceed with RNA isolation following the kit manufacturer's protocol.

5. Histological analysis of endometrial organoids

NOTE: Imaging the morphological features of endometrial organoids is critical to evaluating the cellular effect of growth factors, genetic manipulations, or small molecule inhibitors. This section describes the techniques used to fix, process, and image endometrial epithelial organoids using histological stains and antibody immunofluorescent staining.

  1. Prepare 1.5 mL microcentrifuge tubes containing 1 mL of 4% paraformaldehyde in 1x PBS. Place them on ice.
  2. Aspirate the medium from the wells of the 12-well plate containing the organoids.
  3. Using a 1 mL pipette tip with a cut tip, transfer 500 µL of 4% paraformaldehyde to each well and gently detach the gel matrix domes from the bottom of the plate.
  4. Gently aspirate the entire gel matrix domes into the pipette tip and transfer to the 1.5 mL microcentrifuge tube.
  5. Fix the organoids by placing them on a rotator at 4 ˚C overnight.
  6. The following morning, centrifuge the tube at 600 × g for 5 min to pellet the organoids. Gently remove the 4% paraformaldehyde solution with a pipette and discard. Wash the organoids 2x with 70% ethanol.
  7. After the last wash, remove all but 50-100 µL of ethanol from the tube. Set the tube aside.
  8. Place a tube of specimen processing gel in a water bath and microwave for ~30 s to melt the gel. Ensure that the specimen processing gel does not boil over by monitoring the consistency of the gel.
    NOTE: Once the specimen processing gel is melted, but not boiling hot, work quickly to encapsulate the organoids.
  9. Transfer enough specimen processing gel to cover the entire surface of the mold (approximately 250 µL).
  10. While the specimen processing gel is still molten, quickly transfer the 50 µL of 70% ethanol solution containing the organoids. Ensure that the organoids are sunken or pushed to the bottom portion of the mold.
  11. Place the histology mold on a bucket of ice and allow the specimen processing gel to cool and solidify.
  12. Once the specimen processing gel is completely dry, carefully transfer the specimen processing gel square to a specimen bag, keeping track of the plane where the organoids are located.
  13. Place the bag in a histology cassette and process using standard methods used for formalin fixation and paraffin embedding of tissues18.
  14. Following fixation and embedding in paraffin, section into 5 µm sections using a microtome19. Proceed with standard hematoxylin and eosin (H&E) staining or immunostaining procedures, as outlined below.

6. Hematoxylin & eosin staining

  1. Deparaffinize the sections as follows: xylene, 2 x 10 min; 100% ethanol, 2 x 3 min; 80% ethanol, 3 min; 60% ethanol, 3 min; dH2O, 2 x 3 min; 1 min in hematoxylin; tap water (3 x 5 s); 1 min in eosin.
  2. Dehydrate the sections as follows: 60% ethanol, 3 min; 80% ethanol, 3 min; 95% ethanol, 3 min; 100% ethanol, 2 x 3 min; xylene, 2 x 15 min.
  3. Mount using mounting medium.

7. Immunofluorescence staining

  1. Deparaffinize the sections as described in step 6.1.
  2. Perform antigen retrieval
    1. Submerge the slides in antigen retrieval solution in a microwave-safe container.
    2. Microwave at high heat for 20 min, using 5 min intervals to ensure that the solution does not boil over.
  3. After the 20 min antigen retrieval step is complete, allow the slides to cool on ice for 40 min while still submerged in antigen retrieval buffer.
  4. Wash the slides with 1x TBST for 3 min
  5. Block the slides by incubating in 3% BSA in TBST for 1 h at room temperature.
  6. Primary antibody incubation
    1. Dilute the antibody in 3% BSA in TBST (1:50-1:1,000, depending on Ab).
    2. Incubate overnight at 4 °C in a humidified chamber.
    3. Wash 3 x 5 min with TBST.
  7. Secondary antibody incubation
    1. Dilute the antibody in 3% BSA (in TBST) (1:250), or in 5% normal donkey serum.
    2. Incubate for 1 h at room temperature (RT) in the dark, since the antibody is conjugated to a fluorophore.
  8. Nuclear staining
    1. Dilute 4′,6-diamidino-2-phenylindole (DAPI) 1:1,000 in TBST.
    2. Incubate for 5 min at RT.
    3. Wash 2 x 5 min with TBST.
  9. Mounting
    1. Use one drop of mounting medium to mount the coverslip.
    2. Seal the coverslip using nail polish the following day.

Access restricted. Please log in or start a trial to view this content.

Results

Phase contrast images of mouse endometrial organoids
We established organoids from WT mouse endometrial epithelium, as described in the attached protocol (see diagram in Figure 1). Following enzymatic dissociation of the mouse endometrial epithelium, epithelial sheets were mechanically separated from the uterine stromal cells and further dissociated with collagenase to generate a single-cell suspension. If performed correctly, this method of epithelial and stromal cell s...

Access restricted. Please log in or start a trial to view this content.

Discussion

Here, we describe methods to generate endometrial epithelial organoids from mouse endometrium and the protocols routinely used for their downstream analysis. Endometrial organoids are a powerful tool to study the mechanisms that control endometrial-related diseases, such as endometriosis, endometrial cancer, and implantation failure. Landmark studies published in 2017 reported the conditions to culture long-term and renewable cultures of endometrial organoids from mouse and human epithelium4,...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have no conflicts of interest to disclose.

Acknowledgements

We thank Dr. Stephanie Pangas and Dr. Martin M. Matzuk (M.M.M.) for critical reading and editing of our manuscript. Studies were supported by Eunice Kennedy Shriver National Institute of Child Health and Human Development grants R00-HD096057 (D.M.), R01-HD105800 (D.M.), R01-HD032067 (M.M.M.), and R01-HD110038 (M.M.M.), and by NCI- P30 Cancer Center Support Grant (NCI-CA125123). Diana Monsivais, Ph.D. holds a Next Gen Pregnancy Award from the Burroughs Wellcome Fund.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Organoid Media Formulation
NameCompanyCatalog NumberFinal concentration
Corning Matrigel Growth Factor Reduced (GFR) Basement Membrane Matrix, *LDEV-freeCorning354230100%
Trypsin from Bovine PancreasSigma AldrichT1426-1G1%
Advanced DMEM/F12Life Technologies126340101X
N2 supplementLife Technologies175020481X
B-27™ Supplement (50X), minus vitamin ALife Technologies125870101X
PrimocinInvivogenant-pm-1100 µg/mL
N-Acetyl-L-cysteineSigma AldrichA9165-5G1.25 mM
L-glutamineLife Technologies250300242 mM
NicotinamideSigma AldrichN0636-100G10 nM
ALK-4, -5, -7 inhibitor, A83-01Tocris2939500 nM
Recombinant human EGFPeprotechAF-100-1550 ng/mL
Recombinant human NogginPeprotech120-10C100 ng/mL
Recombinant human Rspondin-1Peprotech120-38500 ng/mL
Recombinant human FGF-10Peprotech100-26100 ng/mL
Recombinant human HGFPeprotech100-3950 ng/mL
WNT3aR&D systems5036-WN200 ng/mL
Other supplies and reagents
NameCompanyCatalog NumberFinal concentration
Collagenase from Clostridium histolyticumSigma AldrichC0130-1G5 mg/mL
Deoxyribonuclease I from bovine pancreasSigma AldrichDN25-100MG2 mg/mL
DPBS, no calcium, no magnesiumThermoFisher14190-2501X
HBSS, no calcium, no magnesiumThermoFisher141701121X
Falcon Polystyrene Microplates (24-Well)Fisher Scientific#08-772-51
Falcon Polystyrene Microplates (12-Well)Fisher Scientific#0877229
Falcon Cell Strainers, 40 µmFisher Scientific#08-771-1
Direct-zol RNA MiniPrep (50 µg)Genesee Scientific11-331
Trizol reagentInvitrogen15596026
DMEM/F-12, HEPES, no phenol redThermoFisher11039021
Fetal Bovine Serum, Charcoal strippedSigma AldrichF6765-500ML2%
Estratiol (E2)Sigma AldrichE1024-1G10 nM
Formaldehyde 16% in aqueous solution, EM GradeVWR157104%
Epredia Cassette 1 Slotted Tissue CassettesFisher Scientific1000961
Epredia Stainless-Steel Embedding Base MoldsFisher Scientific64-010-15 
Ethanol, 200 proof (100%)Fisher Scientific22-032-601 
HistoclearFisher Scientific50-899-90147
Permount Mounting MediumFisher Scientific50-277-97
Epredia Nylon Biopsy BagsFisher Scientific6774010
HistoGel Specimen Processing GelVWR83009-992
Hematoxylin solution PremiumVWR95057-844
Eosin Y (yellowish) solution PremiumVWR95057-848
TBS Buffer, 20X, pH 7.4GenDEPORTT80541X
TBST (10X), pH 7.4GenDEPORTT80561X
Citric acid Sigma AldrichC0759-1KG
Sodium citrate tribasic dihydrateSigma AldrichS4641-500G
Tween20Fisher ScientificBP337-500 
Bovine Serum Albumin (BSA)Sigma AldrichA2153-100G3%
DAPI Solution (1 mg/mL)ThermoFisher622481:1000 dilution
VECTASHIELD Antifade Mounting MediumVector LabsH-1000-10
Clear Nail PolishFisher ScientificNC1849418
Fisherbrand Superfrost Plus Microscope SlidesFisher Scientific22037246
VWR Micro Cover GlassesVWR48393-106
SuperScript VILO Master MixThermoFisher11755050
SYBR Green PCR Master MixThermoFisher4364346
Krt8 Antibody (TROMA-I) DSHBTROMA-I 1:50 dilution
Vimentin AntobodyCell Signaling5741S1:200 dilution
Donkey anti-Rat IgG (H+L) Highly Cross-Adsorbed Secondary
Antibody, Alexa Fluor 594
ThermoFisherA-212091:250 dilution
Donkey anti-Rabbin IgG (H+L) Highly Cross-Adsorbed Secondary
Antibody, Alexa Fluor 488
ThermoFisherA-212061:250 dilution
ZEISS Stemi 508 Stereo MicroscopeZEISS
ZEISS Axio Vert.A1 Inverted Routine Microscope with digital cameraZEISS
Primer SequenceForward (5'-3')Reverse (5'-3')_
Lipocalin 2 (Lcn2)GCAGGTGGTACGTTGTGGGCTCTTGTAGCTCATAGATGGTGC
Lactoferrin (Ltf)TGAGGCCCTTGGACTCTGTACCCACTTTTCTCATCTCGTTC
Progesterone (Pgr)CCCACAGGAGTTTGTCAAGCTCTAACTTCAGACATCATTTCCGG
Glyceraldehyde 3 phosphate dehydrogenase (Gapdh)CAATGTGTCCGTCGTGGATCTGCCTGCTTCACCACCTTCTT

References

  1. Wang, H., Dey, S. K. Roadmap to embryo implantation: clues from mouse models. Nature Reviews Genetics. 7 (3), 185-199 (2006).
  2. Hibaoui, Y., Feki, A. Organoid models of human endometrial development and disease. Frontiers in Cell and Developmental Biology. 8, 84(2020).
  3. Rawlings, T. M., Makwana, K., Tryfonos, M., Lucas, E. S. Organoids to model the endometrium: implantation and beyond. Reproduction & Fertility. 2 (3), 85-101 (2021).
  4. Boretto, M., et al. Development of organoids from mouse and human endometrium showing endometrial epithelium physiology and long-term expandability. Development. 144 (10), 1775-1786 (2017).
  5. Turco, M. Y., et al. Long-term, hormone-responsive organoid cultures of human endometrium in a chemically defined medium. Nature Cell Biology. 19 (5), 568-577 (2017).
  6. Murphy, A. R., Wiwatpanit, T., Lu, Z., Davaadelger, B., Kim, J. J. Generation of multicellular human primary endometrial organoids. Journal of Visualized Experiments. (152), e60384(2019).
  7. Wiwatpanit, T., et al. Scaffold-free endometrial organoids respond to excess androgens associated with polycystic ovarian syndrome. The Journal of Clinical Endocrinology and Metabolism. 105 (3), 769-780 (2020).
  8. Rawlings, T. M., et al. Modelling the impact of decidual senescence on embryo implantation in human endometrial assembloids. Elife. 10, 69603(2021).
  9. Lou, L., Kong, S., Sun, Y., Zhang, Z., Wang, H. Human endometrial organoids: recent research progress and potential applications. Frontiers in Cell and Developmental Biology. 10, 844623(2022).
  10. Soyal, S. M., et al. Cre-mediated recombination in cell lineages that express the progesterone receptor. Genesis. 41 (2), 58-66 (2005).
  11. Daikoku, T., et al. Lactoferrin-iCre: a new mouse line to study uterine epithelial gene function. Endocrinology. 155 (7), 2718-2724 (2014).
  12. Winuthayanon, W., Hewitt, S. C., Orvis, G. D., Behringer, R. R., Korach, K. S. Uterine epithelial estrogen receptor alpha is dispensable for proliferation but essential for complete biological and biochemical responses. Proceedings of the National Academy of Sciences. 107 (45), 19272-19277 (2010).
  13. Seishima, R., et al. Neonatal Wnt-dependent Lgr5 positive stem cells are essential for uterine gland development. Nature Communications. 10 (1), 5378(2019).
  14. Syed, S. M., et al. Endometrial Axin2(+) cells drive epithelial homeostasis, regeneration, and cancer following oncogenic transformation. Cell Stem Cell. 26 (1), 64-80 (2020).
  15. Caligioni, C. S. Assessing reproductive status/stages in mice. Current Protocols in Neuroscience. , Appendix 4 Appendix 4I (2009).
  16. Fitzgerald, H. C., Schust, D. J., Spencer, T. E. In vitro models of the human endometrium: evolution and application for women's health. Biology of Reproduction. 104 (2), 282-293 (2021).
  17. Hewitt, S. C., et al. Progesterone signaling in endometrial epithelial organoids. Cells. 11 (11), 1760(2022).
  18. Sadeghipour, A., Babaheidarian, P. Making formalin-fixed, paraffin embedded blocks. Methods in Molecular Biology. 1897, 253-268 (2019).
  19. Qin, C., et al. The cutting and floating method for paraffin-embedded tissue for sectioning. Journal of Visualized Experiments. (139), e58288(2018).
  20. Rekhtman, N., et al. Novel modification of HistoGel-based cell block preparation method: improved sufficiency for molecular studies. Archives of Pathology & Laboratory Medicine. 142 (4), 529-535 (2018).
  21. Shidham, V. B. CellBlockistry: Chemistry and art of cell-block making - A detailed review of various historical options with recent advances. Cytojournal. 16, 12(2019).
  22. Ali, A., Syed, S. M., Tanwar, P. S. Protocol for in vitro establishment and long-term culture of mouse vaginal organoids. STAR Protocols. 1 (2), 100088(2020).
  23. Kurihara, I., et al. COUP-TFII mediates progesterone regulation of uterine implantation by controlling ER activity. PLoS Genet. 3 (6), 102(2007).
  24. McMaster, M. T., Teng, C. T., Dey, S. K., Andrews, G. K. Lactoferrin in the mouse uterus: analyses of the preimplantation period and regulation by ovarian steroids. Molecular Endocrinology. 6 (1), 101-111 (1992).
  25. Huang, H. L., Chu, S. T., Chen, Y. H. Ovarian steroids regulate 24p3 expression in mouse uterus during the natural estrous cycle and the preimplantation period. The Journal of Endocrinology. 162 (1), 11-19 (1999).
  26. Clevers, H. Modeling development and disease with organoids. Cell. 165 (7), 1586-1597 (2016).
  27. Bigsby, R. M., Cunha, G. R. Estrogen stimulation of deoxyribonucleic acid synthesis in uterine epithelial cells which lack estrogen receptors. Endocrinology. 119 (1), 390-396 (1986).
  28. Clementi, C., et al. Activin-like kinase 2 functions in peri-implantation uterine signaling in mice and humans. PLoS Genetics. 9 (11), 1003863(2013).
  29. Jeong, J. W., et al. Foxa2 is essential for mouse endometrial gland development and fertility. Biology of Reproduction. 83 (3), 396-403 (2010).
  30. Song, Y., et al. Endometriotic organoids: a novel in vitro model of endometriotic lesion development. bioRxiv. , (2022).
  31. Miyazaki, K., et al. Generation of progesterone-responsive endometrial stromal fibroblasts from human induced pluripotent stem cells: role of the WNT/CTNNB1 pathway. Stem Cell Reports. 11 (5), 1136-1155 (2018).
  32. Yoshimatsu, S., Kisu, I., Qian, E., Noce, T. A new horizon in reproductive research with pluripotent stem cells: successful in vitro gametogenesis in rodents, its application to large animals, and future in vitro reconstitution of reproductive organs such as "Uteroid" and "Oviductoid". Biology. 11 (7), 987(2022).
  33. Cheung, V. C., et al. Pluripotent stem cell-derived endometrial stromal fibroblasts in a cyclic, hormone-responsive, coculture model of human decidua. Cell Reports. 35 (7), 109138(2021).
  34. McGowen, M. R., Erez, O., Romero, R., Wildman, D. E. The evolution of embryo implantation. The International Journal of Development Biology. 58 (2-4), 155-161 (2014).
  35. Carson, D. D., et al. Embryo implantation. Developmental Biology. 223 (2), 217-237 (2000).
  36. Li, Y., Sun, X., Dey, S. K. Entosis allows timely elimination of the luminal epithelial barrier for embryo implantation. Cell Reports. 11 (3), 358-365 (2015).
  37. Jain, V., Chodankar, R. R., Maybin, J. A., Critchley, H. O. D. Uterine bleeding: how understanding endometrial physiology underpins menstrual health. Nature Reviews Endocrinology. 18 (5), 290-308 (2022).
  38. Hayashi, K., et al. Wnt genes in the mouse uterus: potential regulation of implantation. Biology of Reproduction. 80 (5), 989-1000 (2009).
  39. Dunlap, K. A., et al. Postnatal deletion of Wnt7a inhibits uterine gland morphogenesis and compromises adult fertility in mice. Biology of Reproduction. 85 (2), 386-396 (2011).
  40. Ter Steege, E. J., Bakker, E. R. M. The role of R-spondin proteins in cancer biology. Oncogene. 40 (47), 6469-6478 (2021).
  41. Brazil, D. P., Church, R. H., Surae, S., Godson, C., Martin, F. BMP signalling: agony and antagony in the family. Trends in Cell Biology. 25 (5), 249-264 (2015).
  42. Tojo, M., et al. The ALK-5 inhibitor A-83-01 inhibits Smad signaling and epithelial-to-mesenchymal transition by transforming growth factor-beta. Cancer Science. 96 (11), 791-800 (2005).
  43. Zhang, Y., Que, J. BMP signaling in development, stem cells, and diseases of the gastrointestinal tract. Annual Review of Physiology. 82, 251-273 (2020).
  44. Plikus, M. V., et al. Cyclic dermal BMP signalling regulates stem cell activation during hair regeneration. Nature. 451 (7176), 340-344 (2008).
  45. Gurung, S., Werkmeister, J. A., Gargett, C. E. Inhibition of transforming growth factor-β receptor signaling promotes culture expansion of undifferentiated human endometrial mesenchymal stem/stromal cells. Scientific Reports. 5, 15042(2015).
  46. Lucciola, R., et al. Impact of sustained transforming growth factor-β receptor inhibition on chromatin accessibility and gene expression in cultured human endometrial MSC. Frontiers in Cell and Developmental Biology. 8, 567610(2020).
  47. Hernandez-Gordillo, V., et al. Fully synthetic matrices for in vitro culture of primary human intestinal enteroids and endometrial organoids. Biomaterials. 254, 120125(2020).
  48. Gnecco, J. S., et al. Physiomimetic Models of Adenomyosis. Seminars in Reproductive Medicine. 38 (2-03), 179-196 (2020).
  49. Nikolakopoulou, K., Turco, M. Y. Investigation of infertility using endometrial organoids. Reproduction. 161 (5), 113-127 (2021).
  50. Kim, J. J. Preparing for implantation. Elife. 10, 73739(2021).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Uterine Epithelium3D Organoid CultureMechanical DissociationEnzymatic DissociationGene ExpressionImmunostainingStromal CompartmentFluorescence Microscopy