This protocol describes how to establish, maintain, genetically modify, differentiate, functionally characterize, and transplant lacrimal gland organoids derived from primary mouse and human tissue.
Method Article
This protocol describes how to establish, maintain, genetically modify, differentiate, functionally characterize, and transplant lacrimal gland organoids derived from primary mouse and human tissue.
The lacrimal gland is an essential organ for ocular surface homeostasis. By producing the aqueous part of the tear film, it protects the eye from desiccation stress and external insults. Little is known about lacrimal gland (patho)physiology because of the lack of adequate in vitro models. Organoid technology has proven itself as a useful experimental platform for multiple organs. Here, we share a protocol to establish and maintain mouse and human lacrimal gland organoids starting from lacrimal gland biopsies. By modifying the culture conditions, we enhance lacrimal gland organoid functionality. Organoid functionality can be probed through a "crying" assay, which involves exposing the lacrimal gland organoids to selected neurotransmitters to trigger tear release in their lumen. We explain how to image and quantify this phenomenon. To investigate the role of genes of interest in lacrimal gland homeostasis, these can be genetically modified. We thoroughly describe how to genetically modify lacrimal gland organoids using base editors-from guide RNA design to organoid clone genotyping. Lastly, we show how to probe the regenerative potential of human lacrimal gland organoids by orthotopic implantation in the mouse. Together, this comprehensive toolset provides resources to use mouse and human lacrimal gland organoids to study lacrimal gland (patho)physiology.
The lacrimal gland is the glandular epithelium responsible for producing most of the aqueous layer of the tear film1. The aqueous layer of the tear film not only contains water to lubricate the ocular surface but also a large repertoire of antimicrobial components that protect the ocular surface from infections2. When the lacrimal gland is damaged or inflamed, dry eye disease occurs, which results in discomfort for patients and can eventually lead to loss of vision3. Over the years, model systems to study the lacrimal gland, in particular the human gland, have been limited4,5,6. This has contributed to a knowledge gap regarding lacrimal gland function under physiological and pathological conditions.
Recently, in vitro models have been developed to study the lacrimal gland in a dish7,8,9. These lacrimal gland organoids are derived from adult stem cells grown as three-dimensional structures in an extracellular matrix supplemented with a cocktail of growth factors that sustains their regenerative capacities in vitro7. The advantage of adult stem cell (ASC)-derived organoids is that they can be maintained for a very long time while recapitulating healthy tissue features. This type of organoid solely consists of epithelial cells, unlike induced pluripotent stem cell (iPSC)-derived organoids, which may also contain stromal cells, for instance. Unlike pluripotent stem cell (PSC)-derived organoids, ASC organoids are established directly from adult tissue and do not require any genetic modifications to be expanded. ASC organoids express adult characteristics10.
This protocol contains a toolbox to derive lacrimal gland organoids from mouse and human primary tissue. The protocol describes how to further enhance the organoids' functionality by simple growth factor withdrawal and how to provoke the organoids to secrete tear fluid by performing a swelling assay. This protocol additionally includes an electroporation-based transfection method to genetically engineer mouse organoids using CRISPR-derived base editors. Unlike conventional Cas9, the use of base editors allows the modification of single bases in the genome without generating a double-stranded break11,12. Lastly, the orthotopic transplantation of human lacrimal gland organoids into immunodeficient mice and the subsequent histological assessment of the engraftment is described. This lacrimal gland organoid toolkit can be used in research on lacrimal gland regeneration and function and for genetic and inflammatory disease modeling.
The mouse experiments were approved by the Animal Ethics Committee of the Royal Netherlands Academy of Arts and Sciences (KNAW) under project license AVD8010020151. The organoids were derived from mouse surplus material. The human lacrimal gland biopsies were collected from the waste material of patients undergoing surgery at the University Medical Centre Utrecht (UMCU) after approval by the medical ethical committee under protocol number 18-740. The protocol contains several sections that are outlined in Figure 1.

Figure 1: Overview of the protocol. This figure highlights the different steps of the protocol. Please click here to view a larger version of this figure.
NOTE: All medium and buffer compositions are described in Supplementary Table 1.
1. Establishment of organoids from mouse and human lacrimal glands
2. Expanding the mouse and human lacrimal gland organoids
3. Cryopreserving the mouse and human lacrimal gland organoids
4. Differentiating lacrimal gland organoids and assessing their functionality
5. Constructing a plasmid to knock out Pax6
6. Generation of Pax6 KO clones
7. Orthotopic transplantation of human lacrimal gland organoids in NSG mice
Following the dissection of the mouse lacrimal gland (Figure 2A), the enzymatic and mechanical digestion generated small tissue fragments, among which the acini and ducts could be distinguished (Figure 2B). The remaining large pieces of tissue would destabilize the ECM, which would reduce initial organoid outgrowth. The mouse lacrimal gland organoid derivation was successful when cystic organoids of ~500 µm diameter were found after ~7 days, the stage at which the organoids were ready to be split (Figure 2C). Even if the overall organoid derivation is successful, some organoids may begin to grow before stopping eventually. Human lacrimal gland organoids grew out as cysts within 3-4 days and reached full-grown size in 10-14 days after tissue isolation (Figure 2D). For both mice and humans, organoid derivation sometimes failed, with no or few organoids growing out; this was generally caused by over-digestion of the tissue. The mouse lacrimal gland organoids could be passaged at least 40x and the human organoids at least 20x. Passaging was done every 7-10 days on average, depending on the organoid growth.

Figure 2: Establishment of mouse and human lacrimal gland organoids. (A) Photographs of the different stages of mouse lacrimal gland dissection. The arrow points at the lacrimal gland under its protective membrane. (B) Brightfield images of mouse lacrimal gland cells right after tissue digestion, with insets showing an acinus and a duct. (C) Brightfield images of a successful and an unsuccessful mouse lacrimal gland organoid derivation. (D) Brightfield images of human organoid outgrowth over the course of 14 days. Please click here to view a larger version of this figure.
The lacrimal gland organoids contain a large proportion of stem cells when cultured in the expansion medium. To increase their differentiation level, we set up a mouse and a human differentiation medium with reduced growth factor content. After 5 days and 7 days, respectively, in the differentiation medium, the mouse and human lacrimal gland organoids became denser (Figure 3A-B). This morphological change correlated with increased functional properties. Applying the cyclic AMP activator forskolin or the neurotransmitter norepinephrine resulted in organoid swelling (i.e., apical water secretion) within less than 3 h (Figure 3C). When the swelling took longer than 3-4 h, this suggested that the organoids were not differentiated enough and/or did not express functional markers, such as receptors for neurotransmitters.

Figure 3: Differentiation of mouse and human lacrimal gland organoids and functional swelling assay in human organoids. (A) Brightfield images of mouse lacrimal gland organoids cultured in expansion medium for 7 days and in differentiation medium for 5 days after 2 days in expansion medium. (B) Brightfield images of human lacrimal gland organoids cultured in expansion medium for 11 days and in differentiation medium for 9 days after 2 days in expansion medium. (C) Brightfield images of differentiated human lacrimal gland organoids exposed to fresh differentiation medium (control), to 1 µM forskolin, and to 100 µM norepinephrine over the course of 3 h. Please click here to view a larger version of this figure.
To knock out Pax6 in mouse lacrimal gland organoids, a plasmid containing the chosen Pax6-targeting gRNA was generated by PCR and ligation (Figure 4A). This gRNA-containing plasmid was electroporated along with the Piggy-Bac plasmids (hygromycin resistance transposon-containing and transposase-containing plasmids) and the C > T base editor Cas9 in mouse lacrimal gland organoids dissociated into single cells. After 3 days, when the organoids had recovered, they were exposed to hygromycin to select for clones that had incorporated the hygromycin resistance cassette. In successful electroporations, organoids resistant to hygromycin grew out (Figure 4B). The growing organoid clones that were larger than ~300 µm were picked, ideally before they started to spontaneously differentiate (Figure 4C). DNA was extracted from part of the organoid while keeping the remainder in culture. The PCR amplification of the Pax6 locus targeted by the gRNA yielded a 367 bp band for each of the clones picked (Figure 4D). After sequencing the amplified locus, clones that were homozygously C > T edited (n = 1) were kept. On the other hand, clones that were not edited (n = 4), heterozygously edited, or wrongly edited (n = 1) were discarded (Figure 4E). Overall, using this gRNA targeting Pax6, one homozygous knock-out mouse lacrimal gland clone out of six sequenced was obtained. Some clones grew out well, but some organoid clones were lost after picking or began to differentiate (Figure 4F). Out of the 10 organoid clones picked, 7 grew out well.

Figure 4: Base editing-mediated knock-out of Pax6 in mouse lacrimal gland organoids. (A) Sanger sequencing trace of pFYF1320 after correct integration of the gRNA targeting the Pax6 locus. (B) Brightfield images of mouse lacrimal gland organoids 5 days after exposure to hygromycin following electroporation. The organoids were cultured in mouse expansion medium. On the left is an example of a failed electroporation, with no clone resistant to hygromycin growing out. On the right is an example of a successful electroporation, with several hygromycin-resistant organoid clones surviving. (C) Brightfield images of clones that should be picked and clones that should not be picked. (D) Agarose gel showing the amplification of the Pax6 locus targeted with the gRNA. In green, the band of the expected size of 367 bp is highlighted. (E) Sanger sequencing trace of three organoid clones that were resistant to hygromycin. The top clone is unedited. The middle clone is a homozygous C > T edition and, hence, a homozygous knock-out. The bottom clone presents two heterozygous point mutations and is either a heterozygous knock-out or a mixed clone and has been wrongly edited. (F) Brightfield images of the picked organoid clones with various levels of outgrowth. Please click here to view a larger version of this figure.
Lastly, to perform human lacrimal gland organoid orthotopic transplantation in mice, organoids that were split 3 days in advance (< 100 µm in diameter) were used. Organoid engraftment was confirmed 1 month after injecting the organoids into the mouse lacrimal gland by staining for a human-specific marker, the human nucleolar antigen (Figure 5). The absence of punctate staining from all the sections of the mouse lacrimal gland signified a lack of human organoid engraftment.

Figure 5: Transplantation of human lacrimal gland organoids into the mouse lacrimal gland. Staining of transplanted mouse lacrimal glands for the human nucleolar marker to monitor engraftment 1 month after transplantation. Please click here to view a larger version of this figure.
Supplementary Table 1: Composition of the media and buffers. Please click here to download this Table.
This protocol describes the establishment and use of lacrimal gland organoids for functional assays, mutation modeling, and transplantation. When establishing mouse and human lacrimal gland organoids, tissue dissociation is crucial. If the tissue is not sufficiently digested, the organoid yield will be low. If the tissue is over-digested, the cells will die and not grow out as organoids. Each tissue should be digested with a specific enzyme for a specific time to ensure optimal organoid outgrowth14,17,18. The lacrimal gland is a rather soft tissue for which a collagenase digestion of 5-10 min combined with pipetting-based mechanical dissociation is sufficient to isolate small pieces of tissue. If single cells need to be obtained for applications such as single-cell RNA sequencing, the dissociation can be carried out for longer until the single-cell stage is reached, but dissociation should be stopped as soon as single cells are obtained to limit any decrease in viability. As tissue dissociation is so crucial, over-digestion is the most likely reason for the failure of lacrimal gland organoid establishment.
The appropriate maintenance of lacrimal gland organoids is important to their use. Long-term maintenance is a hallmark of adult stem cell-derived lacrimal gland organoids, compared to induced pluripotent stem cell-derived organoids7,17. To achieve long-term maintenance, regular organoid splitting and medium changes should be performed. Without this, organoids begin to differentiate and develop decreased stem cell potential, which hampers their long-term maintenance7. At this step again, over-digestion can kill the stem cells and impair organoid maintenance. For regular maintenance, organoid dissociation into single cells is not required. However, to generate clonal knock-out organoid lines, it is critical to begin with single cells. If not, the organoids will be constituted of a mosaic of cells with different genetic backgrounds, making analyzing the effect of a single, defined mutation impossible. Here, we describe the use of a C > T base editor to generate stop codons. This genome editor relies on the presence of arginine, glutamine, or tryptophane codons within 12-18 bases from an NGG PAM. When these conditions are not met in designing a gRNA, conventional Cas9 or C >T base editors with alternative PAMs can be used7,18. However, conventional Cas9 introduces double-stranded breaks that result in indels upon repair11. As both alleles may harbor different indels, clone genotyping requires additional caution. Deconvolution of the modifications introduced should be performed to ensure both alleles contain out-of-frame indels and, hence, that the organoid clones are knocked out for the gene targeted19. The advantage of C > T base editors lies in the fact that they can be used to model point mutations that do not necessarily result in stop codons. For instance, they can be used to model specific Pax6 mutations found in patients with aniridia to study their impact on lacrimal gland physiology20.
The lacrimal gland secretes the aqueous part of the tear film1. Tear secretion can be recapitulated in human organoids after differentiation mediated by growth factor withdrawal and NOTCH inhibition. Under these conditions, organoids undergo terminal differentiation and cannot be further maintained. Yet, differentiated lacrimal gland organoids can guide the development of tearing-inducing drugs in the context of dry eye disease, potentially in high-throughput screens. The tearing assay presented in this protocol is the one that currently gives the biggest change in organoid size in a short amount of time, which makes it easier to quantify in the context of a drug screen7,9,17.
Stem cell therapy holds great promise for lacrimal gland regeneration in dry eye disease21. Adult stem cell-derived lacrimal gland organoids could be a source material for such applications. The protocol presented here results in human lacrimal gland organoid engraftment, mostly as cysts. Low organoid engraftment can arise due to organoids being injected in the wrong site. Training the injection procedure with a dye allows the tracking of the injection site and, ultimately, improves the injection accuracy. Alternatively, the mouse epidermis can be incised to have direct access to the lacrimal gland, as done in rats before22. This method takes longer but may be more accurate. On the other hand, with the present protocol, the organoids did not functionally integrate into the mouse lacrimal gland. Similar results have been observed for iPSC-derived lacrimal gland engraftment22. The transplantation method could be further improved by wounding the lacrimal gland in advance, using a dry eye mouse model, and/or injecting the organoids as single cells or small clumps. Nevertheless, adult stem cell-derived lacrimal gland organoids and the related toolkit can be the basis of future applications in lacrimal gland research and regenerative medicine.
Hans Clevers is the head of Pharma Research and Early Development at Roche, Basel, and holds several patents related to organoid technology.
We thank Yorick Post for the initial development of the protocol. This work was in part supported by an award from the Cancer Research UK Grand Challenge (C6307/A29058) and the Mark Foundation for Cancer Research to the SPECIFICANCER team.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| 1.5 mL safe-lock centrifuge tubes | Eppendorf | EP0030 120.094 | |
| 3,3′-Diaminobenzidine tetrahydrochloride hydrate (DAB) | Sigma-Aldrich | D5637 | CAS: 868272-85-9 , CAUTION, 6 g/L solution can be stored aliquotted at -20 °C |
| 5x green GoTaq Flexi buffer | Promega | M891A | Store at -20 °C |
| A83-01 | Tocris | 2939 | Store at -20 °C, stock at 30 mM, 10000x |
| Advanced DMEM/F12 | Invitrogen | 12634-010 | store at 4 °C |
| Agar plates containing Ampicillin | Hubrecht Institute | ||
| Ampicillin sodium salt | Sigma-Aldrich | A9518 | |
| Autoclave VAPOUR-Line lite | VWR chemicals | ||
| B27 supplement | Invitrogen | 17504-044 | Store at -20 °C, 50x |
| BD Micro-Fine insulin needle 1 mL | BD Bioscience | 324825 | |
| Benchtop microscope DMI1 | Leica | ||
| Bovine serum albumine (BSA) | MP biomedicals | 160069 | Store at 4 °C |
| BTXpress | BTX | MDS450805 | |
| C57BL/6 mice | Hubrecht Institute | ||
| Cassettes | Klinipath | 410-02S | |
| CellBanker 1 | amsbio | 11910 | Cryopreservation medium, adhere to instructions |
| Centrifuge | Eppendorf | ||
| Citric acid monohydrate | J.T. Baker | 0088 | CAS: 5949-29-1 |
| Collagenase I | Sigma Aldrich | C9407 | Aliquots at 20 mg/mL, 20x, store at -20 °C |
| Conical tubes 15 mL | Greiner Bio-One | 5618-8271 | |
| Conical tubes 50 mL | Corning | CLS430828-500EA | |
| Coverslips 24 mm x 50 mm | Menzel-Gläzer | BB024050S1 | |
| Cultrex Basement Membrane Extract (BME), Growth Factor Reduced, Type 2 - extracellular matrix | R&D Systems, Bio-Techne | 3533-001-02 | Store at -20 °C, keep at 4 °C for up to 1 month |
| DAPT | Sigma Aldrich | D5942 | Store at -20 °C, stock at 10 mM, 1000x |
| Disodium hydrogen phosphate anhydrous | VWR chemicals | 28026.292 | CAS: 7558-79-4 |
| Di-sodiumhydrogenphosphate dihydrate | Sigma-Aldrich | 71643 | CAS:10028-24-7 |
| Dispase | ThermoFisher Scientific | 17105-041 | Aliquots at 50 U/mL, store at -20 °C until use, 400x |
| Disposable Scalpel Sterile N° 10 | Swann Morton | 3033838 | |
| DM4000 microscope | Leica | ||
| dNTPs 25 mM | Promega | U1420 | Mix all 4 nucleotides together, Store at -20 °C |
| Dpn1 | New England Biolabs | R0176 | |
| Dulbecco's Phosphate-bufferd Saline (DPBS) | Gibco | 14190144 | 1x |
| Easy strainers 70 µm | Greiner | 542170 | |
| Electroporation cuvette | Nepagene | EC002S | |
| EnVision+/HRP mouse | Agilent | K400111-2 | |
| Ethanol 100% | BOOM | 84045206;5000 | CAUTION, Use to prepare other Ethanol dilutions |
| Ethanol 70% | BOOM | 84010059.5000 | CAUTION |
| Ethanol 96% | BOOM | 84050065.5000 | CAUTION |
| EVOS FL Auto 2 Cell Imaging System | ThermoFisher Scientific | Live-imaging brightfield microscrope | |
| FGF10 | Peprotech | 100-26 | Store at -20 °C, stock at 100 mg/mL in base medium, 100x |
| Fiji | NIH, Fiji developers | ||
| Formaldehyde solution 4% | Sigma-Aldrich | 1.00496 | CAS: 50-00-0, CAUTION |
| Forskolin | Tocris | 1099 | Store at -20 °C, stock at 10 mM, 10000x |
| Glutamax | Gibco | 35050-061 | 100x |
| GoTaq G2 Flexi DNA Polymerase | Promega | M7805 | Store at -20 °C |
| Haematoxylin | VWR chemicals | 10047105 | Store at room temperature |
| HEPES | Gibco | 15630-080 | Store at 4 °C, 100x |
| Histocore H and C, Tissue embedding machine | Leica | ||
| Hot plate | Meidax | ||
| Human nucleolar antigen antibody | Abcam | ab-190710 | |
| Hydrochloric acid 5 N | ThermoFisher Scientific | 10605882 | CAS: 7647-01-0, CAUTION |
| Hydrogen peroxyde 30% | Chem-lab | CL00.2308.1000 | CAS: 7722-84-1, CAUTION |
| Hygromycin B-gold | InvivoGen | ant-hg | Stock at 100 mg/µL, 1000x |
| Hygromycin resistance cassette-containing plasmid | Andersson-Rolf et al, Nature Methods, 2017. doi: 10.1038/nmeth.4156 | ||
| IsoFlo 100% | Mecan | 5960501 | |
| LB medium | Hubrecht Institute | ||
| MgCl2 25 mM | Promega | A351H | Store at -20 °C |
| Microtome RM2235 | Leica | ||
| Midiprep DNA isolation kit | ThermoFisher Scientific | K210005 | |
| Miniprep DNA isolation kit | ThermoFisher scientific | K210003 | |
| N-acetylcysteine | Sigma Aldrich | A9165 | Store at -20 °C, stock at 500 mM, 400x |
| NEPA21 electroporator | Nepagene | ||
| Nicotinamide | Sigma Aldrich | N0636 | Store at -20 °C, stock at 1M, 100x |
| NOD Scid Gamma (NSG) mice | Hubrecht Institute colony | ||
| Noggin conditioned medium | U-Protein Express | Custom order | Store at -20 °C |
| Noradrenaline | Sigma Aldrich | A7257 | Store at -20 °C, stock at 100 mM |
| Oven | Memmert | Set at 58 °C | |
| P20, P200 and P1000 pipettes | Gilson | ||
| Paraffin | VWR chemicals | 10048502 | |
| Pasteur pipettes, glass plugged | ThermoFisher Scientific | 1150-6973 | |
| Pax6_C>T_F: AGACTGTTCCAGGATGGCTG | IDT | ||
| Pax6_C>T_R: TCTCCTAGGTACTGGAAGCC | IDT | ||
| pCMV_ABEmax_P2A_GFP | Addgene | 112101 | |
| Penicillin/Streptomycin | Invitrogen | 15140-122 | Store at -20 °C |
| Pertex | Klinipath | AM-08010 | |
| pFYF1320 | Addgene | 47511 | |
| Primocin | InvivoGen | ant-pm-1 | 1000X, store at -20 °C |
| Prostaglandin E2 (PGE2) | Tocris | 2296 | Store at -20 °C, stock at 10 mM, 10000x |
| Petri dish, 10 cm | Greiner | 633102 | |
| Q5 buffer | New England Biolabs | B9027S | |
| Q5 high-fidelity DNA polymerase | New England Biolabs | M0491S | |
| QIAquick Gel Extraction Kit | Qiagen | 28704 | |
| QuickExtract DNA Extraction Solution | Lucigen | QE09050 | Store aliquots at -20 °C |
| R-spondin 3 conditioned medium | U-Protein Express | Custom order | Store at -20 °C |
| sgRNA Reverse Primer: TCTGCGCCCATCTGTTGCTT CGGTGTTTCGTCCTTTCCACAAG | IDT | ||
| Slides | StarFrost | MBB-0302-55A | Adhesive, ground |
| Sodium azide | Merck | 8.22335.1000 | CAS: 26628-22-8, CAUTION |
| Sodium cytrate dihydrate | J.T. Baker | 0280 | CAS: 6132-04-3 |
| Standard Forward Primer: “/5phos/ GTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGC | IDT | ||
| Subcloning efficiency competent cells DH5alpha | Invitrogen | 18265-017 | |
| Suspension cell culture plates (24-well) | Greiner Bio-One | 662102 | 24-well |
| Suspension cell culture plates (12-well) | Greiner Bio-One | 665102 | 12-well |
| T4 DNA ligase | New England Biolabs | M0202 | |
| TAE buffer | ThermoFisher Scientific | B49 | Stock at 50x, dilute to 1x with ultrapure water |
| Transposase-containing plasmid | Andersson-Rolf et al, Nature Methods, 2017. doi: 10.1038/nmeth.4156 | ||
| TrypLE Express Enzyme | Invitrogen | 12605-028 | store at 4 °C |
| U6_Forward primer: GGGCAGGAAGAGGGCCTAT | IDT | ||
| UltraPure Agarose 1000 | Invitrogen | 16550 | |
| Water bath | Tulabo | ||
| Xylene | Klinipath | 4055-9005 | CAS: 1330-20-7, CAUTION |
| Y-27632 | Abmole Bioscience | Y-27632 dihydrochloride | Store at -20 °C, stock at 10 mM, 1000x |