This protocol describes methodologies to establish mouse endometrial epithelial organoids for gene expression and histological analyses.
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
This protocol describes methodologies to establish mouse endometrial epithelial organoids for gene expression and histological analyses.
Endometrial tissue lines the inner cavity of the uterus and is under the cyclical control of estrogen and progesterone. It is a tissue that is composed of luminal and glandular epithelium, a stromal compartment, a vascular network, and a complex immune cell population. Mouse models have been a powerful tool to study the endometrium, revealing critical mechanisms that control implantation, placentation, and cancer. The recent development of 3D endometrial organoid cultures presents a state-of-the-art model to dissect the signaling pathways that underlie endometrial biology. Establishing endometrial organoids from genetically engineered mouse models, analyzing their transcriptomes, and visualizing their morphology at a single-cell resolution are crucial tools for the study of endometrial diseases. This paper outlines methods to establish 3D cultures of endometrial epithelium from mice and describes techniques to quantify gene expression and analyze the histology of the organoids. The goal is to provide a resource that can be used to establish, culture, and study the gene expression and morphological characteristics of endometrial epithelial organoids.
The endometrium - the inner lining mucosal tissue of the uterine cavity - is a unique and highly dynamic tissue that plays critical roles in a woman's reproductive health. During the reproductive lifespan, the endometrium holds the potential to undergo hundreds of cycles of proliferation, differentiation, and breakdown, coordinated by the concerted action of the ovarian hormones - estrogen and progesterone. Studies of genetically engineered mice have uncovered basic biological mechanisms underpinning the endometrial response to hormones and control of embryo implantation, stromal cell decidualization, and pregnancy1. In vitro studies, however, have been limited due to difficulties in maintaining non-transformed primary mouse endometrial tissues in traditional 2D cell cultures2,3. Recent advances in the culture of endometrial tissues as 3D organ systems, or organoids, present a novel opportunity to investigate biological pathways that control endometrial cell regeneration and differentiation. Mouse and human endometrial organoid systems have been developed from pure endometrial epithelium encapsulated in various matrices4,5, while human endometrium has been cultured as scaffold-free epithelial/stromal co-cultures6,7, and more recently as collagen-encapsulated epithelial/stromal assembloids8. The growth and regenerative potential of epithelial organoid cultures is supported by a defined cocktail of growth factors and small molecule inhibitors that have been empirically determined to maximize growth and regeneration of the organoids4,5,9. Furthermore, the ability to freeze and thaw endometrial organoids permits the long-term banking of endometrial organoids from mice and humans for future studies.
Genetically engineered mice have revealed the complex signaling pathways that control early pregnancy and decidualization, and have been used as models of pregnancy loss, endometrial cancer, and endometriosis. These genetic studies have been largely achieved with cell-specific deletion of loxP flanked alleles ("floxed") using cre recombinases that are specifically active in female reproductive tissues. These mouse models include the widely used progesterone receptor-cre10, which has strong recombinase activity in the endometrial epithelial and stromal tissues, lactoferrin i-cre, which induces endometrial epithelial recombination in adult mice11, or Wnt7a-cre, which triggers epithelial-specific deletion in Müllerian-derived tissues12. Culturing endometrial tissues from genetically engineered mouse models as 3D organoids has provided an excellent opportunity to investigate endometrial biology and facilitate the identification of growth factors and signaling pathways that control endometrial cell renewal and differentiation13,14. Methods for the isolation and culture of mouse endometrial tissue are described in the literature and report the use of various enzymatic strategies for the isolation of uterine epithelium for subsequent culturing of endometrial epithelial organoids4. While previous literature provides a critical framework for endometrial epithelial organoid culture protocols4,5,6, this paper provides a clear, comprehensive method for generating, maintaining, processing, and analyzing these organoids. Standardization of these techniques is important for accelerating advancements in the field of women's reproductive biology. Here, we report a detailed methodology for the enzymatic and mechanical purification of mouse endometrial epithelial tissue for the subsequent culture of endometrial organoids in a gel matrix scaffold. We also describe the methodologies for downstream histological and molecular analyses of the gel matrix-encapsulated mouse endometrial epithelial organoids.
Access restricted. Please log in or start a trial to view this content.
Mouse handling and experimental studies were performed under protocols approved by the Institutional Animal Care and Use Committee (IACUC) of Baylor College of Medicine and guidelines established by the NIH Guide for the Care and Use of Laboratory Animals.
1. Isolation of uterine epithelium from mice using enzymatic and mechanical methods
NOTE: This section describes the steps required to establish, passage, freeze, and thaw epithelial endometrial organoids from mice using a gel matrix scaffold. Previous studies have determined that optimal cultures of mouse endometrial organoids are established from mice during the estrus phase4, which can be determined by cytological examination of a vaginal swab15. Adult female WT mice (6-8 weeks old, hybrid C57BL/6J and 129S5/SvEvBrd) were used for all experiments. The mice were humanely euthanized according to IACUC-approved guidelines using isoflurane sedation followed by cervical disarticulation. Once the mice are euthanized, the following steps should be followed. See the Table of Materials for details related to materials and solutions used in this protocol.
2. Processing of the stromal compartment
NOTE: This section outlines the protocols necessary for isolating the stromal compartment of the mouse endometrium. Given the increasing interest in epithelial/stromal co-culture experiments, it is important to be able to process the stromal cell populations in addition to the epithelial cells that will generate organoids.
3. Encapsulation of uterine epithelium into gel matrix to establish organoids
NOTE: Keep the gel matrix on ice until it is ready to be used.
4. Gene expression analysis of endometrial organoids following treatment with estradiol
NOTE: This section describes the methods used to profile the gene expression of endometrial epithelial organoids using real-time qPCR following treatment with estradiol (E2; see Table 1). Because the endometrium is under the cyclical control of the ovarian hormone E2, testing the responsiveness of the organoids to E2 is an important measure of physiological function. We have obtained high-quality RNA and generated sufficient mRNA to profile gene expression using qPCR and/or RNA-sequencing from our endometrial epithelial organoids. This section describes how to collect organoids and process them for downstream analysis of gene expression. The selected treatment medium reflects the one used to treat cultured endometrial cells. However, it should be noted that this treatment medium can be optimized accordingly, as done for the treating of human endometrial 3D cultures with hormones8,16,17.
5. Histological analysis of endometrial organoids
NOTE: Imaging the morphological features of endometrial organoids is critical to evaluating the cellular effect of growth factors, genetic manipulations, or small molecule inhibitors. This section describes the techniques used to fix, process, and image endometrial epithelial organoids using histological stains and antibody immunofluorescent staining.
6. Hematoxylin & eosin staining
7. Immunofluorescence staining
Access restricted. Please log in or start a trial to view this content.
Phase contrast images of mouse endometrial organoids
We established organoids from WT mouse endometrial epithelium, as described in the attached protocol (see diagram in Figure 1). Following enzymatic dissociation of the mouse endometrial epithelium, epithelial sheets were mechanically separated from the uterine stromal cells and further dissociated with collagenase to generate a single-cell suspension. If performed correctly, this method of epithelial and stromal cell s...
Access restricted. Please log in or start a trial to view this content.
Here, we describe methods to generate endometrial epithelial organoids from mouse endometrium and the protocols routinely used for their downstream analysis. Endometrial organoids are a powerful tool to study the mechanisms that control endometrial-related diseases, such as endometriosis, endometrial cancer, and implantation failure. Landmark studies published in 2017 reported the conditions to culture long-term and renewable cultures of endometrial organoids from mouse and human epithelium4,...
Access restricted. Please log in or start a trial to view this content.
The authors have no conflicts of interest to disclose.
We thank Dr. Stephanie Pangas and Dr. Martin M. Matzuk (M.M.M.) for critical reading and editing of our manuscript. Studies were supported by Eunice Kennedy Shriver National Institute of Child Health and Human Development grants R00-HD096057 (D.M.), R01-HD105800 (D.M.), R01-HD032067 (M.M.M.), and R01-HD110038 (M.M.M.), and by NCI- P30 Cancer Center Support Grant (NCI-CA125123). Diana Monsivais, Ph.D. holds a Next Gen Pregnancy Award from the Burroughs Wellcome Fund.
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Organoid Media Formulation | |||
| Name | Company | Catalog Number | Final concentration |
| Corning Matrigel Growth Factor Reduced (GFR) Basement Membrane Matrix, *LDEV-free | Corning | 354230 | 100% |
| Trypsin from Bovine Pancreas | Sigma Aldrich | T1426-1G | 1% |
| Advanced DMEM/F12 | Life Technologies | 12634010 | 1X |
| N2 supplement | Life Technologies | 17502048 | 1X |
| B-27™ Supplement (50X), minus vitamin A | Life Technologies | 12587010 | 1X |
| Primocin | Invivogen | ant-pm-1 | 100 µg/mL |
| N-Acetyl-L-cysteine | Sigma Aldrich | A9165-5G | 1.25 mM |
| L-glutamine | Life Technologies | 25030024 | 2 mM |
| Nicotinamide | Sigma Aldrich | N0636-100G | 10 nM |
| ALK-4, -5, -7 inhibitor, A83-01 | Tocris | 2939 | 500 nM |
| Recombinant human EGF | Peprotech | AF-100-15 | 50 ng/mL |
| Recombinant human Noggin | Peprotech | 120-10C | 100 ng/mL |
| Recombinant human Rspondin-1 | Peprotech | 120-38 | 500 ng/mL |
| Recombinant human FGF-10 | Peprotech | 100-26 | 100 ng/mL |
| Recombinant human HGF | Peprotech | 100-39 | 50 ng/mL |
| WNT3a | R&D systems | 5036-WN | 200 ng/mL |
| Other supplies and reagents | |||
| Name | Company | Catalog Number | Final concentration |
| Collagenase from Clostridium histolyticum | Sigma Aldrich | C0130-1G | 5 mg/mL |
| Deoxyribonuclease I from bovine pancreas | Sigma Aldrich | DN25-100MG | 2 mg/mL |
| DPBS, no calcium, no magnesium | ThermoFisher | 14190-250 | 1X |
| HBSS, no calcium, no magnesium | ThermoFisher | 14170112 | 1X |
| Falcon Polystyrene Microplates (24-Well) | Fisher Scientific | #08-772-51 | |
| Falcon Polystyrene Microplates (12-Well) | Fisher Scientific | #0877229 | |
| Falcon Cell Strainers, 40 µm | Fisher Scientific | #08-771-1 | |
| Direct-zol RNA MiniPrep (50 µg) | Genesee Scientific | 11-331 | |
| Trizol reagent | Invitrogen | 15596026 | |
| DMEM/F-12, HEPES, no phenol red | ThermoFisher | 11039021 | |
| Fetal Bovine Serum, Charcoal stripped | Sigma Aldrich | F6765-500ML | 2% |
| Estratiol (E2) | Sigma Aldrich | E1024-1G | 10 nM |
| Formaldehyde 16% in aqueous solution, EM Grade | VWR | 15710 | 4% |
| Epredia Cassette 1 Slotted Tissue Cassettes | Fisher Scientific | 1000961 | |
| Epredia Stainless-Steel Embedding Base Molds | Fisher Scientific | 64-010-15 | |
| Ethanol, 200 proof (100%) | Fisher Scientific | 22-032-601 | |
| Histoclear | Fisher Scientific | 50-899-90147 | |
| Permount Mounting Medium | Fisher Scientific | 50-277-97 | |
| Epredia Nylon Biopsy Bags | Fisher Scientific | 6774010 | |
| HistoGel Specimen Processing Gel | VWR | 83009-992 | |
| Hematoxylin solution Premium | VWR | 95057-844 | |
| Eosin Y (yellowish) solution Premium | VWR | 95057-848 | |
| TBS Buffer, 20X, pH 7.4 | GenDEPORT | T8054 | 1X |
| TBST (10X), pH 7.4 | GenDEPORT | T8056 | 1X |
| Citric acid | Sigma Aldrich | C0759-1KG | |
| Sodium citrate tribasic dihydrate | Sigma Aldrich | S4641-500G | |
| Tween20 | Fisher Scientific | BP337-500 | |
| Bovine Serum Albumin (BSA) | Sigma Aldrich | A2153-100G | 3% |
| DAPI Solution (1 mg/mL) | ThermoFisher | 62248 | 1:1000 dilution |
| VECTASHIELD Antifade Mounting Medium | Vector Labs | H-1000-10 | |
| Clear Nail Polish | Fisher Scientific | NC1849418 | |
| Fisherbrand Superfrost Plus Microscope Slides | Fisher Scientific | 22037246 | |
| VWR Micro Cover Glasses | VWR | 48393-106 | |
| SuperScript VILO Master Mix | ThermoFisher | 11755050 | |
| SYBR Green PCR Master Mix | ThermoFisher | 4364346 | |
| Krt8 Antibody (TROMA-I) | DSHB | TROMA-I | 1:50 dilution |
| Vimentin Antobody | Cell Signaling | 5741S | 1:200 dilution |
| Donkey anti-Rat IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 | ThermoFisher | A-21209 | 1:250 dilution |
| Donkey anti-Rabbin IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 | ThermoFisher | A-21206 | 1:250 dilution |
| ZEISS Stemi 508 Stereo Microscope | ZEISS | ||
| ZEISS Axio Vert.A1 Inverted Routine Microscope with digital camera | ZEISS | ||
| Primer Sequence | Forward (5'-3') | Reverse (5'-3') | _ |
| Lipocalin 2 (Lcn2) | GCAGGTGGTACGTTGTGGG | CTCTTGTAGCTCATAGATGGTGC | |
| Lactoferrin (Ltf) | TGAGGCCCTTGGACTCTGT | ACCCACTTTTCTCATCTCGTTC | |
| Progesterone (Pgr) | CCCACAGGAGTTTGTCAAGCTC | TAACTTCAGACATCATTTCCGG | |
| Glyceraldehyde 3 phosphate dehydrogenase (Gapdh) | CAATGTGTCCGTCGTGGATCT | GCCTGCTTCACCACCTTCTT |
Access restricted. Please log in or start a trial to view this content.