We present protocols for the assessment of double strand break repair pathway proficiency in cells using a suite of luminescence-based extrachromosomal reporter substrates.
Method Article
* These authors contributed equally
We present protocols for the assessment of double strand break repair pathway proficiency in cells using a suite of luminescence-based extrachromosomal reporter substrates.
The repair of DNA double strand breaks (DSBs) is crucial for the maintenance of genome stability and cell viability. DSB repair (DSBR) in cells is mediated through several mechanisms: homologous recombination (HR), non-homologous end joining (NHEJ), microhomology-mediated end joining (MMEJ), and single strand annealing (SSA). Cellular assays are essential to measure the proficiency and modulation of these pathways in response to various stimuli.
Here, we present a suite of extrachromosomal reporter assays that each measure the reconstitution of a nanoluciferase reporter gene by one of the four major DSBR pathways in cells. Upon transient transfection into cells of interest, repair of pathway-specific reporter substrates can be measured in under 24 h by the detection of Nanoluciferase (NanoLuc) luminescence.
These robust assays are quantitative, sensitive, titratable, and amenable to a high-throughput screening format. These properties provide broad applications in DNA repair research and drug discovery, complementing the currently available toolkit of cellular DSBR assays.
DNA double strand breaks (DSBs) represent a particularly toxic class of DNA damage1 due to which cells have evolved multiple DSB repair (DSBR) pathways to repair these lesions. The four major DSBR mechanisms are homologous recombination (HR), non-homologous end joining (NHEJ), microhomology-mediated end joining (MMEJ), and single strand annealing (SSA)2,3. DSBR pathways contribute to the maintenance of healthy tissue development and physiology and protect against diseases such as cancer. Furthermore, these repair mechanisms hold therapeutic potential for the development of small molecule modulators in precision oncology. For example, targeting DNA Polymerase θ (Polθ), a pivotal enzyme in the MMEJ repair pathway, has attracted interest due to its synthetic lethality with HR deficiency in cancer4.
Understanding DSBR therefore has broad clinical implications and functional cellular assays capable of measuring the activity of all the major DSBR pathways are needed5. Assays must be suitable for both genetic and pharmacological interrogation and deployable across cell models of interest. To support small molecule drug discovery efforts, assays must be highly sensitive, titratable, have a fast turnaround, and be scalable to high-throughput formats suitable for compound screening.
In general, DSBR has been previously measured using fluorescence-based reporter assay systems stably integrated into the cell genome6. However, while physiological recapitulation of chromosomal DSBR is a distinct advantage, such assays are restricted to a host model in which the reporter is integrated, utilize labor-intensive sample preparation and analysis by flow cytometry, and have limited throughput, turnaround time, robustness, and sensitivity, all essential features necessary for drug discovery efforts.
Here we describe a suite of DSBR reporter assays that allow assessment of the four major DSBR pathways. The suite of reporter assay substrates is outlined in Figure 1 and further described in a recent publication7. They are extrachromosomal, allowing their introduction into cells by simple transient transfection, and the incorporation of a nanoluciferase reporter gene8, which must be reconstituted by engagement with specific DSBR mechanisms, engenders sensitivity, robustness, and scalability. The following DSBR reporter substrate variants are included in the protocol (Figure 1):
Resection-independent MMEJ: This linear substrate is composed of a core double-stranded DNA (dsDNA) region with single-stranded DNA (ssDNA) overhangs, which mimic resected DNA ends9. Four nucleotide microhomologies at the termini of the ssDNA regions encode the start codon for the reporter gene. Repair of this substrate through MMEJ restores the reporter gene open reading frame (ORF).
Resection-dependent MMEJ: The N-terminal reporter gene exon is interrupted by a segment containing a stop codon, which is flanked by 8 base-pair (bp) microhomologies. Nucleolytic end resection is required prior to MMEJ-mediated repair to restore the intact reporter gene.
Blunt NHEJ: The reporter gene is split into N- and C-terminal sections, of which the latter is placed upstream of the promoter. The DSB is produced using EcoRV and it requires direct ligation (without end processing) by NHEJ for both reporter gene portions to be re-joined and the reporter ORF to be restored.
Non-blunt NHEJ: The DSB is located within an intron and will have cohesive or non-cohesive ends depending on the choice of restriction enzyme. The repair of this substrate by NHEJ requires ligation to be preceded by end processing.
Long template HR: The N-terminal exon of the reporter gene is interrupted by a DNA segment containing restriction sites, which replace 22 bp of the original reporter gene sequence. To restore this sequence, repair by HR uses the 2.5 kilobase (kb) homology template placed downstream of the C-terminal exon.
Short template HR: The restriction site needed to generate the DSB replaces part of the native reporter gene sequence and introduces an in-frame stop codon. Like the long template version, this HR substrate requires the downstream homology template (360 bp) for accurate repair and restoration of the reporter ORF.
SSA: This substrate contains a premature stop codon located within the N-terminal exon of the reporter gene. The removal of this stop codon and reinstatement of the intact reporter gene sequence requires repair by SSA, which involves bi-directional long-range resection prior to alignment of the homologies.
For generation of the DSB, some of the reporter substrates can be digested with I-SceI (Figure 1). This will generate a linear substrate with non-cohesive ends in the resection-dependent MMEJ, non-blunt NHEJ, long template HR and SSA reporters, which have tandem I-SceI sites in inverted orientations. In the short template HR reporter substrate, digestion of the single I-SceI site will generate cohesive ends. The non-blunt NHEJ, resection-dependent MMEJ, long template HR and SSA plasmids can also be digested with HindIII, which will produce complementary cohesive ends.
We provide protocols for the generation of the reporter assay substrates and describe how the assays can be performed, providing details on how they can be used to quantify DSBR, including titratable responses to small molecules, assessing cellular potency, on-target activity, and pathway selectivity.
1. Preparation and quality control (QC) of reporter substrates
NOTE: The plasmids encoding the reporter substrates can be propagated in standard Escherichia coli strains (e.g., DH5α and derivates) and recovered by plasmid isolation. Plasmid details (size and antibiotic resistance) are described in Table 1 and Figure 1.

Figure 1: Schematics of extrachromosomal NanoLuc-based DSBR reporter assays. Schematic representation of DSBR reporter substrates, including their location within each source plasmid, main sequence features, and final layout after pathway-specific repair. The resection-independent MMEJ substrate core is excised from the source plasmid by digestion with XhoI/HindIII, after which caps must be ligated to both ends to produce the substrate for MMEJ. The blunt NHEJ reporter substrate is generated by excision from the source plasmid with EcoRV. The resection-dependent MMEJ, non-blunt NHEJ, long template HR, and SSA reporter substrates are generated by linearization of the source plasmids using either I-SceI (which produces non-cohesive ends) or HindIII (which produces cohesive ends). The short template HR reporter substrate is generated by linearization of the source plasmid using I-SceI (which produces cohesive ends). Repair of each reporter substrate by the target DSBR pathway reconstitutes an intact nanoluciferase ORF encoding functional NanoLuc. This figure was adapted from Rajendra et al.7. Abbreviations: DSBR = double strand break repair; NanoLuc = Nanoluciferase; MMEJ = microhomology-mediated end joining; NHEJ = non-homologous end joining; HR = homologous recombination; SSA = single strand annealing; ORF = open reading frame. Please click here to view a larger version of this figure.

Figure 2: Gel electrophoretic analyses of DSBR reporter substrate generation. (A-C) Representative images from gel electrophoretic analysis of intermediates and final construct required for the generation of the resection-independent MMEJ reporter substrate. The adjacent images in panels (A) and (C) are from the same gels; irrelevant lanes have been omitted. (D,E) Representative images from gel electrophoretic analysis for source plasmid, EcoRV-digested products, and gel-extracted final construct required for the generation of the blunt NHEJ reporter substrate. (F-J) Representative images from gel electrophoretic analysis of source plasmids and linearised DSBR constructs for the I-SceI-digested reporter substrates: resection-dependent MMEJ, non-blunt NHEJ, long template HR, short template HR, SSA. Abbreviations: DSBR = double strand break repair; MMEJ = microhomology-mediated end joining; NHEJ = non-homologous end joining; HR = homologous recombination; SSA = single strand annealing. Please click here to view a larger version of this figure.
2. Transient transfection of DSBR reporter substrates
NOTE: An overview of the experimental workflow of assays and some potential permutations are outlined in Figure 3. The protocol below describes an experiment using HEK-293 cells, where these are reverse-transfected with the reporter substrate. Numbers below can be scaled up or down according to the number of wells to be used per plate. The following steps are calculated for an assay performed in one 96-well plate; see Discussion for additional considerations.

Figure 3: Experimental workflow for DSBR reporter assays. Cells of interest are transfected with the linearised DSBR substrate (coding for a NanoLuc ORF that needs to be repaired through a specific DNA repair event) and a Firefly plasmid (transfection control). Then, 6-24 h post transfection, the Firefly luminescence and NanoLuc luminescence can be read sequentially following the addition of Nano-Glo Dual-Luciferase reagents. Example permutations to the core steps (shown within light blue boxes) can be used to test how genetic modulation (knockout, knockdown, or overexpression) or pharmacological treatment affects DSBR pathway proficiency in cells. Abbreviations: DSBR = double strand break repair; NanoLuc = Nanoluciferase; WT = wild type; KO = knockout. Please click here to view a larger version of this figure.
3. Detection of luminescence
4. Data analysis
(1)
(2)Repair of each of the reporter assays can be detected and quantified using the same procedure. Correct repair of a substrate by its cognate repair pathway in cells will reconstitute an intact, functional ORF encoding NanoLuc. This luminescence signal can be detected using a plate reader.
The co-transfection with an intact plasmid encoding Firefly luciferase serves as a transfection control. This control serves two purposes. First, it provides a standard to normalize the NanoLuc signal to, as it should be unperturbed by modulation of DSBR by either genetic or pharmacological means. Second, it can provide an indication of off-target cellular perturbations that impact the luciferase signal, such as cell cycle modulation, effects on transcription/translation, or general toxicity.
The ratio of NanoLuc to Firefly serves as a surrogate readout of repair. Luminescence values can be exported and analyzed by normalizing the two luciferase signals from within the same well. In the case of genetic perturbation studies (e.g., comparing wild-type and KO or non-targeting and target siRNA), repair is usually normalized to the parental sample (wild-type cells or cells treated with non-targeting control siRNA). In the case of pharmacological modulation, values from a compound-treated sample are normalized to the value produced by vehicle treatment.
Full validation of the described reporter suite has been recently published7. Data exemplifying the characterization of genetic and pharmacological modulation of DSBR are shown in Figure 4 (adapted from 7). Polθ is the key mediator of MMEJ and loss or inhibition of this enzyme is predicted to specifically ablate cellular MMEJ3,10. Using a cell line in which POLQ, the gene encoding Polθ, has been knocked out11, the resection-independent MMEJ reporter assay demonstrates that MMEJ is indeed almost fully suppressed. Evaluation of the component NanoLuc and Firefly luminescence signals shows that the observed repair defect is driven by a reduction in the NanoLuc signal (encoded by the reporter substrate) while the Firefly signal (control) is unperturbed (Figure 4A-C). In contrast, the assessment of NHEJ proficiency using the blunt end NHEJ reporter demonstrates that POLQ knockout does not inhibit the repair of the reporter substrate (Figure 4D-F). Together, these genetic data support the specific role of Polθ in MMEJ-mediated repair. These observations are fully recapitulated pharmacologically with ART55812,13, a recently reported highly potent and specific inhibitor of the polymerase domain of Polθ (Figure 4G), where titratable inhibition of MMEJ is observed, which derives from a specific decrease in the NanoLuc and not the Firefly signal (Figure 4H). Furthermore, and in agreement with genetic data, there is no effect on NHEJ (Figure 4I,J). Together these data highlight how these reporters can be used to characterize the genetic modulation of DSBR pathways and show cellular potency and target/pathway specificity of small molecules.

Figure 4: Effects of genetic knockout and pharmacological inhibition of Polθ on MMEJ and NHEJ reporter signals. eHAP1 WT and POLQ(-) cells were transfected with a Firefly control plasmid and with (A-C) the resection-independent MMEJ reporter or (D-F) blunt end NHEJ reporter. Percentage of MMEJ or NHEJ repair is the ratio of NanoLuc luminescence over Firefly luminescence, normalized to the DMSO-treated control, 24 h post transfection. Data represent mean ± SEM of three biological replicates, each averaging 8 technical replicates. HEK-293 cells were transfected with a Firefly control plasmid and (G,H) the resection-independent MMEJ reporter or the (I,J) blunt end NHEJ reporter and treated with the Polθ polymerase inhibitor ART558. Percentage of repair is the ratio of NanoLuc luminescence over Firefly luminescence, normalized to the DMSO-treated control, 24 h post transfection. Percentage inhibition of the individual luminescence signals in (G) and (I) was calculated relative to DMSO-treated control and shown respectively in (H) and (J). Data represent mean ± SEM of 2 biological replicates, each averaging 4 technical replicates. This figure was adapted from Rajendra et al.7. Abbreviations: NanoLuc = Nanoluciferase; MMEJ = microhomology-mediated end joining; NHEJ = non-homologous end joining; WT = wild type. Please click here to view a larger version of this figure.

Figure 5: Inhibition of HR reporter signal by the RAD51 inhibitor CAM833. (A) HEK-293 cells were transfected with the long template HR reporter substrate, a Firefly luciferase control plasmid, and treated with the RAD51 inhibitor CAM83314. NanoLuc and Firefly luminescence was read 16 h after transfection. Percentage of HR repair is the ratio of NanoLuc luminescence over Firefly luminescence, normalized to the DMSO-treated control. Dashed lines highlight percentage HR inhibition and CAM833 concentration at the curve EC50. Data represent mean ± SEM of 2 biological replicates, each averaging 4 technical replicates. (B) Percentage inhibition of the individual luminescence signals in (A) was calculated relative to the DMSO-treated control. Dashed lines highlight percentage NanoLuc and Firefly inhibition at 3.33 µM CAM833 (EC50). The decrease in Firefly signal at CAM833 concentrations ≥ 10 µM is indicative of compound toxicity at high doses; however, NanoLuc signal reduction is observed at concentrations where Firefly signal is unaffected, suggesting that CAM833 induces on-target HR inhibition. This figure was adapted from Rajendra et al.7. Abbreviations: NanoLuc = Nanoluciferase; HR = homologous recombination. Please click here to view a larger version of this figure.
| Reporter substrate | Source plasmid (size in kb, resistance) | DSB generation | Expected size of final reporter substrate (kb) | |||
| Resection-independent MMEJ | 4.0, Kan | Resected 3' tails through ligation of caps | 1.6 | |||
| Resection-dependent MMEJ | 6.5, Kan | I-SceI (non-cohesive), HindIII (cohesive) | 6.5 | |||
| Blunt NHEJ | 4.3, Kan | Blunt ends upon excision from plasmid by EcoRV | 1.7 | |||
| Non-blunt NHEJ | 6.7, Kan | I-SceI (non-cohesive), HindIII (cohesive) | 6.5 | |||
| Long template HR | 9.2, Kan | I-SceI (non-cohesive), HindIII (cohesive) | 9.2 | |||
| Short template HR | 9.3, Amp | I-SceI (cohesive) | 9.3 | |||
| SSA | 9.5, Kan | I-SceI (non-cohesive), HindIII (cohesive) | 9.5 | |||
Table 1: Reporter substrate plasmids. Abbreviations: DSB = double strand break; MMEJ = microhomology-mediated end joining; NHEJ = non-homologous end joining; HR = homologous recombination; SSA = single strand annealing; Kan = kanamycin; Amp = ampicillin.
| Sequence (5’-3’) | Supplier | Purification | Function | ||
| 5’[Phos]TCGAGGACTTGGTCCAGGTT GTAGCCGGCTGTCTGTCGCCAGTCC CCAACGAAATCTTCGAGTGTGAAGACCAT | Sigma | PAGE | Left cap, long oligonucleotide | ||
| 5’[Phos]GCCGGCTACAACCTGGACCAAGTCC | Sigma | PAGE | Left cap, short oligonucleotide | ||
| 5’[Phos]AGCTTTATTGCGGTAGTTTATCA CAGTTAAATTGCTAACGCAGTCAGTGG GCCTCGGCGGCCAAGCTAGGCAATCC GGTACTGTTGGTAAAGCCACCATGG | Sigma | PAGE | Right cap, long oligonucleotide | ||
| 5’[Phos]CGAGGCCCACTGACTGCGTTA GCAATTTAACTGTGATAAACTACCGCAATAA | Sigma | PAGE | Right cap, short oligonucleotide | ||
Table 2: Oligonucleotides for caps for generation of resection-independent MMEJ reporter substrate. Abbreviations: ssDNA = single-stranded DNA; dsDNA = double-stranded DNA; MMEJ = microhomology-mediated end joining; PAGE = polyacrylamide gel electrophoresis. Microhomologies are underlined.
| Reporter assay | NanoLuc reporter substrate DNA (µg DNA/1x106 cells) | Firefly control luciferase plasmid (µg DNA/1x106 cells) |
| Resection-independent MMEJ | 0.5 | 0.66 |
| Resection-dependent MMEJ | 1 | 0.66 |
| Blunt NHEJ | 0.5 | 0.66 |
| Non-blunt NHEJ | 0.5 | 0.66 |
| Long template HR | 1 | 0.66 |
| Short template HR | 2 | 0.66 |
| SSA | 1 | 0.66 |
Table 3: DNA quantities for transient transfection of NanoLuc reporter substrates and Firefly control luciferase plasmid (HEK-293, 96-well plate format). Abbreviations: MMEJ = microhomology-mediated end joining; NHEJ = non-homologous end joining; HR = homologous recombination; SSA = single strand annealing.
Here, we have described protocols for the generation and implementation of a suite of extrachromosomal luminescence-based reporters for measuring the cellular proficiency of the four major DSBR pathways (HR, NHEJ, MMEJ, and SSA)7. Reporter substrates can be introduced into cells by transient transfection and used to assess DSBR activity using a sensitive and robust plate-based readout of NanoLuc luminescence, which is reconstituted upon engagement with cognate cellular DSBR pathways.
Several stages of reporter substrate generation, transfection of the substrates into cells, and data interpretation are critical to the successful execution of these assays. Although standard molecular biology techniques are used to generate the reporter substrates, visualizing the process by gel electrophoresis ensures the highest quality and purity of the substrates prior to transfection. As these assays are reliant on transient transfection, common considerations for these methods apply. These include optimizing seeding density, transfection conditions (including reagents and DNA quantities), and assessing suitability in forward and reverse transfection formats. These reporter assays have been successfully performed with a range of electroporation and lipofection protocols, and options should be fully explored prior to performing these assays. Care should also be taken to inspect the component NanoLuc and Firefly signals rather than just the composite repair signal derived by normalizing the NanoLuc signal (reporter substrate) to the Firefly signal (control). Artifacts can arise from the ratio being driven by changes in the Firefly signal. For example, assessing inhibition in dose-response mode using a highly specific compound should suppress the NanoLuc signal in a titratable manner without perturbing the Firefly signal, which should remain stable (Figure 4G,H). However, in cases where Firefly signals are perturbed, useful impacts on repair can still be determined by identifying a dose window where the Firefly signal is unaffected (Figure 5).
Compared with the most frequently used DSBR reporter assays, these extrachromosomal luminescence-based reporter assays have some distinct advantages. As DSBR pathways are highly conserved, even if cellular machinery varies between cell models, the assays can still report on DSBR proficiency and pathway choice. This opens up the assessment of DSBR to any model of interest to the user, as long as optimal transient transfection conditions are established in advance.
The use of Nanoluciferase as the reporter gene also offers advantages over fluorescent options, which have been used traditionally in DSBR reporter assays. NanoLuc is fast-maturing and luminescence is detected with high sensitivity using a plate reader8. Coupled to the speed of substrate repair (as the reporter substrates are transfected into cells with ready-to-repair DSB ends), this format of DSBR reporter assay is ideal for the rapid turnaround and quantitative robustness required for screening small molecules as part of an industrial drug discovery cascade. Indeed, we have recently described the implementation of the resection-independent MMEJ reporter assay in the discovery cascade used for the identification of small molecule inhibitors of the Polθ polymerase domain13.
There is also flexibility in the implementation of the reporter assays to address specific questions about genetic and pharmacological perturbations of DSBR (Figure 3). For example, prior to transfection of the reporter substrates, cells can be transfected with siRNA against a gene of interest for 48-72 h. Alternatively, the effects of gene overexpression on DSBR pathways can be tested by performing plasmid transfection 24-48 h prior to the transfection of reporter substrates. For pharmacological studies, the present protocol already describes how the use of small molecules can be incorporated into the standard workflow, but alternative formats may include alterations in compound treatment regimes, such as pre-incubations or washouts.
The scalability of transient transfection could also support large-scale screening approaches in which batch transfection of reporter substrates is performed prior to screening. Furthermore, the duration of the assay from transfection to readout can also be varied. Although standard durations may be 16-24 h, some assays may be read out in as little as 6 h7. Concerns over toxicity from small molecules or siRNA that can compromise cell viability should also be considered in determining the assay duration.
In summary, the assays outlined in this study and fully described in a recent publication7 provide a rapid and robust assessment of cellular DSBR proficiency. They are highly sensitive and titratable, making them amenable to both genetic and pharmacological studies. Crucially, as the reporter substrates can be introduced into cells by transient transfection, they have the potential to be utilized in any transfectable cell model of interest, rather than being restricted to specific cell lines by stable integration as is the case with chromosomal DSBR reporters. However, a distinct limitation of these reporter extrachromosomal assays is that the lack of integration into the genome may not fully recapitulate the physiological, chromatinized context of DNA repair and its associated regulatory cues and orchestration15. To this end, extrachromosomal reporter assays are complementary to existing methods of DSBR assessment and expand the toolkit of resources suitable for both basic research and drug discovery.
D.G., E.R., B.M., A.G., S.J.B., G.C.M.S, and H.M.R.R. are all employees and shareholders of Artios Pharma Ltd. G.C.M.S. is a shareholder of AstraZeneca PLC. S.J.B. is a Founder Scientist and shareholder of Artios Pharma Ltd. A patent has been filed on some of the reporters outlined in this study (WO 2021/001647). Promega is the source of the NanoLuc® technology and the modified NanoLuc® polynucleotides. Artios Pharma was authorized by Promega to generate the modified NanoLuc® polynucleotides.
All work was funded by Artios Pharma Ltd. Figure 1 and Figure 3 were created with Biorender.com.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| 10x TBE buffer | Thermo Fisher | AM9863 | |
| 20% TBE-acrylamide gel | Invitrogen | EC6315BOX | |
| 50x TAE buffer | Fisher Scientific | BP13321 | |
| 6x Gel Loading Dye, Purple | NEB | B7024S | |
| 96-well white plate (with transparent bottom and lid) | Porvair | 204012 | |
| Agarose | Cleaver Scientific | CSL-AG500 | |
| AMPure XP beads | Beckman Coulter | A63881 | For bead-based purification of DNA |
| Antarctic phosphatase and 10X buffer | NEB | M0289L | |
| CLARIOstar | BMG Labtech | 430-101 | Plate reader |
| Countess II Automated Cell Counter | Thermo Fisher | AMQAX1000 | Cell counter |
| Custom oligonucleotides | Sigma-Aldrich | Custom order | For resection-independent MMEJ substrate. See Table 2. |
| D300e | Tecan | 30100152 | DMSO-based compound dispenser |
| D300e D4+ cassette | Tecan | 30097371 | High volume cassette for D300e compound dispenser |
| D300e T8+ cassette | Tecan | 30097370 | Low volume cassette for D300e compound dispenser |
| Dimethyl sulfoxide, cell culture grade | Sigma-Aldrich | D2650-100ML | Vehicle for compounds, used in Figure 4 and Figure 5 |
| DSBR reporter source plasmids | Artios | Available to the academic community upon request | |
| EcoRV-HF and 10x CutSmart buffer | NEB | R3195M | |
| Ethanol absolute | VWR | 20821.365 | |
| Foetal Bovine Serum | PAN-Biotech | P30-3031 | |
| GeneRuler Ultra Low Range DNA Ladder | Thermo Fisher | SM1211 | Low molecular weight DNA ladder |
| HEK-293 cells | ATCC | CRL-1573 | Example cell line used in protocol |
| HindIII-HF and 10x CutSmart buffer | NEB | R3104M | |
| HyClone Molecular Biology grade water | Fisher Scientific | 10275262 | |
| I-SceI and 10x Tango Buffer | Invitrogen | ER1771 | |
| Isopropanol | VWR | 20842.33 | |
| JetPRIME reagent and buffer | PolyPlus | 114-15 | Lipid-based transfection reagent |
| MegaStar 1.6 | VWR | 521-1749 | Centrifuge for 15 or 50 mL tubes |
| MEM Eagle | PAN-Biotech | P04-08056 | Culture medium for HEK-293 cells |
| Microplate shaker | Fisherbrand | 15504070 | Microplate orbital shaker |
| MicroStar 17R | VWR | 521-1647 | Centrifuge for 1.5 or 2 mL tubes |
| MultiDrop | Thermo Fisher | 5840300 | Cell or water-based reagent dispenser |
| MultiDrop Standard Cassette | Thermo Fisher | 24072670 | Cassette for MultiDrop reagent dispenser |
| NanoDLR Stop & Glo Buffer and Substrate | Promega | N1630 or N1650 | Reporter luciferase (NanoLuc) reagent to quench Firefly luminescence and detect NanoLuc luminescence. Part of the Nano-Glo Dual-Luciferase Reporter Assay System kit |
| ONE-Glo EX Luciferase Assay Buffer and Substrate | Promega | N1630 or N1650 | Control luciferase (Firefly) assay reagent to detect Firefly. Part of the Nano-Glo Dual-Luciferase Reporter Assay System kit |
| PBS (without calcium or magnesium) | PAN-Biotech | P04-36500 | |
| pGL4 Firefly plasmid (or similar) | Promega | E1310 (or equivalent) | Firefly control plasmid |
| pNL1.1 NanoLuc plasmid (or similar) | Promega | N1091 (or equivalent) | NanoLuc control plasmid, for adjustment of equipment settings/optimisation experiments |
| QIAquick Gel Extraction Kit | Qiagen | 28706 | |
| Quick-Load Purple 1 kb DNA Ladder | NEB | N0552S | High molecular weight DNA ladder |
| Sodium Acetate (3 M), pH 5.5 | Thermo Fisher | AM9740 | For pH adjustment during gel extraction with QIAquick Gel Extraction Kit |
| SYBR Gold (10,000x) | Invitrogen | S11494 | For visualisation of ssDNA and dsDNA |
| SYBR Safe (10,000x) | Invitrogen | S33102 | For visualisation of dsDNA only |
| T4 DNA Ligase and 10x Ligase buffer | NEB | M0202L | |
| Trypan Blue stain 0.4% | Invitrogen | T10282 | For measurement of viability during cell counting |
| Trypsin-EDTA solution; 0.25% Trypsin and 0.53 mM EDTA | Sigma-Aldrich | T4049-100ML | |
| XhoI and 10x CutSmart buffer | NEB | R0146M |