Method Article

RNA Interference in the Egg Parasitoid, Trichogramma dendrolimi Matsumura

DOI:

10.3791/66250

November 21st, 2023

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The manipulation of RNA interference (RNAi) presents a formidable challenge in many parasitoid species with diminutive size, such as Trichogramma wasps. This study delineated an efficient RNAi method in Trichogramma denrolimi. The present methodology provides a robust model for investigating gene regulation in Trichogramma wasps.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The egg parasitoids, Trichogramma spp, are recognized as efficient biological control agents against various lepidopteran pests in agriculture and forests. The immature stages of Trichogramma offspring develop within the host egg, exhibiting remarkable diminutiveness (approximately 0.5 mm in adult length). RNA-interference (RNAi) methodology has emerged as a crucial tool for elucidating gene functions in numerous organisms. However, manipulating RNAi in certain small parasitoid species, such as Trichogramma, has generally posed significant challenges. In this study, we present an efficient RNAi method in Trichogramma denrolimi. The outlined procedure encompasses the acquisition and isolation of individual T. dendrolimi specimens from host eggs, the design and synthesis of double-stranded RNA (dsRNA), the in vitro transplantation and cultivation of T. dendrolimi pupae, the micro-injection of dsRNA, and the subsequent assessment of target gene knockdown through RT-qPCR analysis. This study furnishes a comprehensive, visually detailed procedure for conducting RNAi experiments in T. dendrolimi, thereby enabling researchers to investigate the gene regulation in this species. Furthermore, this methodology is adaptable for RNAi studies or micro-injections in other Trichogramma species with minor adjustments, rendering it a valuable reference for conducting RNAi experiments in other endoparasitic species.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Trichogramma spp. are a group of egg parasitoids that have been extensively utilized as highly efficient biological control agents against a wide spectrum of lepidopteran pests in agricultural and forest ecosystems worldwide1,2,3,4. The application of mass-reared Trichogramma provides an environmentally friendly approach for the sustainable management of pests5,6,7. Understanding the molecular biology of Trichogramma wasps provides valuable insights into enhancing the mass-rearing efficiency and field performance of these biological control agents8,9by investigating the methodology of gene regulation and genome editing10.

Since the discovery of double-stranded RNA (dsRNA)-mediated specific genetic interference in Caenorhabditis elegans in 1998, the RNA-interference (RNAi) method has evolved into a vital genetic toolkit for exploring the regulatory mechanisms of organisms by suppressing the expression of target genes11. RNAi experiments have become a standard methodology widely applied to study gene function in numerous insect species12,13. Nevertheless, the manipulation of RNAi presents a formidable challenge in many parasitoid species, particularly among those belonging to the endoparasitic Chalcidoidea family14,15,16. The RNAi method has been documented in at least 13 parasitoid species14,15,16,17,18,19. Among these, the RNAi approach has been comprehensively conducted in Nasonia wasps and is applicable throughout the developmental stages, including embryos, larvae, pupae, and adults14,15,16. It is noteworthy that Nasonia wasps are ectoparasitoids, with their offspring developing in the interstitial space between the host pupa and the puparium, enabling their cultivation in vitro and making them tolerate certain treatments, such as micro-injection. Unlike Nasonia wasps, Trichogramma individuals undergo their entire embryonic, larval, and pupal development inner the host egg. The layer at embryo and larva stages (which may impede dsRNA permeability), vulnerability to damage, and the difficulty in surviving in vitro present formidable obstacles20,21,22. Additionally, the diminutive size of Trichogramma individuals, approximately ~0.5 mm in adult or pupal length, renders them exceedingly intricate to manipulate20,21,22.

In the present study, we outline a comprehensive procedure for conducting RNA interference (RNAi) experiments in Trichogramma denrolimi Matsumura. This procedure encompasses the following procedures: (1) the design and synthesis of double-stranded RNA (dsRNA), (2) microinjection of T. denrolimi pupae, (3) the transplantation and in vitro incubation of these pupae, and (4) the detection of target gene knockdown through RT-qPCR analysis. The target gene selected for the RNAi experiment is the ferritin heavy chain homology (Ferhch). FerHCH, an iron-binding protein, contains a ferroxidase center endowed with antioxidant capabilities, facilitating the oxidation of Fe2+ to Fe3+. It plays an indispensable role in the growth and development of various organisms by maintaining redox equilibrium and iron homeostasis. Depletion of FerHCH can result in the overaccumulation of iron, leading to irreversible tissue damage, and often culminating in significant phenotypic alterations, including growth defects, deformities, and mortality23,24. This study offers a step-by-step guide for conducting RNAi in T. denrolimi, which will be invaluable for investigating the gene functions within the broader context of Trichogramma wasps.

Access restricted. Please log in or start a trial to view this content.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

NOTE: See the Table of Materials for details related to all materials, instruments, software, and reagents used in this protocol.

1. Collection and maintenance of insect culture

  1. Adhere a group of ~5,000 eggs of Corcyra cephalonica (Stainton) onto a 9 cm by 16 cm card using a 1:5 (v/v) solution of gum arabic powder and water25,26.
    NOTE: Avoid attaching too many host eggs to the card as overcrowding makes it impractical for subsequent transfer and dissection procedures.
  2. To prevent the hatching of host eggs, subject the host egg cards to 30 min of ultraviolet (UV) irradiation (Figure 1-i). Subsequently, cut the paper with inactivated eggs into egg cards measuring 1 cm thick and 8 cm in diameter, each containing approximately 300-500 eggs (Figure 1-ii)25,26,27.
  3. Introduce a cohort of 80-120 T. denrolimi wasps into a glass tube measuring 2 cm in diameter and 8 cm in length. Seal the tube with cotton.
    NOTE: Maintain the wasps at a temperature of 25 ± 1 °C, with a light/dark cycle of 16 h of light and 8 h of darkness and maintain a relative humidity of approximately 75%.
  4. Present a host egg card to the wasps for parasitization (Figure 1-ii). Permit the wasps to deposit their eggs into the host eggs for 6 h, after which promptly remove the wasps.
    ​NOTE: Avoid prolonging the parasitization period excessively as this can lead to overcrowding of T. denrolimi offspring within a host egg, resulting in increased offspring wasp mortality28,29.

2. Synthesis of dsRNA

  1. Design primer sets containing a T7 promoter for the synthesis of double-stranded RNA (dsRNA). Choose a 300-400 bp segment from the targeted gene (Ferhch) for dsRNA synthesis.
  2. Acquire commercially synthesized primer sets for the production of dsRNA for the targeted gene and dsGFP for use as a negative control.
  3. Extract RNA content from 100 T. denrolimi wasps using the referenced kit following the manufacturer's protocol9. Check the quality of RNA content; proceed if the value of OD260/OD280 ranges from 1.8 to 2.09.
  4. Purify the RNA content with 2 µL of 5x buffer (1 U/50 µL), 1 µL of DNAse (1 U/50 µL), and 6.5 µL of RNA (~100 ng/µL), 0.5 µL of H2O at 42 °C for 2 min.
  5. Perform reverse transcriptase polymerase chain reaction (RT-PCR) to generate a cDNA template with 10 µL of purified RNA (~100 ng/µL), 4 µL of 5x buffer (1 U/50 µL), 1 µL of Enzyme Mix I (1 U/50 µL), and 4 µL of H2O. Perform RT-PCR using the following settings: 37 °C for 15 min, 85 °C for 5 s. Store the cDNA product at -4 °C until use.
  6. Perform polymerase chain reaction (PCR) to amplify the dsRNA sequences in accordance with the referenced master mix (10 µL of Taq II [1 U/50 µL], 0.8 µL of forward primer [0.4 µM], 0.8 µL of reverse primer [0.4 µM], 0.8 µL of DNA template [40 ng/µL], and 7.6 µL of H2O). Perform PCR using the following settings: 94 °C for 2 min; 35 cycles with 94 °C for 30 s, 60 °C for 30 s, 72 °C for 30; 72 °C for 2 min.
  7. Assess the quality of PCR products by electrophoresis on a 2.0% agarose gel5,9 and confirm the target sequence through Sanger sequencing.
  8. Purify the PCR product using the Gel Extraction Kit as per the manufacturer's guidelines9,23.
  9. Utilize an RNAi System to synthesize dsRNA for the target gene with 10 µL of 2x buffer (0.02 U/µL), 8 µL of DNA template (75 ng/µL), and 2 µL of enzyme mix (1 U/50 µL) with the following settings: 37 °C for 30 min, 70 °C for 10 min, and 25 °C for 20 min. Elute the synthesized dsRNA with 30 µL of Nuclease-Free Water.
  10. Assess the quality of the dsRNA product by visualizing it on a 1.0% agarose gel5,9. Dilute the dsRNA to 7,000 ng/µL. Check the quality of the dsRNA product; proceed if the value of OD260/OD280 ranges from 1.8 to 2.09. Store the dsRNA product at -20 °C until use.

3. Transplantation of T. denrolimi pupae

  1. Cultivate the parasitized host eggs for approximately 8 days at 25 ± 1°C, maintaining a 16 h light/8 h dark cycle and a relative humidity of ~75%. The parasitized host eggs will blacken after 5 days30 (Figure 1-iv,v).
  2. Transfer the host egg card to a dissecting microscope. Employ a pair of tungsten needles (Figure 1-vi) to meticulously remove the chorion from the host eggs (Figure 1-vii) and retrieve the pupa from within (Figure 1-viii)5,17,18.
    NOTE: The tip of the dissecting needle should be less than 0.05 mm.
  3. Prepare a clean plate for the substrate. Pour out 10-15 mL of a 15 g/L agar solution, allowing it to naturally cool (Figure 2-i).
    NOTE: Mix the agar solution with 0.5 g of streptomycin to inhibit the growth of contaminants in vitro.
  4. Employ a disinfected graver to etch several grooves measuring 0.2-0.3 mm in depth and 0.4-0.8 mm in width (Figure 2-ii).
  5. Use a small brush (Figure 2-iii) to transplant a pupa from the dissected host egg into one of the grooves on the agar substrate (Figure 2-iv).
  6. Repeat steps 3.4 and 3.5, transplanting 100-300 pupae individually into the grooves one by one (Figure 2-v).

4. Micro-injecting dsRNA into T. denrolimi pupa

  1. Use a glass needle puller to pull a glass capillary (Figure 3-i,ii). Set the Heat to 280, the Velocity to 170, the Delay to 250, and the Pull to 30 on a needle puller (Figure 3-iii). Prepare multiple capillary glass needles for microinjection (Figure 3-iv,v).
  2. Bevel the tip of the glass needle using an abrasive plate (Figure 3-vi).
    NOTE: Ensure that the injection needle's tip remains sharp; otherwise, it may result in pupal mortality or impede reagent flow through the needle (Figure 3-vii).
  3. Load approximately 2 µL of the dsRNA injection solution with 7,000 ng/µL into the prepared injection needle using a micro-injection pump (Figure 3-vii).
  4. Transfer the agar substrate containing hundreds of pupae onto the platform of a compound microscope (Figure 3-viii).
  5. Carefully insert the injection needle into the abdomen of a T. denrolimi pupa at a ~30° angle to the abdomen under the lens (Figure 3-ix).
  6. Gradually inject ~5 nL of the injection solution (step 4.3) into the T. denrolimi pupa as gently as possible.
    NOTE: The T. denrolimi pupa may slightly swell as the dsRNA solution is injected. Injecting an excessive amount of solution into the pupa or using needles with overly large openings may result in premature pupal death. Change the needles when they become clogged after injecting several to tens of pupae.
  7. Repeat steps 4.5 and 4.6, injecting dsRNA into 600 pupae one by one.
    ​NOTE: For reliable RT-qPCR analysis, RNA content should be isolated from at least 100 pupae. Inject at least 600 pupae for three replicates in the dsRNA treatment and three replicates in the dsGFP negative control9.

5. Incubation of T. denrolimi pupae

  1. Transfer the substrate containing injected pupae to an incubator at 25 ± 1 °C with a 16 h/8 h light/dark cycle and ~75% RH.
  2. Incubate approximately 700 T. denrolimi pupae per treatment for either 24 h or 48 h. Extract RNA content from a group of 100 pupae per replicate9.
    ​NOTE: Remove the shrunk pupae (dead pupae) from the samples; otherwise, it may result in errors in the detection of gene expression.
  3. Incubate ~50 T. denrolimi pupae per treatment until the wasps emerge (Figure 3-x). Record the emergence rate and deformity rate.

6. Detection of targeted gene expression

  1. Design the primer set for the target gene and reference genes for RT-qPCR using a design tool.
    NOTE: Ensure that the sequences of the RT-qPCR primers do not overlap with the targeted region of dsRNA.
  2. Employ the gene forkhead box O (FoxO) as the reference gene in the RT-qPCR analysis; the primers of FoxO have been reported previously9.
  3. Obtain commercially synthesized primer sets. Perform RT-qPCR with 10 µL of Taq II (1 U/50 µL), 0.8 µL of forward primer (0.4 µM), 0.8 µL of reverse primer (0.4 µM), 0.8 µL of template (10 ng/µL), and 7.6 µL of H2O. Perform RT-qPCR using the following settings: 95 °C for 30 s; 35 cycles with 95 °C for 5 s, 57 °C for 30 s, 72 °C for 30; 95 °C for 10 s; 60 °C for 5 s, and 95 °C for 5 s.
  4. Calculate the expression value of the targeted gene by using the 2-ΔΔCt method9,25.
  5. Employ the Kruskal-Wallis test to analyze the expression of the target gene under the influence of different treatments (dsFerhch, dsGFP, non-injection).
    NOTE: Avoid using parametric tests (e.g., t-test) for post-hoc comparisons as the data's heteroscedasticity and non-normality may lead to erroneous conclusions25.

Access restricted. Please log in or start a trial to view this content.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The emergence rate of T. denrolimi pupae injected with dsFerhch was significantly lower than that of those injected with dsGFP or those without injection (Table 1). Among the emerged wasps, 51.85% of T. denrolimi wasps subjected to dsFerhch developed deformed small wings. The deformed wasps were not observed in the wasps injected with dsGFP or without any injection (Table 1). Moreover, the abdomens of T. denrolimi pupae injec...

Access restricted. Please log in or start a trial to view this content.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Trichogramma wasps are recognized as effective biological control agents, specifically targeting a range of lepidopteran pests in agriculture and forestry1. These diminutive wasps undergo their immature stages within the host egg, a characteristic that presents challenges in conducting RNAi experiments5,18. This study offers a comprehensive visual guide for conducting RNAi experiments in T. denrolimi. Given the shared bio...

Access restricted. Please log in or start a trial to view this content.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors declare that they have no conflicts of interest.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

This research was funded by the Projects of the National Natural Science Foundation of China (32172476, 32102275), the Agricultural Science and Technology Innovation Program (CAAS-ZDRW202203, CAAS-ZDRW202108), and Central Funds Guiding the Local Science and Technology Development (XZ202301YD0042C).

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
2x ES Taq MasterMix (Dye)Cowin Biotech, ChinaCW0690HTo amplify the dsRNA sequences
20x PBS Buffer, DEPC treated (7.2-7.6)Sangon Biotech, ChinaB540627-0500To dilute dsRNA
Agar stripShishi Globe Agar Industries Co.,Ltd, Chinan/aTo make culture medium
Ampicillin sodiumSangon Biotech, ChinaA610028To make culture medium
Bioer Constant temperature metal bath BIOER, ChinaMB-102To synthesis dsRNA
Borosilicate glass capillary WPI, USA1B100-4To pull capillary glass needle
Clean bench Airtech, ChinaSW-CJ-1FDTo extract RNA
Double distilled waterSangon Biotech, ChinaA500197-0500To dilute cDNA
Environmental Testing chamber Panasonic, JapanMLR-352H-PCTo culture T. denrolimi
Eppendorf Centrifuge Eppendrof, Germany5418RTo store RNA content
Eppendorf FemtoJet 4iEppendrof, GermanyFemtoJet 4iTo inject T. denrolimi
Eppendorf Refrigerated Centrifuge Eppendrof, Germany5810RCentrifuge
Ethanol solution (75%, RNase-free)Aladdin, ChinaM052131-500mlTo extract RNA
Gel Extraction KitOmega, USAD25000-02To extract cDNA
GUM ArabicSolarbio, ChinaCG5991-500gTo make egg card
Isopropyl alchoholAladdin, China80109218To extract RNA
Laser-Based Micropipette Puller SUTTER, USAP-2000To pull capillary glass needle
Microloader Eppendrof, Germany20 µLTo load dsRNA
Multi-sample tissue grinder LICHEN, ChinaLC-TG-24To grind T. denrolimi
Needle Grinder SUTTER, USABV-10-ETo grind capillary glass needle
Nuclease-Free WaterSangon Biotech, ChinaTo dilute RNA
OLYMPUS MicroscopeOLYMPUS, JapanXZX16To observe T. denrolimi
PCR machine Bio-rad, USAS-1000For DNA amplification
PowerPac BasicBio-rad, USAPowerPacTM BasicTo detect the quality of dsRNA 
Primer of dsGFP (Forward)[TAATACGACTCACTATAGGG]
ACAAACCAAGGCAAGTAATA
Primer of dsGFP (Reverse)[TAATACGACTCACTATAGGG]
CAGAGGCATCTTCAACG
Primer of Ferhch for qPCR (Forward)TGAAGAGATTCTGCGTTCTGCT
Primer of Ferhch for qPCR (Reverse)CTGTAGGAACATCAGCAGGCTT
Primer of Ferhch for RNAi (Reverse)[TAATACGACTCACTATAGGG]AG
TAGCCATCATCTTTCC
Primer of Ferhch for RNAi(Forward)[TAATACGACTCACTATAGGG]
ACACTGTCAATCGTCCTG
Primer of FoxO for qPCR (Forward)CTACGCCGATCTCATAACGC
Primer of FoxO for qPCR (Reverse)TGCTGTCGCCCTTGTCCT
PrimeScript RT reagent Kit with gDNA Eraser (Perfect Real Time)TaKaRa, JapanRR047A
Quantitative Real-time PCR Bio-rad, USACFX 96 TouchTo perform reverse transcriptase polymerase chain reaction (RT-PCR) 
Real-time PCR (TaqMan) Primer and Probes Design Toolhttps://www.genscript.com/tools/real-time-pcr-taqman-primer-design-tool/
T7 RiBoMAX Express RNAi SystemPromega, USAP1700To synthesis dsRNA  in vitro 
TB Green Premix Ex TaqTM figure-materials-1 (Til RnaseH Plus)TaKaRa, JapanRR820ATo perform RT-qPCR
TrichloromethaneKESHI, ChinaGB/T682-2002To extract RNA
TRIzol ReagentAmbion, USA15596018To extract total RNA content from samples
Ultra-low Temperature Freezer Thermo, USAForma 911

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Zang, L. S., Wang, S., Zhang, F., Desneux, N. Biological control with Trichogramma in China: History, present status and perspectives. Annu Rev Entomol. 66, 463-484 (2020).
  2. Zhou, J. C., et al. Optimal clutch size for quality control of bisexual and Wolbachia-infected thelytokous lines of Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae) mass reared on eggs of a substitutive host, Antheraea pernyi Guérin-Méneville (Lepidoptera: Saturniidae). Pest Manag Sci. 76 (8), 2635-2644 (2020).
  3. Li, T. H., et al. Current status of the biological control of the fall armyworm Spodoptera frugiperda by egg parasitoids. J Pest Sci. 96, 1345-1363 (2023).
  4. Zhou, J. C., et al. Effects of temperature and superparasitism on quality and characteristics of thelytokous Wolbachia-infected Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae) during mass rearing. Sci Rep. 9 (1), 18114(2019).
  5. Zhou, J. C., et al. Penetrance during Wolbachia-mediated parthenogenesis of Trichogramma wasps is reduced by continuous oviposition, associated with exhaustion of Wolbachia titers in ovary and offspring eggs. Pest Manag Sci. 78 (7), 3080-3089 (2022).
  6. Huang, N. X., et al. Long-term and large-scale releases of Trichogramma promote pesticide decrease in maize in northeastern China. Entomol Gen. 40 (4), 331-335 (2020).
  7. Wang, P., et al. Performance of Trichogramma japonicum as a vector of Beauveria bassiana for parasitizing eggs of rice striped stem borer, Chilo suppressalis. Entomol Gen. 41 (2), 147-155 (2021).
  8. Ning, S. F., et al. The identification and expression pattern of the sex determination genes and their sex-specific variants in the egg parasitoid Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae). Front Physiol. 14, 1243753(2023).
  9. Huo, L. X., et al. Selection and evaluation of RT-qPCR reference genes for expression analysis in the tiny egg parasitoid wasp, Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae). J Asia Pac Entomol. 25 (2), 101883(2022).
  10. Leung, K., et al. Next-generation biological control: the need for integrating genetics and genomics. Biol Rev Camb Philos Soc. 95 (6), 1838-1854 (2020).
  11. Fire, A., et al. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391 (6669), 806-811 (1998).
  12. Leonard, S. P., et al. Engineered symbionts activate honey bee immunity and limit pathogens. Science. 367 (6477), 573-576 (2020).
  13. Sun, Y., et al. Silencing an essential gene involved in infestation and digestion in grain aphid through plant-mediated RNA interference generates aphid-resistant wheat plants. Plant Biotechnol J. 17 (5), 852-854 (2019).
  14. Li, M., Bui, M., Akbari, O. S. Embryo Microinjection and Transplantation Technique for Nasonia vitripennis Genome Manipulation. J Vis Exp. 130, e56990(2017).
  15. Dalla Benetta, E., Chaverra-Rodriguez, D., Rasgon, J. L., Akbari, O. S. Pupal and Adult Injections for RNAi and CRISPR Gene Editing in Nasonia vitripennis. J Vis Exp. 166, e61892(2020).
  16. Lynch, J. A., Desplan, C. A method for parental RNA interference in the wasp Nasonia vitripennis. Nat Protoc. 1 (1), 486-494 (2006).
  17. Zhu, K. Y., Palli, S. R. Mechanisms, Applications, and Challenges of Insect RNA Interference. Annu Rev Entomol. 65, 293-311 (2020).
  18. Colinet, D., et al. Development of RNAi in a Drosophila endoparasitoid wasp and demonstration of its efficiency in impairing venom protein production. J Insect Physiol. 63, 56-61 (2014).
  19. Wang, B., et al. A digestive tract expressing α-amylase influences the adult lifespan of Pteromalus puparum revealed through RNAi and rescue analyses. Pest Manag Sci. 75 (12), 3346-3355 (2019).
  20. Zhou, J. C., et al. Wolbachia-infected Trichogramma dendrolimi is outcompeted by its uninfected counterpart in superparasitism but does not have developmental delay. Pest Manag Sci. 79 (3), 1005-1017 (2023).
  21. Zhou, J. C., et al. Posterior concentration of Wolbachia during the early embryogenesis of the host dynamically shapes the tissue tropism of Wolbachia in host Trichogramma wasps. Front Cell Infect Microbiol. 13, 1198428(2023).
  22. Lee, T. Y. The development of Trichogramma evanescens Westw. and its influence on the embryonic development of its host, Attacus cynthia ricini Boisd. Acta Entomol Sin Z. 11 (1), 89-119 (1961).
  23. Shen, Y., Chen, Y. Z., Zhang, C. X. RNAi-mediated silencing of genes in the brown planthopper Nilaparvata lugens affects survival, growth and female fecundity. Pest Manag Sci. 77 (1), 365-377 (2021).
  24. Wu, S., Yin, S., Zhou, B. Molecular physiology of iron trafficking in Drosophila melanogaster. Curr Res Insect Sci. 50, 100888(2022).
  25. Zhou, J. C., et al. Wolbachia-Driven Memory Loss in a Parasitic Wasp Increases Superparasitism to Enhance Horizontal Transmission. mBio. 13 (6), e0236222(2022).
  26. Ning, S. F., Zhou, J. C., Liu, Q. Q., Zhao, Q., Dong, H. Gradual, temperature-induced change of secondary sexual characteristics in Trichogramma pretiosum infected with parthenogenesis-inducing Wolbachia. PeerJ. 7, e7567(2019).
  27. Zhang, C., et al. Decreased Wolbachia titers cause gradual change in masculinization of intersex individuals of thelytokous Trichogramma dendrolimi. Entomol Gen. 42 (5), 751-759 (2022).
  28. Zhang, X., et al. Multi-parasitism: A promising approach to simultaneously produce Trichogramma chilonis and T. dendrolimi on eggs of Antheraea pernyi. Entomol Gen. 41 (6), 627-636 (2021).
  29. Zhou, J. C., et al. Effects of Thelytokous parthenogenesis-inducing Wolbachia on the fitness of Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae) in superparasitised and single-parasitised hosts. Front Ecol Evol. 9, 730664(2021).
  30. Flanders, S. E. Notes on the life history and anatomy of Trichogramma. Ann Entomol Soc Am. 30 (2), 304-308 (1937).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

RNA InterferenceTrichogramma DendrolimiEgg ParasitoidGene KnockdownDouble Stranded RNAMicro InjectionHost Egg ParasitizationRT qPCR AnalysisFerritin Heavy ChainBiological Control

Related Articles