The protocol describes an efficient and reliable method for quantifying the poly(A) length of the gene of interest from the Drosophila nervous system, which can be easily adapted to tissues or cell types from other species.
Method Article
The protocol describes an efficient and reliable method for quantifying the poly(A) length of the gene of interest from the Drosophila nervous system, which can be easily adapted to tissues or cell types from other species.
Polyadenylation is a crucial posttranscriptional modification that adds poly(A) tails to the 3' end of mRNA molecules. The length of the poly(A) tail is tightly regulated by cellular processes. Dysregulation of mRNA polyadenylation has been associated with abnormal gene expression and various diseases, including cancer, neurological disorders, and developmental abnormalities. Therefore, comprehending the dynamics of polyadenylation is vital for unraveling the complexities of mRNA processing and posttranscriptional gene regulation.
This paper presents a method for measuring poly(A) tail lengths in RNA samples isolated from Drosophila larval brains and Drosophila Schneider S2 cells. We employed the guanosine/inosine (G/I) tailing approach, which involves the enzymatic addition of G/I residues at the 3' end of mRNA using yeast poly(A) polymerase. This modification protects the RNA's 3' end from enzymatic degradation. The protected full-length poly(A) tails are then reverse-transcribed using a universal antisense primer. Subsequently, PCR amplification is performed using a gene-specific oligo that targets the gene of interest, along with a universal sequence oligo used for reverse transcription.
This generates PCR products encompassing the poly(A) tails of the gene of interest. Since polyadenylation is not a uniform modification and results in tails of varying lengths, the PCR products display a range of sizes, leading to a smear pattern on agarose gel. Finally, the PCR products are subjected to high-resolution capillary gel electrophoresis, followed by quantification using the sizes of the poly(A) PCR products and the gene-specific PCR product. This technique offers a straightforward and reliable tool for analyzing poly(A) tail lengths, enabling us to gain deeper insights into the intricate mechanisms governing mRNA regulation.
Most eukaryotic mRNAs are posttranscriptionally polyadenylated at their 3′ terminus in the nucleus by the addition of non-templated adenosines by canonical poly(A) polymerases. An intact poly(A) tail is pivotal throughout the lifecycle of mRNA, as it is essential for mRNA nuclear export1, facilitates interaction with poly(A)-binding proteins to enhance translational efficiency2, and imparts resistance against degradation3. In certain cases, the poly(A) tail can also undergo extension in the cytoplasm, facilitated by noncanonical poly(A) polymerases4. In the cytoplasm, poly (A) tail length dynamically changes and influences the life span of the mRNA molecule. Numerous polymerases and deadenylases are known for modulating tail length5,6,7. For example, the shortening of poly(A) tails correlates with translational repression, whereas the lengthening of poly(A) tails enhances translation8,9.
Accumulating genomic studies have demonstrated the fundamental significance of the poly(A) tail length across various facets of eukaryotic biology. This includes roles in germ-cell development, early embryonic development, neuronal synaptic plasticity for learning and memory, and the inflammatory response10. There have been numerous methods and assays developed for measuring poly(A) tail lengths. For example, the RNase H/oligo(dT) assay takes advantage of RNase H in the presence or absence of oligo(dT) to study poly(A) tail length11,12. Other methods to study poly(A) tail include the PCR amplification of 3' ends such as rapid amplification of cDNA ends poly(A) test (RACE-PAT)12,13 and the ligase-mediated poly(A) test (LM-PAT)14. Further modifications of the PAT assay include ePAT15 and sPAT16. Enzymatic G-tailing17,18 or G/I-tailing of the 3' end are other variations of the PAT assay. Further modification of these techniques includes the use of fluorescently labeled primers along with capillary gel electrophoresis for high-resolution analysis, referred to as the high-resolution poly(A) test (Hire-PAT)19. These PCR-driven assays allow fast and high-sensitivity poly(A) length quantitation.
With the development of next-generation sequencing, a high-throughput sequencing method, such as PAL-seq20 and TAIL-seq21, allows polyadenylation analyses at a transcriptome-wide scale. However, these methods provide only short sequencing reads of 36-51 nucleotides. Therefore, FLAM-Seq22 was developed for global tail length profiling of full-length mRNA and provides long reads. Nanopore technology23 provides PCR-independent, direct RNA, or direct cDNA sequencing for poly(A) tail length estimations. However, these high-throughput methods are not without limitations. They require large amounts of starting materials, are expensive, and time-consuming. Moreover, analyzing rare transcripts can be extremely challenging with high-throughput methods, and low-throughput PCR-based methods still provide an advantage when a small number of transcripts need to be analyzed, for pilot experiments, and validation of other methods.
We have recently demonstrated that Dscam1 mRNAs contain short poly(A) tails in Drosophila, which necessitates a non-canonical binding of the cytoplasmic poly(A)-binding protein on Dscam1 3'UTR using the G/I tailing method24. Here we provide a streamlined procedure for tissue preparation and quantifying poly(A) length of mRNAs from the Drosophila nervous system and Drosophila S2 cells.
1. Rearing and selecting Drosophila larvae
2. Brain isolation from Drosophila larvae (Figure 1)

Figure 1: Dissection of Drosophila larval brain from 3rd instar wandering stage. (A) Schematic drawings of Drosophila larva. (B-G) Larva dissection. Please click here to view a larger version of this figure.
3. Drosophila S2 Schneider cells
4. Total RNA extraction from Drosophila larvae brain and S2 cells
5. Preparation of RNA gel and electrophoresis
6. Poly(A) tail length measurement

Figure 2: RNA sample preparation and the poly(A)-tail assay. (A) The RNA gel images show total RNA from the Drosophila larva brain (left) and S2 cells (right) on a 1.5% formaldehyde agarose gel. Single-stranded RNA ladder sizes are shown in nucleotides on lane M. Note a major RNA banding at ~600 nt, which is from rRNA. (B) Schematics of poly(A)-tail assay. Abbreviation: G/I = guanosine/inosine. Please click here to view a larger version of this figure.
7. PCR product analysis by agarose gel electrophoresis
8. Capillary electrophoresis
9. Data analysis: poly(A) tail length measurement (Figure 3)

Figure 3: Poly(A) tail length and peak value measurement. Please click here to view a larger version of this figure.
10. Visualizing poly(A) tail length distribution
Here, we analyzed the poly(A) tail length of Dscam1 and GAPDH from Drosophila larval brains (Figure 4). Isolated RNAs were visualized on an agarose gel for quality control. A single RNA band at around 600 nucleotide size indicates intact RNA preparation (Figure 2A). RNAs were subjected to the G/I tailing and high-resolution capillary electrophoresis using an Agilent 2100 bioanalyzer. The gel images were exported using the Agilent 2100 Expert Software and assembled accordingly. The PCR products from GAPDH and Dscam1 gene-specific primer pairs showed a distinct single band while those from the gene-specific/universal primer pairs showed distinct smear patterns (Figure 4A and Table 1), which indicates differential poly(A) length of GAPDH and Dscam1 mRNAs. In Figure 4B, the smear analysis was used to obtain average poly(A) tail lengths from GAPDH and Dscam1. The electropherograms were exported and modified to represent the poly(A) tail lengths (Figure 4C).
Similarly, we performed a poly(A) tail length analysis on S2 cells (Figure 5). To determine the role of Dscam1 3'UTR in shortening poly(A) tails, S2 cells were transfected with the DNA plasmids containing Dscam1 coding region with either SV40 3'UTR or Dscam1 3'UTR. The minimum SV40 3'UTR was selected for control of Dscam1 3'UTR since SV40 3'UTR has been widely used as a minimum transcription termination and polyadenylation signal for recombinant DNA plasmids. Total RNA was extracted and subjected to RT-PCR, G/I tailing, and high-resolution capillary electrophoresis (Figure 5). The result shows that the poly(A) tail length distribution from the SV40 3'UTR plasmid followed a similar pattern as that of endogenous GAPDH while the poly(A) tail length distribution from the Dscam1 3'UTR plasmid followed a similar pattern as that of endogenous Dscam1 mRNA from the larval brains.

Figure 4: Poly(A) tail length measurement of GAPDH and Dscam1 from the larval brains. (A) Capillary gel electrophoresis resolves the gene-specific PCR product as a discrete band (first and second lanes) for GAPDH2 and Dscam1. The PCR product using universal reverse primer shows a smear distribution (third and fourth lane). * non-specific band. (B) The average poly(A)-tail lengths were calculated using the smear analysis. (C) The distribution of poly(A) tail length was reconstructed from the exported csv file. Please click here to view a larger version of this figure.

Figure 5: Poly(A) tail length measurement of transfected Dscam1 DNA plasmid. Cultured Drosophila S2 cells were co-transfected with the Dscam1 constructs that contain the coding region of Dscam1, and the 3′UTR of either Dscam1 or SV40. (A) Capillary gel electrophoresis images are shown for the gene-specific PCR product as a discrete band (first and second lanes) for SV40 (Dscam1-SV40 3'UTR) and Dscam1 (Dscam1-Dscam1 3'UTR). The PCR product using universal reverse primer shows a smear pattern (third and fourth lanes). * non-specific band. (B) The average poly(A)-tail lengths were calculated using the smear analysis. (C) The poly(A) tail length distribution was reconstructed from the exported csv file. Please click here to view a larger version of this figure.
| Dscam1 |
| Forward Primer (5’-3’) CGCAGCCACAACAATTGAATG |
| Reverse Primer (5’-3’) AAATAAAATCAAAATCATATATTTAGCAACTTATGAAC |
| SV40 |
| Forward Primer (5’-3’) CCACAAAGGAAAAAGCTGCAC |
| Reverse Primer (5’-3’) TTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTG |
| GAPDH |
| Forward Primer (5’-3’) CACTTCAGAAACGGCCTGAAAATGGC |
| Reverse Primer (5’-3’) AATATTTAAATGCTTATGAGTCGGCATTTTTAAAACTAC |
| Universal reverse primer |
| Reverse Primer (5’-3’) GGTAATACGACTCACTATAGCGAGACCCCCCCCCCTT |
Table 1: Primers used in this protocol.
Supplemental File 1: Composition of solutions and PCR setup. Please click here to download this File.
In this protocol, we describe the technique to dissect the Drosophila larval brain from wandering 3rd instar stage as well as the sample preparation from Drosophila S2 cells. Due to the labile nature of mRNAs, sample collection requires extra caution. For larval brain dissection, brains should not be damaged during isolation and should not be kept in solution for a prolonged duration. Keeping dissection time to 8-10 min for a round of dissection is essential. It may also be beneficial to supplement the dissection solution with RNAase inhibitors. As for the S2 cell culturing and transfection, carry out all steps in the laminar flow hood.
The RNA isolation step requires additional consideration. We recommend using a laminar flow type clean space that is pretreated with RNase-removing solutions. Apart from RNA yield, it is essential to check the RNA integrity to ensure that the sample has not been degraded during the dissection and isolation steps. RNA integrity can be visualized by denaturing agarose gel electrophoresis. The total RNA from Drosophila exhibits a single banding profile because 28S rRNA is dissociated into two equally sized subunits, which comigrates with the 18S rRNA25. This can be seen as a single band of around 600 nucleotides when using a single-stranded RNA ladder (Figure 2A).
Isolated RNA samples are subjected to the G/I tailing (Figure 2B). Guanosine and inosine residues are added at the 3′-end of RNAs by yeast poly(A) polymerase (PAP)17, which preserves the 3′-end of RNA from enzymatic degradation. The newly synthesized G/I-tag-protected full-length RNAs are reverse-transcribed to yield cDNA samples using the universal reverse primer (3'-tagged C10T2). Followed by a PCR with the gene-specific forward/reverse primers right upstream of the polyadenylation site to generate a PCR product that shows a sharp band. The PCR reactions from a gene-specific forward and the universal reverse primers generate undefined lengths of DNA molecules as a smear on the gel, which reflects varying lengths of poly(A) tails. The PCR products were subsequently analyzed by capillary gel electrophoresis.
When designing primers, it is important to note that the amplicon size with gene-specific forward/reverse primers should be in the range of 50-300 bp. Testing multiple forward primers gives an opportunity to find the best primer that works for poly(A) tail assessment. We recommend designing a reverse primer for gene-specific products just upstream of the predicted poly(A) start site because this provides an opportunity for straightforward calculation of the poly(A) tail lengths. When running PCR reactions, it is important to perform a "no reverse transcriptase control" to rule out amplification from contaminated genomic DNA. PCR optimization with an annealing temperature gradient is highly recommended. Given the nature of this methodology, analyzing poly(A) tail lengths of alternatively polyadenylated mRNA species requires additional consideration. For example, many genes undergo alternative polyadenylation to generate different 3'UTR species26. We recommend using different PCR primer sets to study individual 3'UTR species.
We highly recommend including the gene-specific PCR product on capillary gel electrophoresis in each run since there is a potential migration difference of a few nucleotides in each run. It is essential that the actual base pair size of the gene-specific PCR is used rather than the theoretical sizes when calculating poly(A) tail length.
Some RNAs undergo additional posttranscriptional modifications, including terminal uridylation27. The G/I tailing method may not be suitable for measuring poly(A) tail length when the mRNA is uridylated. This is because the universal reverse primer may not efficiently amplify the mRNA species that has non adenine nucleotides at its 3'-end. The G/I tailing is a PCR-based method, which potentially creates unwanted bias by amplifying shorter fragments more efficiently. Thus, users should be cautious when interpreting the result.
Using the method presented here, we demonstrated that the G/I tailing can be efficiently used to measure poly(A) tail length from the Drosophila nervous system and S2 cells. The method is highly quantitative when coupled with capillary electrophoresis. While high-throughput analyses provide global poly(A) tail analysis, the low-throughput PCR-based method G/I tailing is still very useful for single-transcript analysis, pilot experiments, and validation of other methods. In summary, the choice of method depends on the specific research questions and goals. Researchers should select the method that best suits their experimental needs and resources.
The authors have no conflicts of interest to disclose.
This study was supported by the National Institute of Neurological Disorders and Stroke Grant R01NS116463 to J.K., and the Cellular and Molecular Imaging Core facility at the University of Nevada, Reno, which was supported by National Institutes of Health Grant P20GM103650 and used for research reported in this study.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| 3-(N-morpholino) propanesulfonic acid (MOPS) | Research Product Internation (RPI) | M92020 | |
| Agilent High Sensitivity DNA Kit | Agilent Technologies | 5067-4626 | |
| Agilent software 2100 expert free download demo | Agilent Technologies | https://www.agilent.com/en/product/automated-electrophoresis/bioanalyzer-systems/bioanalyzer-software/2100-expert-software-228259 | |
| Apex 100 bp-Low DNA Ladder | Genesee Scientific | 19-109 | |
| Bioanalyzer | Agilent 2100 Bioanalyzer G2938C | ||
| Diethyl pyrocarbonate (DEPC) | Research Product Internation (RPI) | D43060 | |
| DNA dye (Gel Loading Dye, Purple (6x) | New England biolabs | B7024S | |
| Drosophila S2 cell line | Drosophila Genomics Resource Center stock #181 | ||
| Drosophila Schneider’s Medium | Thermo Fisher Scientific | 21720024 | |
| Ehidium bromide | Genesee scientific | 20-276 | |
| Fetal bovine serum (FBS) | Sigma-Aldrich | F4135 | |
| Forceps Dumont 5 | Fine Science tools | 11254-20 | |
| Nuclease free water | Thermo Fisher Scientific | AM9932 | |
| PBS 10x | Research Product Internation (RPI) | P32200 | |
| Poly(A) Tail-Length Assay Kit | Thermo Fisher Scientific | 764551KT | |
| RiboRuler Low Range RNA Ladder | Thermo Fisher Scientific | SM1833 | |
| RNA Gel Loading Dye (2x) | Thermo Fisher Scientific | R0641 | |
| RNA microprep kit | Zymoresearch | R1050 | |
| RNA miniprep kit | Zymoresearch | R1055 | |
| Scissors-Vannas Spring Scissors - 2.5 mm Cutting Edge | Fine Science tools | 15000-08 | |
| TopVision Agarose Tablets | Thermo Fisher Scientific | R2802 | |
| Tris-Acetate-EDTA (TAE) | Thermo Fisher Scientific | B49 |