Method Article

Point-of-care CRISPR-based Diagnostics with Premixed and Freeze-dried Reagents

DOI:

10.3791/66703

August 16th, 2024

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Here, we present the step-by-step preparation of premixed, lyophilized recombinase-based isothermal amplification and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-based reactions, which can be used for the detection of nucleic acid biomarkers of infectious disease pathogens or other genetic markers of interest.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Molecular diagnostics by Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-based detection have high diagnostic accuracy and attributes that are suitable for use at point-of-care settings such as fast turnaround times for results, convenient simple readouts, and no requirement of complicated instruments. However, the reactions can be cumbersome to perform at the point of care due to their many components and manual handling steps. Herein, we provide a step-by-step, optimized protocol for the robust detection of disease pathogens and genetic markers with recombinase-based isothermal amplification and CRISPR-based reagents, which are premixed and then freeze-dried in easily stored and ready-to-use formats. Premixed, freeze-dried reagents can be rehydrated for immediate use and retain high amplification and detection efficiencies. We also provide a troubleshooting guide for commonly found problems upon preparing and using premixed, freeze-dried reagents for CRISPR-based diagnostics, to make the detection platform more accessible to the wider diagnostic/genetic testing communities.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

CRISPR-based diagnostics for the detection of nucleic acid biomarkers was first reported in 20171,2,3,4, and since then, has been proven as next-generation diagnostics with Food and Drug Administration (FDA)-approved tests, particularly for the detection of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) RNA, in multiple countries5,6,7,8. Beyond coronavirus disease 2019 (COVID-19), the technologies have been demonstrated as effective for detecting diverse viruses and bacteria9,10,11,12,13, genetic disease mutations and deletions, and can be engineered to detect protein and small molecule biomarkers2,12. CRISPR-based diagnostics often combine isothermal amplification methods-such as recombinase polymerase amplification (RPA) or loop-mediated isothermal amplification (LAMP)14,15-with CRISPR-based detection using RNA-guided CRISPR-associated (Cas) enzymes with "collateral" endonuclease activity after target recognition3. The dual use of isothermal amplification and CRISPR-based detection confers several desirable attributes to the technologies, particularly high diagnostic accuracy approaching that of the gold-standard polymerase chain reaction (PCR), and capability to multiplex and detect small sequence differences, including single-nucleotide polymorphisms1,9.

The most accurate versions of CRISPR-based diagnostics, however, contain multiple components and steps and can be complicated to perform with non-experts or at the point of care (POC). To address this challenge of extending the use of highly accurate CRISPR-based diagnostics to POC settings, we have developed protocols to prepare premixed, lyophilized, recombinase-based isothermal amplification and CRISPR-based detection reactions, which are easy to use and store7. These protocols should complement existing excellent protocols on CRISPR-based diagnostics14, which contain additional information on the production of biochemical components needed for CRISPR-based diagnostics7, design guidelines1, and formulations using alternative isothermal amplification techniques2,14,15,16 and Cas enzymes12. Ultimately, we hope that CRISPR-based diagnostics can help realize rapid, inexpensive, and sensitive nucleic detection in settings where portable and instrumental-free analyses are required1,9,17.

We primarily use the combination of RPA and Cas13-based detection in our protocols. RPA functions at near-ambient temperatures (37-42 °C), and therefore, has low energy and equipment requirements. Other isothermal amplification reactions require higher temperatures (LAMP, 60-65 °C; strand-displacement amplification (SDA), 60 °C; exponential amplification reaction (EXPAR), 55 °C; and helicase-dependent amplification (HDA), 65 °C)2. The design of RPA primers is also not complex, unlike LAMP primers, and can be extended to multiplexed amplification7,9,14. Even though multiplexing beyond two targets with RPA is difficult in practice, there are clear guidelines on how to design multiplexed RPA primers to minimize interference18.

While carryover contamination remains a big issue in the two-step workflow, the generated amplicons of RPA are small in size and less likely to cause carryover contamination compared to large concatemeric amplicons from LAMP14. RPA primers can be designed according to standard guidelines14: they are generally 25-35 nucleotide-long with melting temperatures of 54 to 67 °C. The amplicon size should be smaller than 200 base pairs. The reverse transcriptase enzyme (RT) can be added to RPA to enable amplification from RNA, and in reverse transcription-RPA (RT-RPA), another enzyme Ribonuclease H (RNase H) is typically added in small amounts to help resolve the resulting RNA: DNA hybrid and promote the amplification reaction5,19. To allow T7 transcription for Cas13-based detection, the T7 RNA polymerase promoter can be placed at the 5' end of the forward RPA primer.

After amplicons are generated from RPA, they can be detected with crRNA-programmed Cas enzymes. Among various Cas enzymes that can be used for amplicon detection, we prefer RNA-targeting Cas13 variants due to their high cleavage activity1 and well-characterized polynucleotide cleavage preferences7,9, the latter of which can be used for multiplexed detection. The crRNA sequence for Cas13 is designed to be complementary (reverse complement) to the target site in the produced RNA with spacer and direct repeat (DR) sequences. The crRNA sequence and RPA primers should not overlap, to avoid undesired Cas-based detection of off-target amplification products, which increases background and false positives14.

Cas-based detection relies on different detection modalities to monitor the cleavage of reporter nucleic acid molecules (RNA reporters for Cas13-based reactions)1,2,14. Different detection modalities include colorimetry, electrochemical readouts, fluorescence, sequencing readouts, and lateral flow strips2. We focus on the fluorescence readout given a variety of fluorophores and reporters such as cyanine 5 (Cy5), rhodamine X (ROX), and carboxyfluorescein (FAM), which can be effectively excited using a single blue LED light source, and their fluorescence analyzed by a microplate reader or a real-time thermal cycler7,14. In addition, fluorescence readout is easy to set up and allows continuous monitoring, which enables real-time quantitation. Multiplexed RPA preamplification and multiplexed Cas13-based detection using Cas enzymes can be combined with multicolor fluorescence readouts for the simultaneous detection of multiple genetic targets2,7.

In our protocols, we first isothermally amplify RNA with RT-RPA by adding the RNA sample to the lyophilized form of the RT-RPA reagent (Figure 1). During RT-RPA, the T7 promoter is added to the generated double-stranded DNA amplicon. Thereafter, the RPA products are transferred to the lyophilized Cas13-based detection, which also contains T7 RNA polymerase. This detection reaction will convert DNA amplicons into RNA (via T7 RNA polymerase), which can be readily detected with crRNA-programmed Cas13. Target-activated Cas13 will cleave reporter molecules to produce detectable fluorescence signal2,7,14. While the protocols here pertain to detection by Leptotrichia wadei (LwaCas13a), they can be extended to simultaneous, multiplexed detection of up to four targets using orthogonal Cas13 and Cas12 enzymes7,9. RPA and Cas-based detection reactions can also be combined into a single tube, albeit at a loss of sensitivity14.

RNA detection process diagram; RT-RPA, T7 polymerase, CRISPR-Cas13a/b; fluorescence analysis.
Figure 1: CRISPR-based detection workflow. The workflow illustrates the detection of two target genes. First, regions of interest within the DNA target are isothermally amplified with RPA; the reaction can be performed with reverse transcription (RT-RPA) when detecting RNA targets. Thereafter, T7 transcription converts dsDNA amplicons to RNAs, which in turn are recognized by Cas13-crRNA complexes capable of eliciting collateral RNase activity upon target binding. Cleavage of quenched fluorescence reporters produces fluorescence signals that can be monitored using a microplate reader, visualized by an LED transilluminator, or used with a real-time thermal cycler. Abbreviations: CRISPR = Clustered Regularly Interspaced Short Palindromic Repeats; RT = reverse transcription; RPA = recombinase polymerase amplification; Cas = CRISPR-associated protein; LED = light-emitting diode. Please click here to view a larger version of this figure.

The key features of the protocols presented here are the premixing formulations for lyophilization. Premixing simplifies the reaction use and enhances reproducibility, but many components within RPA and Cas-based detection-particularly reverse transcription and some labile cofactors such as ATP are not stable in solution. Therefore, we formulate the premixed solutions such that they can be freeze-dried for long-term storage and easy transport and deployment1,9,20. Premixed, freeze-dried reagents also help improve the detection sensitivity, as higher sample volume (and therefore, higher DNA/RNA input) can be added to reconstitute the reaction10. In our formulations, we primarily use trehalose21 as the cryoprotectant in lyophilized RPA and Cas-based detection reactions7. In addition to reagent preservation, trehalose also promotes the reactions via increasing enzyme stabilization16,22,23,24 and decreasing melting temperatures of dsDNA23. Explorations of other stabilizers5,7,21,25,26 beyond trehalose may yield even more optimal formulations for different use scenarios.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

1. Preparation of lyophilized RT-RPA premixed reagents

  1. Equipment preparation
    1. Prepare a liquid nitrogen dewar or tray for flash-freezing of reactions. Fill the dewar or tray with liquid nitrogen.
    2. Freeze dryer
      1. Check for condensed water in draining tubes and the chamber interior; remove the water if needed.
      2. Clean the chamber interior and the 1.5 mL microcentrifuge tube metal rack with RNase decontamination solution, followed by 70% ethanol.
      3. Close the chamber door and the vacuum release valve.
      4. Turn on the freeze dryer.
      5. Manually set the shelf temperature to -30 °C.
    3. Molecular biology equipment
      1. Clean the following with RNase decontamination solution: pipettes, pipette tip racks, a vortex mixer, a spin-down minicentrifuge, and a permanent marker.
      2. Clean the following with tap water, then wipe with cleaning wipe paper: plastic racks for microcentrifuge tubes and a foam box for ice.
      3. Prepare a heating block (used for dissolving/resolubilizing the triglycine solution) by cleaning it with RNase decontamination solution and 70% ethanol. Then, turn it on and set the temperature to 60 °C.
  2. Preparation of premixed RPA reactions
    NOTE: This formulation is for 10 reactions (using three RPA pellets).
    1. Check whether there is any precipitate in the triglycine solution before use. If there are precipitates, dissolve these by incubating at 60 °C and mixing thoroughly before use. Cool the triglycine solution down before adding other heat-sensitive reagents.
      NOTE: Precipitates can form easily if the tube is left at room temperature for a prolonged period.
    2. Remove three RPA pellet strip tubes from the freezer; tap the strip tubes by knocking them gently against the lab bench to dislodge the white pellets.
    3. Transfer all three pellets into a 1.5 mL microcentrifuge tube A.
    4. Pipette 25 µL of nuclease-free water to rinse any remaining RPA powder in the strip tubes and transfer the rinse solution to a new 1.5 mL microcentrifuge tube B.
    5. Add 10 µL of the 0.57 M triglycine solution and 10 µL of primer mix (10 µM each) to the mastermix tube B.
    6. Vortex-mix tube B; then spin down and place the tube on ice.
    7. Add 28.4 µL of the 5x RPA buffer (prepared from 500 µL of 50% (w/v) PEG20000, 250 µL of 1 M Tris pH 7.4, and 100 µL of 100 mM dithiothreitol (DTT)) to the mastermix tube B and mix thoroughly by strong tapping or shaking multiple times.
      NOTE: We make the solution in this manner to help dilute/decrease the viscosity of PEG in the mastermix tube, prior to adding everything to solubilize RPA pellets.
    8. Transfer pellets collected in tube A from Step 1.2.3 into the mastermix tube B and then invert the mastermix tube several times to mix. Observe whether the solution appears homogeneous and monophasic (it will also look slightly opaque) and then, place the tube on ice.
      NOTE: If mixing is not thorough, PEG can cause the solution/suspension to phase-separate.
    9. Add 0.71 µL of 200 Unit/µL RT and 2.84 µL of 5 Unit/µL RNase H to the mastermix tube. Gently tap or invert the mastermix tube up and down many times. Spin down and place the tube on ice.
      NOTE: We add these enzymes after heavy mixing of earlier steps since RT and RNase H are sensitive to shear due to mixing; no more vortexing after RT/RNase H addition.
    10. Aliquot 8.4 µL of the mastermix solution to 10 precooled 1.5 mL tubes and place the tubes on ice. To do this, plunge the pipette tip into the mastermix solution and draw the mastermix solution into the tip slowly and steadily to prevent air bubbles from forming and to ensure accurate volume measurement. Dispense the mastermix solution into a precooled 1.5 ml tube.
      NOTE: With 8.4 µL aliquoted, in our experience, there will be ~1-2 µL suspension left in the mastermix tube. The experimenter can adjust the aliquoting volume down slightly to ensure enough reagents for all 10 reactions. Use proper pipetting techniques when handling viscous solutions.
    11. After aliquoting is completed, place the tubes in a metal rack submerged in liquid nitrogen to prepare them for lyophilization. Allow the tubes to be submerged in liquid nitrogen for 5 min.
      NOTE: As lyophilization removes excess solution, it allows us to add more DNA/RNA input, which helps increase sensitivity. Freeze-dried premixed RPA reactions can be stored at -20 °C for 8 months. Lyophilization helps with reproducibility if a given experiment is performed using RPA mastermixes prepared in the same batch, so making a larger batch also helps.
  3. Lyophilization
    1. At the freeze dryer, check collector and shelf temperatures. If necessary, wait until the collector temperature reaches -75 ± 5 °C and the shelf temperature reaches -30 ± 1 °C.
    2. Cover open tubes in the metal rack with a sheet of cleaning wipe paper, place the metal rack along with the open tubes in the freeze dryer shelf, and close the shelf door.
    3. Select the program shown in Table 1 and press start. After 30 min of the secondary drying step (20 °C, <0.1 mbar; temperature is held infinitely by setting the time of the step to "infinite"), press stop the program.
      NOTE: We let the tubes warm up in the freeze dryer to prevent water condensation.
    4. Release the pressure by opening the vacuum release valve, then remove the rack from the shelf. Cap the tubes immediately and store the lyophilized reactions at -20 °C.
      NOTE: Lyophilized RPA and CRISPR-Cas13a premixed reactions can be stored at -20 °C for 8 months.

2. Preparation of lyophilized CRISPR-Cas13a premixed detection reagents

NOTE: Follow step 1.1 for equipment preparation.

  1. CRISPR-Cas13a premixed reaction preparation (10 reactions)
    1. Remove the following items from storage and place them on ice: 10 µL of LwaCas13a (produced in-house7,8,14) (2 mg/mL), Cas storage buffer, 10 ng/µL (225 nM) crRNA, 25 mM rNTP, 50 Unit/µL T7 RNA polymerase, 2 µM of FAM fluorescence reporter.
    2. Prepare a working solution of LwaCas13a at 126 µg/mL (900 nM) by adding 148.8 µL of Cas storage buffer (50 mM Tris-HCl pH 7.4, 0.6 M NaCl, 5% Glycerol, 2 mM DTT) to 10 µL of 2 mg/mL LwaCas13a.
    3. Prepare the CRISPR-Cas13a mastermix reaction as follows: 71 µL of RNase-free water, 20 µL of 400 mM Tris pH 7.4, 20 µL of 60% (w/v) trehalose, 10 µL of 10 ng/µL (225 nM) crRNA (here, targeting the s and n genes of SARS-CoV-2), 8 µL of 100 mM rNTP mix (25 mM each), 6 µL of 50 Unit/µL T7 RNA polymerase, 25 µL of 2 µM FAM fluorescence reporter, and 10 µL of 126 µg/mL (900 nM) LwaCas13a. Mix well by inverting the mastermix tube; then, spin down.
    4. Aliquot 17 µL of the mastermix into 10 1.5 mL tubes placed on ice. Place the tubes in a rack submerged in liquid nitrogen and allow the tubes to be submerged in liquid nitrogen for 5 min.
  2. Lyophilization
    1. At the freeze dryer, check collector and shelf temperatures and wait until the collector temperature reaches -75 ± 5 °C and the shelf temperature reaches -30 ± 1 °C.
    2. Place the tubes in the freeze-dryer. Select the program shown in Table 1 and press start. After 30 min of the secondary drying step (25 °C, <0.1 mbar; temperature is held infinitely by setting the time of the step to "infinite"), stop the program.
    3. Release the pressure by opening the vacuum release valve and remove the rack from the shelf. Cap the tubes immediately and store the lyophilized reactions at -20 °C.
      NOTE: Lyophilized RPA and CRISPR-Cas13a premixed reagents can be stored at -20 °C for 8 months.

3. RT-RPA nucleic acid amplification

NOTE: To prevent cross-contamination, workplace areas and pipettors should be separated for pre amplification, sample addition, and post amplification. We recommend using filtered pipette tips.

  1. Prewarm a thermal shaking incubator at 42 °C.
  2. Add 1 µL of magnesium acetate (Mg(OAc)2) and potassium acetate (KOAc) solution mix (composed of 196 mM Mg(OAc)2 and 1.5 M KOAc) to the side of the tube containing the lyophilized, premixed RT-RPA pellet (from section 1).
    NOTE: A trick to add the Mg(OAc)2 and KOAc mix: the drop should be placed at around the 1 mL volume mark of the tube. Here, the drop will be clearly visible and is not likely to be lost from tube closing or other actions. The amplification will start after spinning down to collect the drop at the tube bottom. When processing more than one reaction at a time the amplification can be initiated simultaneously.
  3. Resuspend the RT-RPA pellet by adding 12.4 µL of the RNA sample (or the control samples).
    NOTE: The sequence of addition is negative sample/negative control, RNA/DNA to be tested, positive sample/positive control.
  4. To initiate the RT-RPA reaction, briefly spin down the added solution from steps 3.2 and 3.3 using a spin-down minicentrifuge at room temperature for 3 s.
  5. Mix by carefully tapping the tube and then do another brief spin-down for 3 s.
  6. Incubate the reaction at 42 °C for 60 min by placing it in a preheated heating block or a thermal shaking incubator.
  7. After the end of the reaction, take out the reaction tubes and place them on ice before proceeding to the CRISPR-Cas detection step (section 4).
    NOTE: The RPA-amplified product can be used in the detection reaction immediately or can be stored at 4 °C for several days or at -20 °C for several months.

4. CRISPR-Cas13 nucleic acid detection

  1. Turn on a fluorescence microplate reader, set and preheat the heating temperature to 37 °C, and select the program shown in Table 2.
  2. Place a 384-well plate on ice.
  3. Resuspend the lyophilized CRISPR-Cas premixed detection reaction (from section 2) by adding 17 µL of 8 mM magnesium chloride solution. Mix by carefully tapping the tube; then briefly spin down for 3 s and place the tube on ice.
  4. Transfer 18 µL of the resuspended reaction mix to each well of the precooled 384-well plate on ice.
  5. Add 2 µL of the RPA product prepared in section 3 to each reaction well.
  6. Remove the plate from the ice, quickly place it into a preheated fluorescence microplate reader, and press start.
    NOTE: A 384-well plate was placed on ice to allow synchronization of reaction initiation when the 384-well plate is transferred into a preheated fluorescence microplate reader.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

We highlight the kinetics of FAM fluorescence signal generation from the combined detection of s and n genes of SARS-CoV-2, and how the information was used to determine optimal conditions for lyophilized, premixed reaction formulations. In all cases, we included samples with Ct values well within the determined detection limit (LoD) (Ct ~31-33), as well as those with Ct at the LoD (Ct ~35-37)7, to allow differentiation of protocols with better sensitivity.

For lyophilized, premixed RT-RPA, we found that the inclusion of KOAc in the premixed reaction negatively affected the reaction sensitivity (Figure 2A). We therefore omitted KOAc from the premixed reaction and added it with the reaction initiator, Mg(OAc)2, once the RNA sample had been added. We also used similar assays to determine the optimal concentration of a cryoprotectant trehalose (Figure 2B) and the effects of triglycine7 in the lyophilized RT-RPA reaction (Figure 2C). Therefore, optimal lyophilized, premixed RT-RPA reactions were prepared with 6% trehalose, no KOAc (but it was added later after the RNA sample), and supplemented with triglycine, as described in protocol section 1.

CRISPR-Cas kinetics; fluorescence graphs; KCl, trehalose, and Tricine effects; experimental results.
Figure 2: Optimizing lyophilized, premixed RT-RPA reactions. RT-RPA reaction was prepared using primers targeting the n gene of SAR-CoV-2. Mg(OAc)2 was excluded from all premixed reactions. Effects of (A) KOAc, (B) trehalose, and (C) triglycine added to the premixed reactions were evaluated. Reaction monitoring via generated FAM fluorescence was carried out using a real-time thermal cycler or a fluorescence microplate reader. Individual data from triplicate measurements are shown. Abbreviations: RT = reverse transcription; RPA = recombinase polymerase amplification; CRISPR = Clustered Regularly Interspaced Short Palindromic Repeats; Cas = CRISPR-associated protein; SAR-CoV-2 = Severe Acute Respiratory Syndrome Coronavirus 2; Ct = cycle threshold; FAM = carboxyfluorescein. Please click here to view a larger version of this figure.

For lyophilized, premixed Cas13a-based reactions, we verified the importance of having the correct cryoprotectant: either 6% trehalose or 2% sucrose19 worked well, while lower sucrose at 1% or 5% w/v PEG20000 did not preserve the reaction efficiency after lyophilization (Figure 3). MgCl2 was omitted from all reactions and was added at the rehydration step. The optimal lyophilized Cas13-based detection reaction was prepared with 6% trehalose as shown in protocol section 2.

CRISPR-Cas reaction graph; fluorescence vs. time; lyophilization effect; additive impact.
Figure 3: Optimizing lyophilized, premixed Cas13-based detection reactions. The detection reaction was performed at 37 °C using the RPA product from the SARS-CoV-2 n gene. The tests were done before and after lyophilization. MgCl2 was excluded from all premixed reactions. The abilities of (A) trehalose, (B) PEG20000, and (C) sucrose in preserving reaction efficiency after lyophilization were evaluated. Reaction monitoring via generated FAM fluorescence was carried out using a real-time thermal cycler. Individual data from triplicate measurements for the "after lyophilization" conditions and one replicate from the "before lyophilization" conditions are shown. Figure 3A,B was taken from Patchsung et al.7. Abbreviations: RPA = recombinase polymerase amplification; SAR-CoV-2 = severe acute respiratory syndrome coronavirus 2; FAM = carboxyfluorescein. Please click here to view a larger version of this figure.

The lyophilized, premixed reagents for RT-RPA and Cas13-based reactions are stable at -20 °C for at least 8 months [Figure 4].

Lyophilized RPA stability graphs over time; CRISPR-Cas fluorescence analysis; experimental results.
Figure 4: Stability tests of lyophilized, premixed RPA and CRISPR-Cas13a reagents at -20 °C. Stability test at (A) 30 days, (B) 45 days, (C) 3 months, (D) 5 months, (E) 8 months. Individual data from triplicate measurements are shown. Please click here to view a larger version of this figure.

The LoD of lyophilized RT-RPA and Cas13-based reactions for the detection of s and n genes of SARS-CoV-2 is shown in Figure 5. The kinetics of signal generation can be improved upon dual gene detection compared to when only one gene is detected.

Lyophilized CRISPR-Cas reaction graphs; fluorescence vs. time; singleplex vs. multiplex data comparison.
Figure 5: Analytical sensitivity of single-gene vs dual-gene detection. (A) The LoD of lyophilized singleplex RT-RPA and Cas-based detection targeting the s gene of SAR-CoV-2. (B) The LoD of lyophilized singleplex RT-RPA and Cas-based detection targeting the n gene of SAR-CoV-2. (C) The LoD of lyophilized multiplex RT-RPA and dual Cas-based detection targeting the s and n genes. The LoD was determined using serially diluted SARS-CoV-2 RNAs, whose Ct values were determined using an RT-qPCR assay targeting the n gene. Individual data from 3-6 replicate measurements are shown. Abbreviations: LoD = limit of detection; RT = reverse transcription; RPA = recombinase polymerase amplification; CRISPR = Clustered Regularly Interspaced Short Palindromic Repeats; Cas = CRISPR-associated protein; SAR-CoV-2 = Severe Acute Respiratory Syndrome Coronavirus 2; Ct = cycle threshold; qPCR = quantitative polymerase chain reaction. Please click here to view a larger version of this figure.

Beyond virus detection, we showcase a prototype of a POC genotyping tool based on CRISPR diagnostics, to help identify venomous snake species endemic to Thailand (Figure 6). Faster and accurate identification of snake species through DNA samples collected from bite wounds can aid in the prompt administration of antivenoms, improving the patient's chance of survival. We targeted regions within the mitochondrial cytochrome b (cytb) gene of eight snake species including Ophiophagus hannah (King cobra) (Figure 6A) and showed that detection of synthetic DNA surrogates of the O. hannah cytb gene can reach the attomolar level of sensitivity (Figure 6B,C).

RPA and T7 transcription diagram; CRISPR-Cas reaction graph; fluorescence intensity results.
Figure 6: A prototype for CRISPR-based detection to identify snake species from snakebite envenoming. (A) RPA primers and LwaCas13a crRNA design for the detection of the cytb gene of Ophiophagus hannah. T7 promotor (T7 overhang) was placed at the 5' end of the forward RPA primer. (B) Kinetics of FAM signal generation over 60 min and (C) endpoint FAM fluorescence from LwaCas13a-mediated detection of synthetic dsDNA inputs corresponding to the cytb gene segments from O. hannah. Different input concentrations (0, 10-9, 10-12, 10-15, and 10-18 M) were used. Data are mean ± s.d. from triplicate measurements. Abbreviations: RPA = recombinase polymerase amplification; CRISPR = Clustered Regularly Interspaced Short Palindromic Repeats; Cas = CRISPR-associated protein; FAM = carboxyfluorescein. Please click here to view a larger version of this figure.

Lyophilization of CRISPR-Cas13a premixed detection reagents
StepRamp RateShelf TempTime (hh:mm)Vaccuum
(°C/min)(°C)(mbar)
Freeze 13-30off-
Dry 13-30off0
Dry 23401:000
Dry 33200

Table 1: Lyophilizer settings of premixed RT-RPA and CRISPR-Cas13a detection reagents. Abbreviations: RT = reverse transcription; RPA = recombinase polymerase amplification; CRISPR = Clustered Regularly Interspaced Short Palindromic Repeats; Cas = CRISPR-associated protein.

ParameterSetting
Temperature37 °C
Kinetic cycleDuration time02:00 (mm:ss)
Interval time02:30 (mm:ss)
ShakingDuration time1 sec
ModeLinear
Amplitude1 mm
Fluorescence intensityExcitation wavelength488 nm
Emission wavelength520 nm
ModeTop
Z-Position24470
Gain71
Integration time20 µs
Number of flashes25

Table 2: Fluorescence microplate reader program for nucleic acid detection.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

There are critical steps in this protocol. For area segregation, it is recommended to use separate spaces for nucleic acid extraction, mastermix preparation (pre amplification area), sample addition, and amplicon detection (post amplification area). Each area should be set by using a separate set of tools and equipment. Do not bring tools from one area into another area, especially from the post amplification area into the pre amplification area. Cleaning of working areas is necessary: one should clean working areas, pipettes, vortexers, and permanent markers with RNase/DNase decontamination solution/3% Clorox followed by 70% ethanol or autoclaved deionized water. Washing basic labware and removable parts of instruments, such as 1.5 mL tube plastic racks and the rotor adaptor of a minicentrifuge is required. Nuclease-free water is used as a negative control and a reaction component, and thus is a sensitive reagent that can be contaminated if not handled carefully. So, we recommend making small aliquots of water to be only used once.

Always run a negative control reaction using the assay primers to check for contamination. Additionally, to avoid contamination problems, we recommend preparing the negative control reaction by adding nuclease-free water in the pre amplification area instead of the sample addition room. Magnesium acetate-potassium acetate mixture should be aliquoted in small volumes (~20 µL/tube) that are only used once to avoid reagent contamination with carryover amplicons. When adding the magnesium-potassium acetate mixture to lyophilized premix RPA reactions, we recommend changing the pipette tip every time. For the workflow of experiments, keep the workflow unidirectional, from pre amplification to post amplification experiments. Move from "cleaner" (pre amplification) workspaces toward "dirtier" (post amplification) ones.

For modifications and troubleshooting of the method to avoid carryover contamination of amplicons, we recommend spatially separating the three main steps of the experiment: preparation of the RPA reaction; sample addition; and the amplification and detection steps. The mastermix should be prepared in a template-free area of the lab. When changing rooms, also change gloves and lab coats. Work unidirectionally from pre to post amplification. Avoid using the same pipette for different steps. It is best if different sets of pipettes are arranged for these steps: preparation of mastermixes; addition of the template DNA/RNA; and the transfer of the amplified product. Use filtered tips, try to prevent aerosol formation as much as possible, and avoid touching the inside of the tube when opening it. If amplification experiments show contamination, all reagents should be changed. If possible, go to another lab with fresh reagents and check if contamination persists. Aside from reagents, do not bring anything else including pipettes. Try autoclaving pipettes if they are autoclavable.

To improve the amplification rate (assay optimization), first, consult the manufacturer's instructions such as the RPA manual from TwistDx to ensure optimal designs. Next, try empirical optimizations of the reactions such as adding reaction additives known to boost RPA and CRISPR reactions7; increasing the reaction times (e.g., RPA reaction time up to 60 min); or varying primer sequences and concentrations. We also recommend adding as much sample volume as possible; using lyophilized reagents allows more sample volume to be added. To reduce background fluorescence, one can do a heat inactivation step (75 °C for 5 min) after RPA is finished, before moving on to detection, or optimize the concentration of the reporter. Too much reporter will give a higher background. In addition, adding RNase inhibitors helps to prevent Cas-independent degradation of the reporter.

Beyond optimizing (RT)-RPA and CRISPR-based reaction conditions and their handling procedures, one should ensure that reagents used are of good quality, and that the nucleic acid extraction step preceding all reactions is successful. Lyophilized reagents provide high detection sensitivity, are portable, enable POC testing, and can be applied to diverse clinical samples. Moreover, lyophilized (RT)-RPA can be rehydrated instantly by adding the nucleic acid extract from clinical samples. A previous study showed higher sensitivity when putting a greater volume of nucleic acid input with no restricted volume, effectively increasing the total amount of target nucleic acid.

CRISPR-based diagnostics have been adapted to detect pathogens by collecting clinical samples such as nasopharyngeal and throat swabs, urine, and serum7,8,11. It has also been applied to distinguish single nucleotide variants, identify antibiotic-resistance genes in antimicrobial-resistant organisms, and detect cancer-associated mutations. The utility of the technology may be the greatest in field applications where engineered biochemical reactions for isothermal amplification and CRISPR-based detection can be combined with field-ready devices and readouts such as a handheld fluorometer or lateral flow strips.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

M.P. and C.U. have filed a patent in Thailand on the formulations for multiplexed detection of SARS-CoV-2 RNA. R.K. declares no competing interests.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

C.U. acknowledges funding from Siam Commercial Bank under VISTEC-Siriraj Frontier Research Center, and from Thailand Science Research and Innovation (TSRI), fundamental fund, fiscal year 2024, grant number FRB670026/0457. R.K. and M.P. are supported by studentship and research assistantship funds from VISTEC, respectively.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Material
Betaine solutionSigma-AldrichB0300-1VL
DEPC-Treated waterInvitrogenAM9915G
Dithiothreitol (DTT)Merck3870-25GM
EpiScript reverse transcriptaseLucigenERT12925K
Gly-Gly-Gly Sigma-AldrichSIA-50239-1G
LwaCas13aProducing in-houseStrain name:Leptotrichia wadei, Abbreviation: Lwa, Protein name: LwaCas13a
Magnesium chloride solution, 1MSigma-AldrichM1028-10X1ML
NxGenT7 RNA polymeraseLucigen30223-2
Poly(ethylene glycol)Sigma-Aldrich81300-1KG
Potassium acetate solution, 5MSigma-Aldrich95843-100ML-F
Riobnucleotide Solution MixNEBN0466L
RNase HNEBM0297L
SucroseTCITCI-S0111-500G
Trehalose DihydrateSigma-AldrichSIA-90210-50G
Trizma hydrochloride solution, 1M, pH 7.4Sigma-AldrichT2194-100ML
TwistAmp Basic kitTwistDxTABAS03KIT
Equipment
BluPAD Dual LED Blue/White light transilluminatorBio-HelixBP001CU
Dry Bath Dual BlockELITE4-2-EL-02-220Model: EL-02
Fluorescence microplate readerTecan30050303Model: Infinite 200 Pro
Freeze dryerLABCONCO794001030FreeZone Triad Benchtop Freeze Dryer
Microplate 384-wellGreinerGDE0784076F-Bottom, small volume, Hibase, Med. Binding, Black
Real-time thermal cycler (CFX Connect Real-Time PCR System)Bio-Rad185-5201Model: CFX Connect Optics Module
Oligonucleotide
s-gene forward RPA primerIDTGAAATTAATACGACTCAC
TATAGGGAGGTTTCAAAC
TTTACTTGCTTTACATAGA
s-gene reverse RPA primerIDTTCCTAGGTTGAAGA
TAACCCACATAATAAG
n-gene forward RPA primerIDTGAAATTAATACGACTC
ACTATAGGAACTTCTC
CTGCTAGAATGGCTG
n-gene reverse RPA primerIDTCAGACATTTTGCTCTC
AAGCTGGTTCAATC
LwaCas13a-crRNA for the s geneSynthegoGAUUUAGACUACCCCAAAAAC
GAAGGGGACUAAAACGCAGCA
CCAGCUGUCCAACCUGAAGAAG
LwaCas13a-crRNA for the n geneSynthegoGAUUUAGACUACCCCAAAAACG
AAGGGGACUAAAACAAAGCAAG
AGCAGCAUCACCGCCAUUGC
FAM-polyU-IABkFQ reporterIDT56-FAM/rUrUrUrUrU/3IABkFQ
O-hannah_cytb_F RPA primerIDTGAAATTAATACGACTCACTA
TAGGGTACGGATGAACCATA
CAAAACCTTCACGCAATCG
O-hannah_cytb_R RPA primerIDTAAGATCCATAGTAGATTC
CTCGTGCGATGTGGATA
synT7crRNA13a_ O_hannah IDTGCGCATCCATATTCTTCAT
CTGCATTTAGTTTTAGTCC
CCTTCGTTTTTGGGGTA
GTCTAAATCCCCTATAGT
GAGTCGTATTAATTTC

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Gootenberg, J. S., et al. Nucleic acid detection with CRISPR-Cas13a/C2c2. Science. 356 (6336), 438-442 (2017).
  2. Kaminski, M. M., Abudayyeh, O. O., Gootenberg, J. S., Zhang, F., Collins, J. J. CRISPR-based diagnostics. Nat Biomed Eng. 5 (7), 643-656 (2021).
  3. Makarova, K. S., Koonin, E. V. Annotation and classification of CRISPR-Cas systems. Methods Mol Biol. (1311), 47-75 (2015).
  4. Chen, J. S., et al. CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science. 360 (6387), 436-439 (2018).
  5. Arizti-Sanz, J., et al. Simplified Cas13-based assays for the fast identification of SARS-CoV-2 and its variants. Nat Biomed Eng. 6 (8), 932-943 (2022).
  6. Broughton, J. P., et al. CRISPR-Cas12-based detection of SARS-CoV-2. Nat Biotechnol. 38 (7), 870-874 (2020).
  7. Patchsung, M., et al. A multiplexed Cas13-based assay with point-of-care attributes for simultaneous COVID-19 diagnosis and variant surveillance. CRISPR J. 6 (2), 99-115 (2023).
  8. Patchsung, M., et al. Clinical validation of a Cas13-based assay for the detection of SARS-CoV-2 RNA. Nat Biomed Eng. 4 (12), 1140-1149 (2020).
  9. Gootenberg, J. S., et al. Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6. Science. 360 (6387), 439-444 (2018).
  10. Lee, R. A., et al. Ultrasensitive CRISPR-based diagnostic for field-applicable detection of Plasmodium species in symptomatic and asymptomatic malaria. Proc Natl Acad Sci U S A. 117 (41), 25722-25731 (2020).
  11. Myhrvold, C., et al. Field-deployable viral diagnostics using CRISPR-Cas13. Science. 360 (6387), 444-448 (2018).
  12. Wu, H., et al. Versatile detection with CRISPR/Cas system from applications to challenges. Trends Analyt Chem. 135, 116150(2021).
  13. Yao, R., et al. CRISPR-Cas13a-based detection for bovine viral diarrhea virus. Front Vet Sci. 8, 603919(2021).
  14. Kellner, M. J., Koob, J. G., Gootenberg, J. S., Abudayyeh, O. O., Zhang, F. SHERLOCK: nucleic acid detection with CRISPR nucleases. Nat Protoc. 14 (10), 2986-3012 (2019).
  15. Selvam, K., et al. RT-LAMP CRISPR-Cas12/13-based SARS-CoV-2 detection methods. Diagnostics (Basel). 11 (9), 1646(2021).
  16. Carter, C., Akrami, K., Hall, D., Smith, D., Aronoff-Spencer, E. Lyophilized visually readable loop-mediated isothermal reverse transcriptase nucleic acid amplification test for detection Ebola Zaire RNA. J Virol Methods. 244, 32-38 (2017).
  17. Bhardwaj, P., Kant, R., Behera, S. P., Dwivedi, G. R., Singh, R. Next-generation diagnostic with CRISPR/Cas: Beyond nucleic acid detection. Int J Mol Sci. 23 (11), 6052(2022).
  18. Twistamp. Twistamp® assay design manual. , (2023).
  19. Qian, J., et al. An enhanced isothermal amplification assay for viral detection. Nat Commun. 11 (1), 5920(2020).
  20. Ghouneimy, A., Mahas, A., Marsic, T., Aman, R., Mahfouz, M. CRISPR-based diagnostics: Challenges and toward point-of-care applications. ACSSynth Biol. 12 (1), 1-16 (2023).
  21. Jones, K. L., Drane, D., Gowans, E. J. Long-term storage of DNA-free RNA for use in vaccine studies. Biotechniques. 43 (5), 675-681 (2007).
  22. Fang, X., et al. Real-time monitoring of strand-displacement DNA amplification by a contactless electrochemical microsystem using interdigitated electrodes. Lab Chip. 12 (17), 3190-3196 (2012).
  23. Mok, E., Wee, E., Wang, Y., Trau, M. Comprehensive evaluation of molecular enhancers of the isothermal exponential amplification reaction. Sci Rep. 6 (1), 37837(2016).
  24. Wan, J., et al. Development of a test kit for visual loop-mediated isothermal amplification of Salmonella in spiked ready-to-eat fruits and vegetables. J Microbiol Methods. 169, 105830(2020).
  25. Curti, L. A., et al. Evaluation of a lyophilized CRISPR-Cas12 assay for a ensitive, specific, and rapid detection of SARS-CoV-2. Viruses. 13 (3), 420(2021).
  26. Joung, J., et al. Detection of SARS-CoV-2 with SHERLOCK one-pot testing. N Engl J Med. 383 (15), 1492-1494 (2020).

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

CRISPR DiagnosticsPoint Of Care TestingIsothermal AmplificationNucleic Acid DetectionRecombinase Polymerase AmplificationPathogen DetectionGenetic Marker DetectionCas13a DetectionFluorescence Microplate Reader

Related Articles