Here, we present a simplified endogenous gene tagging protocol for Drosophila, which utilizes a PCR-based technique for marker-free identification of successful genetic modifications, facilitating the development of stable knock-in lines.
Method Article
* These authors contributed equally
Here, we present a simplified endogenous gene tagging protocol for Drosophila, which utilizes a PCR-based technique for marker-free identification of successful genetic modifications, facilitating the development of stable knock-in lines.
The study of protein subcellular localization, dynamics, and regulation in live cells has been profoundly transformed by the advent of techniques that allow the tagging of endogenous genes to produce fluorescent fusion proteins. These methods enable researchers to visualize protein behavior in real time, providing valuable insights into their functions and interactions within the cellular environment. Many current gene tagging studies employ a two-step process where visible markers, such as eye color changes, are used to identify genetically modified organisms in the first step, and the visible marker is excised in the second step. Here, we present a one-step protocol to perform precise and rapid endogenous gene tagging in Drosophila melanogaster, which enables screening for engineered lines without the visible eye marker, offering a significant advantage over past methods. To screen for successful gene-tagging events, we employ a PCR-based technique to genotype individual flies by analyzing a small segment from their middle leg. Flies that pass the screening criteria are then used to produce stable stocks. Here, we detail the design and construction of CRISPR editing plasmids and methods for screening and confirmation of engineered lines. Together, this protocol improves the efficiency of endogenous gene tagging in Drosophila significantly and enables studies of cellular processes in vivo.
Fluorescent proteins have emerged as powerful tools for visualizing protein localization, dynamics, and protein-protein interactions in cells within living organisms1,2. Tagging endogenous genes with fluorescent proteins enables long-term live imaging of cellular processes with subcellular resolution. Furthermore, these endogenous gene-labeling techniques have several advantages compared to overexpression and immunostaining approaches. For example, overexpression of proteins might lead to protein misfolding, nonspecific protein-protein interactions, and mislocalization3. To date, researchers have been able to create vast libraries of endogenous genes fused to fluorescent proteins for a few model organisms, such as budding yeast, which can undergo efficient homologous recombination4. In the case of Drosophila melanogaster, various tools such as MiMICs5, transposon-based enhancer traps6, and fosmids7 have been devised to fluorescently tag genes.
The development of CRISPR-Cas9-based tools has made it possible to efficiently perform genome editing, including tagging endogenous proteins, in a wide range of model organism8,9. Cas9 is an RNA-guided enzyme that cleaves double-stranded DNA in a highly efficient and specific manner8, which can then be repaired by a nonhomologous end-joining (NHEJ) pathway leading to point mutations or deletions. Alternatively, the homology-directed repair (HDR) pathway allows the integration of heterologous DNA into the chromosome.
Past methods for CRISPR-based gene tagging in the model organism, Drosophila melanogaster, have relied on a two-step process10,11,12. This involves using a discernible eye-color marker, Dsred, to detect successful HDR events. Afterward, the Dsred marker would be excised using the Cre/loxP recombination system. To streamline and expedite this process, here, we present a simpler and more efficient method. This approach circumvents the need for lethal genotyping and allows for the direct screening of individual flies. Specifically, we employ a PCR-based approach to extract DNA from a small segment of the fly's middle leg, allowing us to genotype individual flies. Notably, this procedure does not compromise the vitality, movement, or reproductive capabilities of the sampled fly. Only the appropriate individuals, identified through this method, are further developed into stable stocks.
Here, we present a detailed protocol for generating fluorescent protein tagged flies in which endogenous genes are labeled with fluorescent reporters. This technique uses CRISPR-Cas9 genome editing to fuse any desired fluorophore tag to the N- or C- terminal of an endogenous gene. Below, we describe the design and construction of gRNA plasmids and a donor plasmid, one-step screening strategy to select CRISPR-positive flies, and steps to establish stable lines. Specifically, we describe strategies to tag an endogenous core clock Drosophila gene, period, with a fluorophore at the C-terminal. We also briefly describe the control experiments that need to be performed to confirm that the tagged protein is functional and live-imaging techniques to visualize the Period protein in live clock neurons within intact Drosophila brains13. The protocol described here is also broadly applicable to screen candidates for deletions and insertions of specific bits of DNA by CRISPR-Cas9 genome editing.
1. Design and construction of gene editing reagents
NOTE: To carry out endogenous tagging, it is essential to identify the various isoforms of the desired gene. Depending on the specific goals of the experiment, a fluorescent tag can be incorporated either internally or at the N- or C-termini of the selected protein isoform(s). For optimal CRISPR-mediated editing, it's crucial to position the two sgRNAs suitably close to the intended knock-in site. Subsequently, to enable editing through homologous recombination, a donor vector encompassing sequences homologous to the target gene, along with the fluorescent tag, should be prepared. Below is a step-by-step guide to these processes (Figure 1).
In our experiments, we typically found a success rate of ~20%-30% in screening for various endogenous tagged genes on all chromosomes (X, II, III). The efficiency of this process can vary based on several factors, such as gRNA selection, the nature of the gene, and injection quality. Here, we illustrate the results from our strategy to tag the endogenous period gene with the mNeonGreen fluorophore13. The period gene, positioned on the X chromosome of D. melanogaster, plays a pivotal role in the circadian clock. Drosophila has a well characterized clock network consisting of approximately 150 clock neurons that express clock proteins17.
We tagged the Period protein with the green fluorescent protein mNeonGreen on its C-terminal end, connected by a dual-glycine linker13. Post-plasmid injection, we crossed the G0 flies with FM7/L balancer and subsequently harvested the F1 generation. Out of 126 F1 flies screened using specialized PCR primers (Table 1), we identified 47 positive cases, yielding a 37.3% success rate. From these, we selected 5 F1 individuals to set up additional crosses to produce stable stocks. Gender did not impact the positive outcome rate during this screening. After verifying the sequence accuracy of the tagged gene, we executed control tests, including behavioral assessments and qPCR evaluations to ensure mRNA oscillations to confirm the functionality of the tagged protein (PERIOD-mNeonGreen)13.
To perform live-imaging experiments, we crossed these PERIOD-mNeonGreen flies with Clock856-GAL4;UAS-CD4-tdTomato flies, where Clock856-GAL4 labels all clock neurons19 and CD4 is a transmembrane protein that labels cell membranes. For live-imaging experiments, we dissected 3-4 adult brains using ice-cold Schneider's Drosophila medium. The brains were mounted and imaged using an Airyscan confocal microscope. Figure 4 shows the representative images displaying the PERIOD protein within clock neurons in Drosophila brains.

Figure 1: Schematic of the CRISPR/Cas9-based gene editing protocol. The protocol outlines a series of steps to design and assemble sgRNA and donor plasmids, followed by screening through the single-leg PCR method and production of stable engineered lines. Please click here to view a larger version of this figure.

Figure 2: Schematic of CRISPR/Cas9 genome editing to generate period-mNeonGreen flies. (A) Schema illustrating the addition of a fluorescent protein tag to the C-terminal of an endogenous gene. (B) The endogenous period (per) gene is tagged with mNeonGreen, a bright, monomeric green fluorescent protein at the carboxyl terminus. Two sgRNAs are in the last exon and the 3'UTR, respectively. The donor vector contains two ~1 kb homology sequences flanking the mNeonGreen tag. Stop codon is added to the end of the tag for proper translation termination. Please click here to view a larger version of this figure.

Figure 3: Strategy to screen for CRISPR-positive flies. (A) Approach to set up pre-screening genetic crosses for genes intended for CRISPR tagging on X and II chromosomes. G0 denotes the initially injected flies, while F1 represents their first-generation offspring that require screening. (B) The single-leg PCR screening method and the duration for each procedure step are outlined. (C) Shown here is a picture of the Fly Hotel. Glass tubes are filled with fly food and sealed at one end. Single flies are loaded into individual tubes. After the DNA extracted from the middle led of individual flies is tested, the appropriate flies are taken from the fly hotel and the stable lines are established. (D) Approach to set up post-screening crosses of flies (shown here in blue) which passed the screening test. Please click here to view a larger version of this figure.

Figure 4: Representative images of PERIOD-mNeonGreen protein in clock neurons. Representative images from period-mNeonGreen, Clock-GAL4, UAS-CD4-tdTomato flies entrained to Light-Dark cycles. ZT refers to Zeitgeber Time and ZT0 refers to time of lights on and ZT12 refers to time of lights off. Clock neuron's nuclear envelope is labeled with tdTomato, shown here in red, and PERIOD protein is tagged with mNeonGreen and shown in green. PERIOD protein is organized into discrete nuclear foci throughout the late night and early morning timepoints. Scale bars, 1 μm. Please click here to view a larger version of this figure.
| Name | DNA sequence(5' to 3') |
| Period screening primer forward | ATACTCGTCCATAGACCACG |
| Period screening primer reverse | ACATTATCCTCGGCTTGCAT |
| per-gRNA1-sense | cttcACCAGACACAGCACGGGGAT |
| per-gRNA1-antisense | aaacATCCCCGTGCTGTGTCTGGT |
| per-gRNA2-sense | cttcGTCAGCAGCAACTGCGGGTG |
| per-gRNA2-antisense | aaacCACCCGCAGTTGCTGCTGAC |
| period homology arms and mNeonGreen insert | GAATTCCAAGCTGCTCATCCTGCCCATTGTCAGCAA GGGCGACCTGACCATTCGGTTGAACGATGTGCACA CAAAGGTTTGGATTACCGCCGAGCCAGTGAAGCGC TCCGATGGCCACACCTATCTCAACATCACCGACTAC AAGACGGCCACCAAGATCAAGGGgtgagcatggcctgcat gtctagccaactgaatggtgacctcaaacctcttctcgtagTGGCCACT TTGACCTGTCGAATCTGTTCAACGACAACAAGGAGC GCGCGACAGCACGCTGAAGGTGCTGAACCAGGAGT GGAGCACCCTGGCCCTCGATGTCCAGCCGAAGATC AACGAGGCCTGCGCCAAGGCCTTCAGTGCCATCGT ACAGAGTCTGTGGGCCAACATTCCCTACGACGAGTT CTTCGAAAAGGAATGAACGCATATGTATCTAACAAAGT CCGGTCTAACTAGCCACTCTAGCTAATTACTGATTAAA CTACCTAATTGCAGCTAAATCCAATCCATCTTCGATTAA AACAACTACTACAAGTGTTGGCGTTGGCTTTTCGATAT TTATTGTACAATAAATAACTAAAAAAGATTCGGATATATA AACCTTAGGGCTGAGAAGGGTGGTTCGATGTTCGAAC CCTCTCTAGTTTTCAATTCACTTAATATTCTGATTAAACAT AGGATAGATATCATCTAAAAGCTTTGCTTGGCTTGAGAT CTACATTATCCTCGGCTTGCATGGGTTCTGGGCATCCTT CCACGTCAGTTCGTCTGATGCTTTCGTTACTTGTTCGGA TACTGAATGGTGACATCCCACGGAAGCGTTCGCGTTGAT TCGAAGAActtgaagggaatggaagggggagttaggaataggaactggtgg gactggctggtactcggtgcccagaccggaggcaattgctcacTCGTTTCCA GGACCCTGCTGCTCCTCGGTGTCTGCTGCTCGGATCATC CCAGGGATCGACATTGTGCACTCGGTTGTGTACGTCGGT CAGCAGCAACTGCGGGTGTCATTACTTGTACAGTTCGT CCATACCCATGACATCGGTGAAAGCTTTTTGCCATTCTT TGAAATTCAGCTCTGTTTTCGAGTGCTTCAGTTCGGTTT TTCGAAAGACATACATCGGTTGGTTCTTGAGATAGTTAG CCGCCATCGGCTTGGCAAAAGTGTACGTTGTTCGCGCT GTGGAGCGATACCTTTTTCCATTTCCTGTTGTATAGGAC CATTTGAAAGTGGAAATAATAGTCTTATCATTGGGGTAG GTCTTTTTGCTGCGGCACCAGTCAGCGGCAGTGAGC GAATTTGTCATAACTGGGCCATCAGCGGGGAAACCCG TTCCCTTGACTTGGGCTTCGCCTTTAATATGGCTACCT TCGTAAGTGTACCGATAGTTCACCGTGAGCGAGGCTC CGTCTTCAAATTGCATTGTTCGATGCACCTGGTAGCCC GAGCCATCTACCATCGCGGCTTGGAAGGGCGACATGC CATCTGGATACGGCAAATACTGATGGAATCCGTAACCG ATGTGTGGAACCAGGATCCAAGGGGAAAATTGGAGAT CGCCTTTAGTCGATTTCAGATTGAGCTCTTCGTAGCC GTCGTTGGGGTTTCCCGTACCCTGTCCGACCATATC GAAGTCGACTCCATTGATCGAACCAAAGATATGCAG CTCGTGTGTAGCCGGCAACGAAGCCATATTATCTTC TTCACCCTTCGACACACCTCCGCCGTCGCCGTGCT GTGTCTGGTCCTCCTCCGGGTGCTCCATGATCTTGC TCTCAGATGTGCTCATGCTctgcaaaagaacggaaatggatta cattgaatcgcatcgtggactgaactgtacgtacCTTCAGCTTTCGG TGCTTGGGGTCCTTTTCGGTGTCCGGCGGACTCTC CGATCCGTCCGTGGTCTTGATGAAGGACGAGTAGA AGGAGGAGAAGCTGGAGCCATCCATGTCGTCGCTA TTCCCATTGCTGTCCGTGTATTTctgtggatgagaccatgttc ttcataatgaccaatcaccaatggacctcattcgtatagcatacCTTGTT GTTGGCGGGATTGCTGCTGCTGCAGGGCGGGTCG GAGTTGTAGTCGCCCATCACGGAGGGAATGGGCGA GGAGTCCGGCACCTCCTTCTTGCAGGGATCGGATA CCGCTGCACTGGAGCCCGGCTCCGTCTTGACGGA TGCGCTCTGCGAGGAGGGACGCTGCACCTGGGC AGGAGTGGTGACCGAGTGGAATGCACCCGGCACC TTCTTCGTCATGGACGCCGGCGTGGTctatggacgagta tggagttggagttggagttaagacagttcggtgaggcaccaccggccactg acttacCGTGTACACCGACTTGTTGTACGCGGATTGGG AGCCCAACGGACGTTCGGGAATCTGGAGAGCGTTG GCCATTCCCGGAAAGGGCATCGGCTGGTACATCAT GGCCGTGGCCGCGGCCGCCGCCGGGTGTGTGTAG AAAAGCGAAGGATGCGGGTACATCACGCCGGCCAT GTACTGCAGCGGCATGGCCTGGGCGGCCGCGGCA GCCGCCTGCTGCGAGGTGGTGGGCATGTCCGTGC CACCCTTGTGCGGATGCTTGTGCATCCGGGGAGAG CGCGTGGGACTGGTGGGCGTCAAGGAGGCGGGGA TGTAGTAGAAGGTCGGGAAGAGGCCGGCGGAGGA GAAGCTGCTCTGGGCCATGGCCGTGTGCGTGGAG TGAACGGGCGGTGTGATGCCCACCGAGAACGGTG GCCAGAGGTTTATGTTCTAGA |
Table 1: List of sgRNA sequences to tag endogenous Period gene at the C terminal and primers used to perform single-leg PCR screening.
The results demonstrate a streamlined, simple one-step CRISPR-based strategy for tagging endogenous genes in Drosophila. In the protocol, we use two gRNAs to induce DNA double-strand break and homologous recombination more efficiently. The gRNAs and the donor plasmid are injected into fruit fly embryos, which express Cas9 enzyme in their germline. These embryos are subsequently cultivated under standard conditions until adulthood, at which point they are crossed with balancer flies to produce the first generation (F1) offspring. PCR genotyping is performed on the middle leg of each F1 specimen to screen for genetically modified flies. This method provides a significant advantage over the current screening methods which use two steps of screening, where the first step relies on using a visible marker such as eye color to identify the appropriate genotype and the second step involves removal of the eye color marker10. Here, we present a method employing PCR on DNA extracted from a small segment of the middle leg of an individual fly allowing non-lethal genotyping of individual flies, offering a more efficient and cost-effective alternative to existing methods. This method allows screening of candidate animals one by one or in batches until the appropriate genotype is isolated. The number of animals screened before appropriate stocks are isolated varies from experiment to experiment, depending on many factors including efficiency of sgRNAs selected, efficiency of injection, off-target insertions which can affect viability. Alternatively, DNA from single wings from individual flies can also be used for genotyping purposes18.
It is possible the addition of a tag to the N- or C-terminal of a gene can adversely affect the function of the gene, which can potentially affect the viability of the flies. If protein structure information is available, it can be used to determine whether N- or C-terminal tagging may better preserve function and localization of the native protein. It is always recommended to perform control experiments, including testing whether the tagged protein shows similar localization pattern as the wildtype protein by antibody staining methods. The same screening strategy can be used to screen other kinds of CRISPR-based genetic insertions or deletions. In conclusion, the one-step screening strategy makes it much easier to generate CRISPR-edited flies and opens many possibilities to study the subcellular localization and dynamics of endogenous genes in their native context.
The authors declare no competing interests.
We thank George Watase and Josie Clowney for discussions during the initial stages of the protocol development. The work was supported by funds from the NIH (grant no. R35GM133737 to S.Y.), Alfred P. Sloan Fellowship (to S. Y.) and McKnight Scholar Award (to S. Y.).
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| 0.5M EDTA pH8.0 | Invitrogen | AM9260G | |
| 5-alpha Competent E. coli (High Efficiency) | NEB | C2987H | |
| 96-well deep well plate | BRAND | 701354 | |
| Agar | Fisher Scientific | BP1423-500 | |
| BbsI-HF | NEB | R3539S | |
| DreamTaq Green PCR Master Mix (2X) | Thermo Scientific | K1081 | |
| D-Sucrose | Fisher Scientific | BP220-1 | |
| EcoRI-HF | NEB | R3101S | |
| Hydrochloric Acid | Fisher Scientific | A142-212 | |
| Prolong Glass Antifade Mounting Medium | Invitrogen | P36982 | |
| Proteinase K | QIAGEN | 19131 | |
| Schneider's Drosophila Medium | Gibco | 21720001 | |
| Sodium Chloride | Fisher Scientific | S271-500 | |
| T4 DNA ligase | NEB | M0202S | |
| Tris Base | Fisher Scientific | BP152-500 | |
| XbaI | NEB | R0145S |