Method Article

High-Throughput Image-Based Quantification of Mitochondrial DNA Synthesis and Distribution

DOI:

10.3791/65236

May 5th, 2023

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

A procedure for studying the dynamics of mitochondrial DNA (mtDNA) metabolism in cells using a multi-well plate format and automated immunofluorescence imaging to detect and quantify mtDNA synthesis and distribution is described. This can be further used to investigate the effects of various inhibitors, cellular stresses, and gene silencing on mtDNA metabolism.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The vast majority of cellular processes require a continuous supply of energy, the most common carrier of which is the ATP molecule. Eukaryotic cells produce most of their ATP in the mitochondria by oxidative phosphorylation. Mitochondria are unique organelles because they have their own genome that is replicated and passed on to the next generation of cells. In contrast to the nuclear genome, there are multiple copies of the mitochondrial genome in the cell. The detailed study of the mechanisms responsible for the replication, repair, and maintenance of the mitochondrial genome is essential for understanding the proper functioning of mitochondria and whole cells under both normal and disease conditions. Here, a method that allows the high-throughput quantification of the synthesis and distribution of mitochondrial DNA (mtDNA) in human cells cultured in vitro is presented. This approach is based on the immunofluorescence detection of actively synthesized DNA molecules labeled by 5-bromo-2'-deoxyuridine (BrdU) incorporation and the concurrent detection of all the mtDNA molecules with anti-DNA antibodies. Additionally, the mitochondria are visualized with specific dyes or antibodies. The culturing of cells in a multi-well format and the utilization of an automated fluorescence microscope make it easier to study the dynamics of mtDNA and the morphology of mitochondria under a variety of experimental conditions in a relatively short time.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

For most eukaryotic cells mitochondria are essential organelles, as they play a crucial role in numerous cellular processes. First and foremost, mitochondria are the key energy suppliers of cells1. Mitochondria are also involved in regulating cellular homeostasis (for instance, intracellular redox2 and the calcium balance3), cell signaling4,5, apoptosis6, the synthesis of different biochemical compounds7,8, and the innate immune response9. Mitochondrial dysfunction is associated with various pathological states and human diseases10.

The functioning of mitochondria depends on the genetic information located in two separate genomes: the nuclear and mitochondrial genomes. The mitochondrial genome encodes a small number of genes compared to the nuclear genome, but all the mtDNA-encoded genes are essential for human life. The mitochondrial protein machinery necessary to maintain the mtDNA is encoded by nDNA. The basic components of the mitochondrial replisome, as well as some mitochondrial biogenesis factors, have already been identified (reviewed in previous research11,12). However, mitochondrial DNA replication and maintenance mechanisms are still far from being understood. In contrast to nDNA, the mitochondrial genome exists in multiple copies, which provides an additional layer for regulating mitochondrial gene expression. Much less is currently known about the distribution and segregation of mtDNA within organelles, to what extent these processes are regulated, and if they are, which proteins are involved13. The segregation pattern is crucial when cells contain a mixed population of wild-type and mutated mtDNA. Their unequal distribution may lead to the generation of cells with a detrimental amount of mutated mtDNA.

So far, the protein factors necessary for mtDNA maintenance have been identified mainly by biochemical methods, bioinformatic analyses, or through disease-associated studies. In this work, in order to ensure a high chance of identifying factors that have previously escaped identification, a different strategy is described. The method is based on the labeling of mtDNA during replication or repair with 5-bromo-2'-deoxyuridine (BrdU), a nucleoside analog of thymidine. BrdU is readily incorporated into nascent DNA strands during DNA synthesis and, in general, is used for monitoring the replication of nuclear DNA14. However, the procedure developed here has been optimized for detecting BrdU incorporated into mtDNA using the immunofluorescence of anti-BrdU antibodies.

The approach allows for the high-throughput quantification of mtDNA synthesis and distribution in human cells cultured in vitro. A high-throughput strategy is necessary to conduct tests under different experimental conditions in a relatively short time; therefore, it is proposed in the protocol to utilize a multi-well format for cell culturing and automated fluorescence microscopy for imaging. The protocol includes the transfection of human HeLa cells with an siRNA library and the subsequent monitoring of mtDNA replication or repair using the metabolic labeling of newly synthesized DNA with BrdU. This approach is combined with immunostaining of the DNA with the help of anti-DNA antibodies. Both parameters are analyzed using quantitative fluorescence microscopy. Additionally, mitochondria are visualized with a specific dye. To demonstrate the specificity of the protocol, BrdU staining was tested on cells devoid of mtDNA (rho0 cells), on HeLa cells upon the silencing of well-known mtDNA maintenance factors, and on HeLa cells after treatment with an mtDNA replication inhibitor. The mtDNA levels were also measured by an independent method, namely qPCR.

Access restricted. Please log in or start a trial to view this content.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

1. Preparation of the siRNA mixture

  1. One day before the start of the experiment, seed cells (e.g., HeLa) on a 100 mm dish so that they reach 70%-90% confluence the next day.
    NOTE: All operations must be carried out under sterile conditions in a laminar flow chamber.
  2. Prepare the appropriate amount of siRNA diluted to a concentration of 140 nM in Opti-MEM medium (see Table of Materials). A 96-well plate can be used as a reservoir.
  3. Add 5 µL of the siRNA solution (or Opti-MEM medium for the control samples) to each well of a black 384-well cell culture microplate.
    NOTE: Depending on the number of siRNA samples tested, an electronic or multi-channel pipette can be used.
  4. Prepare the appropriate amount of RNAiMAX transfection reagent solution (see Table of Materials) in Opti-MEM medium. Add 1 µL of RNAiMAX for every 100 µL of medium.
  5. Add 10 µL of the transfection reagent solution to each well of the 384-well plate. The most convenient and fastest way to do this is with a reagent dispenser.
  6. Incubate the siRNA with the transfection reagent for 30 min at room temperature.

2. Preparation of cells for transfection

  1. During the incubation (step 1.6), aspirate the medium using a suction device (see Table of Materials), and wash the cells with 3 mL of PBS.
  2. Add 1.5 mL of trypsin diluted 1:2 in PBS, and incubate the cells at 37 °C for 10 min.
  3. Check if the cells have detached; if so, add 3 mL of DMEM medium with 10% FBS. Suspend the cells thoroughly, and transfer them to a 15 mL tube. Take at least 150 µL of the suspension, and count the cells in a cell-counting chamber (see Table of Materials).
  4. Prepare a cell suspension at the appropriate concentration (35,000/mL for the HeLa line) in DMEM medium with 10% FBS, penicillin, and streptomycin.

3. Cell transfection

  1. Add 20 µL of the cell suspension to each well of the 384-well plate using the reagent dispenser. This will result in 700 cells seeded per well.
  2. Incubate the cells for 1 h at room temperature, and then place them in the incubator for 72 h (37 °C and 5% CO2).

4. BrdU incorporation

  1. Prepare a 90 µM solution of BrdU (see Table of Materials) in DMEM medium with 10% FBS.
  2. At 56 h after the siRNA transfection (16 h before cell fixation), add 10 µL of 90 µM BrdU solution to each well of the 384-well plate (the final BrdU concentration is 20 µM).
    NOTE: The action should be performed as fast as possible; therefore, it is best to use a reagent dispenser, electronic pipette, or multi-dispenser pipette. Remember to prepare control wells without the addition of BrdU.
  3. Incubate the cells for 16 h (37 °C and 5% CO2).

5. Labeling of mitochondria

  1. Prepare a 20 µM solution of BrdU in DMEM with 10% FBS, and add to it the mitochondria tracking dye solution (see Table of Materials) to a concentration of 1.1 µM.
  2. At 15 h after the start of BrdU incorporation (1 h before cell fixation), add 10 µL of the mitochondria tracking dye solution (see Table of Materials) to each well of the 384-well plate (the final dye concentration is 200 nM).
    NOTE: Use a reagent dispenser, electronic pipette, or multi-dispenser pipette. Remember to retain control wells without the addition of BrdU but with the addition of the mitochondria tracking dye.
  3. Incubate the cells for 1 h (37 °C and 5% CO2).

6. Cell fixation

NOTE: All washing is most conveniently carried out using a microplate washer, while the addition of reagents is most quickly carried out using a reagent dispenser.

  1. Using the microplate washer (see Table of Materials), rinse each well twice with 100 µL of PBS. After the second wash, leave 25 µL of PBS in the well.
    NOTE: Leaving PBS in the well reduces the likelihood of cell detachment during the addition of liquid in the next step. All the washes are completed with the PBS left in; therefore, the solution added in the next step should always be prepared at a 2x concentration as it will be added in an equal volume to the remaining PBS.
  2. Fix the cells by adding 25 µL of an 8% formaldehyde solution in PBS with 0.4% Triton X-100 and Hoechst 33342 at a concentration of 4 µg/mL (the final concentrations of individual reagents are 4%, 0.2%, and 2 µg/mL, respectively) (see Table of Materials).
  3. Incubate the plate in the dark at room temperature for 30 min.

7. Blocking

  1. Rinse each well four times with 100 µL of PBS. After the last wash, leave 25 µL of PBS in the well.
  2. Add 25 µL of 6% BSA in PBS (the final BSA concentration is 3%) to each well.
  3. Incubate the plate in the dark at room temperature for 30 min.

8. Addition of the primary antibodies

  1. Aspirate the BSA using a microplate washer, and leave 10 µL of solution in the well.
  2. Add 10 µL of the primary antibody solution prepared in 3% BSA in PBS. Use anti-BrdU at 0.8 µg/mL and anti-DNA at 0.4 µg/mL (the final concentrations of antibodies are 0.4 µg/mL and 0.2 µg/mL, respectively) (see Table of Materials).
  3. Incubate the plate in the dark at 4 °C overnight.

9. Addition of the secondary antibodies

  1. Rinse each well four times with 100 µL of PBS. After the last wash, leave 10 µL of PBS in the well.
  2. Add 10 µL of the 4 µg/mL secondary antibody solution prepared in 6% BSA in PBS (the final concentration is 2 µg/mL). Use isotype-specific antibodies (anti-mouse IgG1 and anti-mouse IgM) conjugated to fluorochromes such as Alexa Fluor 488 and Alexa Fluor 555 (see Table of Materials).
  3. Incubate the plate in the dark at room temperature for 1 h.
  4. Rinse each well four times with 100 µL of PBS. After the last wash, leave 50 µL of PBS in the well.
  5. Seal the plate with an adhesive sealing film (see Table of Materials), and store it in the dark at 4 °C. Imaging must be performed within 2 weeks.

10. Imaging

NOTE: Imaging must be performed with an automated wide-field microscope; the microscope must be equipped with a motor stage supplied with controls to image individual areas of the plate automatically.

  1. Check the autofocus settings in the corner areas of the plate (wells A1, A24, P24, P1) and in the center.
    NOTE: For imaging, it is recommended to use a 20x short working distance objective (see Table of Materials) with the highest possible numerical aperture.
  2. Based on the intensity histograms generated by the imaging software in live view mode, select a sufficiently long exposure time for the individual fluorescence channels so that the resulting image is not oversaturated.
  3. Set the appropriate number of planes for imaging on the z-axis.
    NOTE: The field of view at 20x magnification is large enough that not all cells are in the same plane of focus, so z-sectioning must be performed to view all the cells in their correct plane of focus. Usually, five planes are enough. Depending on the availability of disk space, individual z-stacks or only maximum intensity projections can be saved. The image analysis shown in the representative results section is based on maximum intensity projections.
  4. Select the appropriate number of fields of view to display per well.
    NOTE: Depending on the confluence, approximately 60-300 cells can be imaged in one field of view. Typically, for HeLa cells with a confluence of 60%-90%, imaging five fields of view will allow one to analyze from 500 cells to over 1,000 cells.
  5. Select the wells to be imaged, and start imaging.

11. Quantitative image analysis

NOTE: The quantitative analysis of acquired images can be performed using an open-source software such as Cell Profiler15. For the present study, the analysis was performed using the ScanR 3.0.0 software (see Table of Materials).

  1. Start the analysis by performing background correction for all the images from all the fluorescence channels. Depending on the size of the analyzed objects, select the appropriate filter size: 80 pixels for cell nuclei and 4 pixels for BrdU and mtDNA spots.
  2. Start segmenting the image by creating a mask of the main object based on the ratio of the intensity of the fluorescence signal to the background for the channel corresponding to the cell nuclei.
  3. Create masks for the sub-objects representing the BrdU and mtDNA spots, respectively, using the fluorescence channels appropriate for the given structures.
    NOTE: Each sub-object is assigned to the closest main object (cell nucleus).
  4. Set the parameters to be measured during the analysis, and measure the intensity of the individual pixels within each mask for all the fluorescence channels.
    NOTE: It is also necessary to calculate the number of sub-objects assigned to a given cell nucleus and the area of each sub-object.
  5. Define the derived parameters to be calculated based on the obtained data. To obtain the total fluorescence intensities for the BrdU or mtDNA channel, sum up the intensities of all the sub-objects assigned to a given cell nucleus. To obtain the mean fluorescence intensity, divide the total fluorescence intensity by the sum of the area of the sub-objects assigned to a given cell nucleus.
    NOTE: To ensure that the created sub-object (BrdU or mtDNA spot) is actually located in the mitochondria, it is necessary to gate them based on the fluorescence intensity from the mitochondria tracking dye.
  6. Perform further analysis of the data obtained with the ScanR software using the R 4.2.2 statistical Software16 along with the following packages: dplyr17, data.table18, ggplot219, and ggpubr20. This step is optional.

Access restricted. Please log in or start a trial to view this content.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

A scheme of the procedure for the high-throughput study of the dynamics of mtDNA synthesis and distribution is shown in Figure 1. The use of a multi-well plate format enables the simultaneous analysis of many different experimental conditions, such as the silencing of different genes using a siRNA library. The conditions used for the labeling of newly synthesized DNA molecules with BrdU allow for the detection of BrdU-labeled DNA in the mitochondria of HeLa cells (Figure...

Access restricted. Please log in or start a trial to view this content.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Historically, DNA labeling by BrdU incorporation and antibody detection has been used in nuclear DNA replication and cell cycle research14,27,28. So far, all the protocols for detecting BrdU-labeled DNA have included a DNA denaturation step (acidic or thermal) or enzyme digestion (DNase or proteinase) to enable epitope exposure and facilitate antibody penetration. These protocols were developed for tightly packed nuclear DNA. Ho...

Access restricted. Please log in or start a trial to view this content.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors have nothing to disclose.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

This work was supported by the National Science Centre, Poland (Grant/Award Number: 2018/31/D/NZ2/03901).

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
2′,3′-Dideoxycytidine (ddC)Sigma-AldrichD5782
384  Well Cell Culture Microplates, blackGreiner Bio-One#781946
5-Bromo-2′-deoxyuridine (BrdU)Sigma-AldrichB5002-1GDissolve BrdU powder in water to 20 mM stock solution and aliquot. Use 20 µM BrdU solution for labeling.
Adhesive sealing filmNerbe Plus04-095-0060
Alexa Fluor 488 goat anti-mouse IgG1 secondary antibodyThermo Fisher ScientificA-21121
Alexa Fluor 555 goat anti-mouse IgM secondary antibodyThermo Fisher ScientificA-21426
BioTek 405 LS microplate washerAgilent
Bovine Serum Albumin (BSA)Sigma-AldrichA4503
Cell counting chamber ThomaHeinz HerenzREF:1080339
Dulbecco's Modified Eagle Medium (DMEM)CytivaSH30243.01
Dulbecco's Modified Eagle Medium (DMEM)Thermo Fisher Scientific41965-062
Fetal Bovine Serum (FBS)Thermo Fisher Scientific10270-106
Formaldehyde solutionSigma-AldrichF1635Formaldehyde is toxic; please read the safety data sheet carefully.
Hoechst 33342Thermo Fisher ScientificH3570
IgG1 mouse monoclonal anti-BrdU (IIB5) primary antibodySanta Cruz Biotechnologysc-32323
IgM mouse monoclonal anti-DNA (AC-30-10) primary antibodyProgen#61014
LightCycler 480 SystemRoche
Lipofectamine RNAiMAX Transfection ReagentThermo Fisher Scientific#13778150
MitoTracker Deep Red FMThermo Fisher ScientificM22426Mitochondria tracking dye 
Multidrop Combi Reagent DispenserThermo Fisher Scientific
Opti-MEMThermo Fisher Scientific51985-042
Orca-R2 (C10600) CCD CameraHamamatsu
Penicillin-Streptomycin Sigma-AldrichP0781-100ML
Phosphate buffered saline (PBS)Sigma-AldrichP4417-100TAB
PowerUp SYBR Green Master MixThermo Fisher ScientificA25742
qPCR primer Fw B2M (reference)CAGGTACTCCAAAGATTCAGG 
qPCR primer Fw GPI (reference gene)GACCTTTACTACCCAGGAGA
qPCR primer Fw MT-ND1 TAGCAGAGACCAACCGAACC 
qPCR primer Fw POLGTGGAAGGCAGGCATGGTCAAACC
qPCR primer Fw TFAMGATGAGTTCTGCCTGCTTTAT
qPCR primer Fw TWNKGCCATGTGACACTGGTCATT
qPCR primer Rev B2M (reference)GTCAACTTCAATGTCGGATGG 
qPCR primer Rev GPI (reference gene)AGTAGACAGGGCAACAAAGT
qPCR primer Rev MT-ND1 ATGAAGAATAGGGCGAAGGG 
qPCR primer Rev POLGGGAGTCAGAACACCTGGCTTTGG
qPCR primer Rev TFAMGGACTTCTGCCAGCATAATA
qPCR primer Rev TWNKAACATTGTCTGCTTCCTGGC
ScanR microscopeOlympus
siRNA CtrlDharmaconD-001810-10-5
siRNA POLGInvitrogenPOLGHSS108223
siRNA TFAMInvitrogenTFAMHSS144252
siRNA TWNKInvitrogenC10orf2HSS125597
Suction deviceNeoLab2-9335Suction device for cell culture
Triton X-100Sigma-AldrichT9284-500ML
TrypsinBiowestL0931-500
UPlanSApo 20x 0.75 NA objectiveOlympus

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Brown, G. C. Control of respiration and ATP synthesis in mammalian mitochondria and cells. The Biochemical Journal. 284, 1-13 (1992).
  2. Zhang, L., et al. Biochemical basis and metabolic interplay of redox regulation). Redox Biology. 26, 101284(2019).
  3. Pizzo, P., Drago, I., Filadi, R., Pozzan, T. Mitochondrial Ca2+ homeostasis: Mechanism, role, and tissue specificities. Pflugers Archiv: European Journal of Physiology. 464 (1), 3-17 (2012).
  4. Shadel, G. S., Horvath, T. L. Mitochondrial ROS signaling in organismal homeostasis. Cell. 163 (3), 560-569 (2015).
  5. Martínez-Reyes, I., Chandel, N. S. Mitochondrial TCA cycle metabolites control physiology and disease. Nature Communications. 11 (1), 102(2020).
  6. Galluzzi, L., Kepp, O., Trojel-Hansen, C., Kroemer, G. Mitochondrial control of cellular life, stress, and death. Circulation Research. 111 (9), 1198-1207 (2012).
  7. Rone, M. B., Fan, J., Papadopoulos, V. Cholesterol transport in steroid biosynthesis: role of protein-protein interactions and implications in disease states. Biochimica Et Biophysica Acta. 1791 (7), 646-658 (2009).
  8. Swenson, S. A., et al. From synthesis to utilization: The ins and outs of mitochondrial heme. Cells. 9 (3), 579(2020).
  9. West, A. P., Shadel, G. S., Ghosh, S. Mitochondria in innate immune responses. Nature Reviews. Immunology. 11 (6), 389-402 (2011).
  10. Nunnari, J., Suomalainen, A. Mitochondria: In sickness and in health. Cell. 148 (6), 1145-1159 (2012).
  11. Pohjoismäki, J. L. O., Goffart, S. Of circles, forks and humanity: Topological organisation and replication of mammalian mitochondrial DNA. BioEssays. 33 (4), 290-299 (2011).
  12. Gustafsson, C. M., Falkenberg, M., Larsson, N. -G. Maintenance and expression of mammalian mitochondrial DNA. Annual Review of Biochemistry. 85, 133-160 (2016).
  13. Nicholls, T. J., Gustafsson, C. M. Separating and segregating the human mitochondrial genome. Trends in Biochemical Sciences. 43 (11), 869-881 (2018).
  14. Gratzner, H. G. Monoclonal antibody to 5-bromo- and 5-iododeoxyuridine: A new reagent for detection of DNA replication. Science. 218 (4571), 474-475 (1982).
  15. Stirling, D. R., et al. CellProfiler 4: Improvements in speed, utility and usability. BMC Bioinformatics. 22 (1), 433(2021).
  16. R Core Team. R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing. , Vienna, Austria. (2021).
  17. Wickham, H., François, R., Henry, L., Müller, K. dplyr: A Grammar of Data Manipulation. , Available from: https://CRAN.R-project.org/package=dplyr (2021).
  18. Dowle, M., Srinivasan, A. data.table: Extension of `data.frame. , Available from: https://CRAN.R-project.org/package=data.table (2020).
  19. Wickham, H. ggplot2: Elegant graphics for data analysis. , Available from: https://ggplot2.tidyverse.org (2016).
  20. Kassambara, A. ggpubr: "ggplot2" based publication ready plots. , Available from: https://CRAN.R-project.org/package=ggpubr (2020).
  21. Hashiguchi, K., Zhang-Akiyama, Q. -M. Establishment of human cell lines lacking mitochondrial DNA. Methods in Molecular Biology. 554, 383-391 (2009).
  22. Piechota, J., Szczesny, R., Wolanin, K., Chlebowski, A., Bartnik, E. Nuclear and mitochondrial genome responses in HeLa cells treated with inhibitors of mitochondrial DNA expression. Acta Biochimica Polonica. 53 (3), 485-495 (2006).
  23. Spelbrink, J. N., et al. Human mitochondrial DNA deletions associated with mutations in the gene encoding Twinkle, a phage T7 gene 4-like protein localized in mitochondria. Nature Genetics. 28 (3), 223-231 (2001).
  24. Campbell, C. T., Kolesar, J. E., Kaufman, B. A. Mitochondrial transcription factor A regulates mitochondrial transcription initiation, DNA packaging, and genome copy number. Biochimica et Biophysica Acta. 1819 (9-10), 921-929 (2012).
  25. Krasich, R., Copeland, W. C. DNA polymerases in the mitochondria: A critical review of the evidence. Frontiers in Bioscience. 22 (4), 692-709 (2017).
  26. Kotrys, A. V., et al. Quantitative proteomics revealed C6orf203/MTRES1 as a factor preventing stress-induced transcription deficiency in human mitochondria. Nucleic Acids Research. 47 (14), 7502-7517 (2019).
  27. Gratzner, H. G., Pollack, A., Ingram, D. J., Leif, R. C. Deoxyribonucleic acid replication in single cells and chromosomes by immunologic techniques. Journal of Histochemistry & Cytochemistry. 24 (1), 34-39 (1976).
  28. Leif, R. C., Stein, J. H., Zucker, R. M. A short history of the initial application of anti-5-BrdU to the detection and measurement of S phase. Cytometry. Part A: The Journal of the International Society for Analytical Cytology. 58 (1), 45-52 (2004).
  29. Lentz, S. I., et al. Mitochondrial DNA (mtDNA) biogenesis: visualization and duel incorporation of BrdU and EdU into newly synthesized mtDNA in vitro. The Journal of Histochemistry and Cytochemistry. 58 (2), 207-218 (2010).
  30. Liu, Y., et al. Multi-omic measurements of heterogeneity in HeLa cells across laboratories. Nature Biotechnology. 37 (3), 314-322 (2019).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

High throughputImage based QuantificationMitochondrial DNAReplication MechanismsDistribution FactorsMitochondrial GenomesATP ProductionOxidative PhosphorylationImmunofluorescence DetectionBrdU IncorporationIn Vitro CulturingAutomated Fluorescence Microscopy