Tear-Derived Exosomal miR-15a as New Diagnostic Tool for Diabetic Retinopathy

Summary

This article describes a protocol for the collection and detection of miR-15a from tears as a new diagnostic tool for diabetic retinopathy.

Abstract

Diabetic retinopathy (DR) is a major complication of diabetes mellitus, affecting a significant percentage of the diabetic population. Early diagnosis and intervention are critical for preventing irreversible vision loss. Current diagnostic methods, although effective, have limitations. miRNA, a small non-coding RNA that inhibits the stability and/or translation of an mRNA by binding to the 3'-untranslated regions (3'-UTRs) of target mRNAs, has been increasingly recognized as being significantly associated with diabetes and can be obtained from tears. This study investigated the potential of tear fluid-derived exosomal miR-15a as a novel diagnostic marker for DR. Tear Samples were obtained from 135 diabetic patients (36 with diabetic retinopathy [DR] and 50 without DR) and 49 healthy controls. Exosomes were isolated, and the expression levels of exosomal miR-15a were measured using droplet digital PCR (ddPCR). The results showed that exosomal miR-15a expression was altered in diabetic and DR patients compared to healthy individuals. These findings indicate that exosomal miR-15a derived from tear fluid may play a role in the molecular mechanisms underlying diabetes and its complications. Furthermore, it holds potential as a non-invasive and reliable diagnostic biomarker for diabetic retinopathy, offering high sensitivity and specificity.

Introduction

Diabetic retinopathy (DR) is one of the most prominent microvascular complications of diabetes, threatening the vision of millions around the globe. The global prevalence of DR from population data of IDP Atlas 2019 was estimated at 22.7% out of the whole diabetic population worldwide, with the number of new cases being continuously on the rise, particularly in developed and developing countries¹. Clinically, DR is characterized by early-stage DR or non-proliferative diabetic retinopathy (NPDR), late-stage DR or proliferative diabetic retinopathy (PDR), and the presence of macular edema. Increased vascular permeability and capillary blockage ar....

Protocol

The study was conducted with approval from the Universiti Malaya Medical Centre Medical Research Ethical Committee (Reference number: 20165-2446). Written consent was obtained from all human subjects prior to recruitment. A total of 135 subjects were included from among patients attending the ophthalmology clinic at the Universiti Malaya Medical Centre (UMMC), Kuala Lumpur. Inclusion criteria included patients who received services under UMMC and were aged between 20-80 years. Patients undergoing active insulin treatment, with a history of laser or anti-VEGF treatment in the last 3 months, or on regular anti-platelets or blood thinners were excluded from the study. Su....

Results

Standard curve
A standard curve was created to determine the exact volume of tears collected from each patient. Basically, different volumes of preservative ranges between 3 µL to 25 µL were exposed to Schirmer strips. And the distance of the wet area on the Schirmer was observed. The procedure was repeated three times for each procedure, and the average reading was calculated. A standard curve of the volume of tears collected vs the distance of wet areas of Schirmer was generated (

Discussion

Funduscopy examination, optical coherence tomography, and fluorescein angiography are the currently available detection techniques for diabetic retinopathy detection. The three techniques are often used together to provide a comprehensive assessment of various retinal and choroidal diseases. Funduscopy is a clinical examination routinely performed during diabetic retinopathy assessment. This method is carried out by trained ophthalmologists and is the gold standard for diagnosing diabetic retinopathy. This method enables.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
0.9% w/v Sodium Chloride	Ain Medicare Sdn Bhd	GB16165967618
1x Phosphate Buffer Saline	Thermo Fisher Scientific	10010-023
Applied Biosystems TaqMan MicroRNA Reverse Transcription Kit	Applied Biosystems	4366596
ddPCR Supermix for Probes (No dUTP)	BioRad Laboratories	1863024
ddPCR 96-Well Plates	BioRad Laboratories	12001925
DG8 Cartridges	BioRad Laboratories	1864008
DG8 Gaskets	BioRad Laboratories	1863009
Droplet Generation Oil for Probes	BioRad Laboratories	1863005
Exospin-96 Exosome Isolation Kit	Cell Guidance Systems	EX07-96
miRNeasy Serum/Plasma Advanced Kit	Qiagen	217204
PX1 PCR Plate Sealer	BioRad Laboratories	1814000
QX100 droplet digital PCR System	BioRad Laboratories	QX100
QXDx Droplet Generator	BioRad Laboratories	12001049
Schirmer Strip	Optitech	SCH-100
T100 Thermal Cycler	BioRad Laboratories	1861096
Taqman MicroRNA Assay MTOMED 20 (Assay ID: 000389 )	Applied Biosystems	4440887	Target Sequence: UAGCAGCACAUAAUGGUUUGUG