Method Article

CIRCLE-Seq for Interrogation of Off-Target Gene Editing

2.1K views

DOI:

10.3791/67069

November 1st, 2024

In This Article

Summary

A significant barrier to technologies like CRISPR is the off-target events that can disrupt vital genes. 'Circularization for In Vitro Reporting of Cleavage Effects by Sequencing' (CIRCLE-seq) is a technique designed to identify unintended cleavage sites. This method maps the genome-wide activity of CRISPR-Cas9 with high sensitivity and without bias.

Abstract

Circularization for In Vitro Reporting of Cleavage Effects by Sequencing (CIRCLE-seq) is a novel technique developed for the impartial identification of unintended cleavage sites of CRISPR-Cas9 through targeted sequencing of CRISPR-Cas9 cleaved DNA. The protocol involves circularizing genomic DNA (gDNA), which is subsequently treated with the Cas9 protein and a guide RNA (gRNA) of interest. Following treatment, the cleaved DNA is purified and prepared as a library for Illumina sequencing. The sequencing process generates paired-end reads, offering comprehensive data on each cleavage site. CIRCLE-seq provides several advantages over other in vitro methods, including minimal sequencing depth requirements, low background, and high enrichment for Cas9-cleaved gDNA. These advantages enhance sensitivity in identifying both intended and unintended cleavage events. This study provides a comprehensive, step-by-step procedure for examining the off-target activity of CRISPR-Cas9 using CIRCLE-seq. As an example, this protocol is validated by mapping genome-wide unintended cleavage sites of CRISPR-Cas9 during the modification of the AAVS1 locus. The entire CIRCLE-seq process can be completed in two weeks, allowing sufficient time for cell growth, DNA purification, library preparation, and Illumina sequencing. The input of sequencing data into the CIRCLE-seq pipeline facilitates streamlined interpretation and analysis of cleavage sites.

Introduction

Genome engineering has seen significant advancements over the past twenty years, with a major milestone being the discovery of clustered regularly interspaced short palindromic repeats (CRISPR)-Cas9 in 20121. Leveraging the programmable nature of bacterial DNA endonucleases, CRISPR-Cas9 technology enables precise targeting and modification of almost any DNA sequence. Since its inception, the system has been optimized to rely only on the Cas9 endonuclease and a guide RNA (gRNA) to edit specific genomic regions. CRISPR-Cas9's potential as a curative therapy has been demonstrated in clinical trials for various conditions such as Leber's congenital amaurosis, transthyretin amyloidosis, and sickle cell anemia, among others2,3,4.

CRISPR-Cas9 induces double-stranded breaks (DSBs), which are typically resolved by one of two mechanisms: the error-prone non-homologous end joining (NHEJ) or the more precise homology-directed repair (HDR), provided a template DNA is available. The tendency of CRISPR-Cas9 to cause NHEJ-associated insertions and deletions (indels), along with cleavage at unintended genomic sites, limits its application in clinical settings5,6,7,8,9,10. Additionally, unintended genomic modifications can create cryptic splice sites, nonsense or missense mutations, induce chromothripsis, or confer oncogenic potential to cells-outcomes that have been observed in several genome editing trials11,12,13,14,15. In conclusion, accurately identifying the off-target activity of CRISPR-Cas9 is crucial for its clinical applications, particularly in systemic gene therapies that may alter billions of cells.

Various methods can be employed to identify CRISPR-Cas9 off-target cleavage sites, including Genome-wide Unbiased Identification of Double-stranded breaks (GUIDE)-seq16, which uses double-stranded oligodeoxynucleotides to tag DSBs in living cells. Nevertheless, a criticism of this method is that false positives can arise from random DSBs or from PCR artifacts, which must be discarded by excluding captured sites that show poor similarity to the on-target sites. The method based on the use of Integrase-Defective Lentiviral Vector (IDLV) is less sensitive and likely to miss many off-target sites17. Other in situ methods like DSBCapture, BLESS, and BLISS18,19,20 involve fixed cells and label DSBs directly, however they are constrained by their dependency on immediate DSB capture and the absence of exogenous DNA. Digenome-seq21, an in vitro method, and Selective enrichment and Identification of Tagged genomic DNA Ends by sequencing (SITE-seq)22 both provide sequencing solutions but have their limitations in background noise and single-end analysis, respectively. Discovery of in situ Cas off-targets and verification by sequencing (Discover-Seq)23 offers in vivo and in situ identification of Cas9 activity via MRE11 binding, but only detects DSBs that exist at the time of sample preparation24. Lastly, Inference of CRISPR Edits (ICE) uses a bioinformatics approach to robustly analyze CRISPR edits using Sanger data25.

This article describes a detailed procedure for Circularization for In Vitro Reporting of Cleavage Effects by Sequencing (CIRCLE-seq): an in vitro technique that sensitively and impartially maps the genome-wide off-target activity of Cas9 nuclease in a complex with the gRNA of interest26. This approach begins with culturing the cells of interest and isolating DNA, followed by random shearing through focused ultrasonication, then exonuclease and ligase treatment. This process ultimately produces circular double-stranded DNA molecules, which are then purified through plasmid-safe DNase treatment. This circular DNA is then exposed to the Cas9-gRNA complex, which cleaves at both intended and unintended cleavage sites, leaving behind exposed DNA ends that act as substrates for Illumina adapter ligation. This process produces a diverse library of genomic DNA (gDNA) containing both ends of each nuclease-induced DSB, ensuring that each read has all the information necessary for each cleavage site. This allows for the use of Illumina sequencing with lower sequencing coverage requirements, setting CIRCLE-seq apart from other similar methods mentioned above. It is important to note that while CIRCLE-seq does have higher off-target sensitivity than other protocols as an in vitro method, this comes at the cost of higher false-positives due to the absence of the epigenetic landscape that is present in other methods such as GUIDE-seq16. Additionally, DSB DNA repair and its associated machinery are not present in CIRCLE-seq, abrogating indels or proper repair that would otherwise be observed.

In addition to describing the step-by-step protocol to perform CIRCLE-seq, the protocol is validated by identifying genome-wide unintended cleavage sites of CRISPR-Cas9 that occur during the modification of the AAVS1 locus, as an example. This easy-to-follow protocol provides detailed instructions, from the culture of induced pluripotent stem cells (iPSCs) and gDNA isolation to gDNA circularization, Cas9-gRNA cleavage, library preparation, sequencing, and pipeline analysis. Given the low sequencing coverage requirements, CIRCLE-seq is available to any lab with access to next-generation sequencing.

Protocol

The details of the reagents, consumables, and equipment used for this study are listed in the Table of Materials.

1. Cell culture (5 days)

  1. Include a negative control throughout this protocol. Prepare enough cells for an additional 25 μg of gDNA (~2.0e7 cells per sample).
  2. Culture iPSCs according to the established protocol27. Collect the cells and resuspend them in 10 mL of PBS. Pipette a 6 μL sample of cells and resuspend in a 1:1 ratio with trypan blue. Use automated cell counter to count the sample.
  3. Aliquot 2 x 107 cells per tube, then spin down at 300 x g for 3 min at 25 °C (Room temperature (RT)). This is sufficient for multiple replicates. Pipette off and discard the supernatant.

2. Genomic DNA isolation (1 day)

  1. Use the commercially available DNA purification kit to isolate the gDNA, following the manufacturer's instructions:
    1. Add 200 µL of PBS to a 15 mL conical tube containing the cell pellet and resuspend. Then, pipette 3 mL of cell lysis buffer and 15 µL of proteinase K into the tube. Invert the tube 25 times to mix thoroughly. Place the tube in a water bath shaker set to 55 °C and 150 rpm for 3 h, or overnight for optimal DNA yield.
    2. Pipette in 15 μL of RNase A. Invert 25 times. Place in a water bath at 37 °C for 1 h.
    3. Chill the sample on ice for 5 min. Then, add 1 mL of protein precipitation solution, vortex at high speed for 20 s, and centrifuge at 2000 x g for 10 min at RT. Proteins should form a visible, compact pellet at the bottom of the tube. If the pellet is not visible, incubate the sample on ice for an additional 5 min and centrifuge again.
    4. Add 3 mL of 100% isopropanol to a new 15 mL conical tube. Carefully pipette the supernatant from step 2.1.3 into the tube. Invert the tube 50 times to mix, then centrifuge at 2000 x g and room temperature for 3 min. Without disturbing the DNA pellet, carefully aspirate the supernatant using a Pasteur pipette connected to a vacuum trap and invert the tube on a clean, lint-free wipe.
    5. Pipette 3 mL of 70% (v/v) ethanol onto the DNA pellet and invert 10 times to wash. Centrifuge at 2,000 x g for 3 min at RT. Then, carefully pour off the supernatant.
    6. Keep the tube open and allow the resulting DNA pellet to dry for 30 min, ensuring that all ethanol has fully evaporated. Pipette in 50 μL of DNA hydration solution and mix thoroughly by gentle pipetting.
    7. Dissolve the DNA by placing the sample in a water bath shaker at 65 °C for 1 h, then leave the sample out at RT overnight. Centrifuge the sample at RT and 2,000 x g for 1 min and use the dsDNA BR Assay Kit with associated tubes to quantify the isolated DNA with the fluorometer.

3. Preparation of gRNA (7 days)

  1. Order the synthetic gRNA of interest from a commercial source (see Table of Materials). This protocol is also compatible with crRNA/tracrRNA.

4. gRNA in vitro cleavage test

NOTE: Here, a target in the AAVS1 gene is used. To target other genes of interest, design primers (Table 1) to amplify the target region and replace the primers in the following steps with custom primers.

  1. Prepare the PCR reaction: Mix 25 μL of Phusion Hot Start Flex 2x Master Mix (Final Concentration 1x), 0.5 μL of AAVS1 F Primer (Final concentration 0.1 μM), 0.5 μL of AAVS1 R Primer (Final concentration 0.1 μM), 5 μL of gDNA (100 ng, 20 ng/μL, from step 2.1.6), and 19 μL of Nuclease-free H2O (Total volume: 50 μL).
  2. Use the following thermocycler parameters: Denaturation: 98 °C for 2 min (1 cycle), Denaturation: 98 °C for 10 s (10 cycles), Annealing: 72-62 °C (-1 °C/cycle) for 15 s (10 cycles), Extension: 72 °C for 30 s (10 cycles), Denaturation, 98 °C for 10 s (30 cycles). Annealing: 65 °C for 15 s (30 cycles), Extension: 72 °C for 30 s (30 cycles), Final Extension: 72 °C for 5 min (1 cycle), Hold: 4 °C indefinitely.
  3. Use AMPure XP beads to purify the product of the PCR reaction. First, pipette in 1.8x volumes, or 90 μL, of XP beads to the PCR product. Pipette ten times to thoroughly mix. Leave the mixture at RT for 5 min to incubate.
  4. Using a magnetic rack, separate the beads from the solution by placing the PCR reaction plate on the magnet for 3 min. Pipette off the cleared solution and discard. Add 200 µL of 80% ethanol (v/v) to the beads, incubate for 30 s, and then remove the ethanol. Repeat this washing step twice to ensure complete removal of the ethanol.
  5. Let the samples dry naturally for 3 min by placing the plate on the magnet. Remove the plate from the magnet and add 40 µL of TE buffer, pH 8.0. Mix by pipetting up and down ten times. Allow the sample to sit at RT for 2 min.
  6. Place the PCR reaction plate on the magnet for an additional minute. After 1 min, transfer the supernatant to a new plate. Measure the purified PCR yield using a spectrophotometer, and analyze it on a TapeStation using an optical tube strip with an optical tube strip cap, along with High Sensitivity D1000 ScreenTape and High Sensitivity D1000 reagents (ladder and buffer), following the manufacturer's instructions. Store the prepared sample at -20 °C for up to several months.
  7. Dilute Cas9 nuclease protein to 1 μM as follows: Mix 2 μL of 10x Cas9 buffer (Final concentration 1x), 1 μL of Cas9 Nuclease, S. pyogenes (Final Concentration 1 μM), and 17 μL of Nuclease-free H2O in a total volume of 20 μL.
  8. Perform an RNase-free procedure to prevent gRNA degradation. Dilute gRNA (from step 3.1) to 3 μM in H2O to a total volume of 10 μL.
    NOTE: Use the following formula to estimate the molecular weight of gRNA: Molecular weight of ssRNA (g/mol) = (length of ssRNA (nt) x 321.47 g/mol) + 18.02 g/mol. For reference, a 104 nt long gRNA at 3 µM is approximately 100 ng/µL.

5. DNA shearing (3 h)

  1. Prepare the ME220 by first homing the control arm. Then, fill the reservoir with purified deionized H2O. On the control station laptop, access Water Works and click on Fill. Adjust the temperature to 4.5 °C.
  2. Transfer 25 μg of gDNA into a microtube (microtube-130 AFA Fiber Screw-Cap). Then, fill the tube to a total volume of 130 μL with 1x TE. Use the following conditions to shear the DNA to an average length of approx. 300 bp: set Duration to 10 s; Peak Power to 70; Duty Factor % to 20; Cycles/Burst to 50; all of which will automatically set the Avg Power to 14.0.

6. Purifying sheared genomic DNA (1 h)

  1. Divide the sheared genomic DNA into two portions of 65 µL each. Purify using 1.8 times the volume of XP beads (117 µL), following the procedure outlined in steps 4.3-4.6. Transfer the supernatant to a new PCR plate and measure the quantity using a spectrophotometer.
  2. Run 1 μL of the eluted sheared gDNA on a TapeStation, according to the manufacturer's instructions, to ensure that the gDNA is sheared to a broad distribution of approx. 300 bp. If needed, store the sheared gDNA at -20 °C for up to several months.

7. Preparation of CIRCLE-seq library (3 days)

  1. Hairpin adapter annealing
    1. Resuspend oSQT1288 (Table 1), the hairpin adapter, to a final concentration of 100 μM in 1x TE.
    2. Perform the adapter annealing as follows: mix 40 μL of oSQT1288 (Final Concentration 40 μM), 10 μL of 10x STE (Final Concentration 1x), and 50 μL of Nuclease-Free H2O for a total volume of 100 μL.
    3. Use the following the annealing parameters: 95 °C for 5 min, -1 °C per min for 70 cycles, hold at 4 °C indefinitely.
  2. Perform End repair . Employ the PCR-Free HTP Library Preparation Kit and prepare the End-Repair Master Mix.
    1. Mix 8 μL of Nuclease-Free H2O, 7 μL of 10x end-repair buffer (Final Concentration 1x), and 5 μL of end-repair enzyme mix (final volume 20 μL of Total End-Repair Master Mix).
    2. Pipette 20 μL of the end-repair master mix into the sheared gDNA sample from steps 4.3-4.6. Mix 20 μL of End-Repair Master Mix with 50 μL of sheared gDNA for a final volume of 70 μL.
    3. Place the mix in a thermocycler at 20 °C for 30 min, then hold at 4 °C indefinitely.
    4. Add 1.7x volumes, or 120 μL, of XP beads and follow the purification steps from steps 4.3-4.6. Elute with 42 μL of TE, pH 8.0. Make sure the beads remain in solution for the next step.
  3. Perform A-tailing. Using the HTP Library Preparation (PCR-free) Kit, prepare the A-tailing Master Mix.
    1. Mix 5 μL of 10x A-tailing buffer (Final Concentration 1x) and 3 μL of A-tailing enzyme (total final volume of 8 μL of A-tailing Master Mix).
    2. Pipette 8 μL of the A-tailing Master Mix into each DNA specimen containing beads from step 7.2.4, mixing 8 μL of A-tailing Master Mix to 42 μL of End-Repaired DNA containing beads (total final volume of 50 μL). Place in a thermocycler at 30 °C for 30 min. Hold at 4 °C indefinitely.
    3. Pipette 1.8 volumes, or 90 μL, of PEG/NaCl SPRI solution (a component of the HTP Library Preparation Kit (PCR-free; 96 reactions)) to the A-tailed DNA. Purify the A-tailed DNA according to steps 4.3-4.6. Elute the A-tailed DNA in 30 μL of TE, pH 8.0. Keep the beads in solution for the next step.
  4. Perform Adapter ligation. Using the HTP Library Preparation (PCR-free) Kit, prepare the Adapter Ligation Master Mix.
    1. Mix 10 μL of 5x ligation buffer (Final Concentration 1x), 5 μL of DNA Ligase, and 5 μL of annealed hairpin adapter (40 μM) from step 7.1.3. Ensure the Final Concentration 4 μM for a total Adapter Ligation Master Mix of 20 μL.
    2. Pipette 20 μL of Adapter Ligation Master Mix into each eluted DNA specimen containing beads from step 7.3.3 (total final volume of 50 μL per sample).
    3. Place in a thermocycler at 20 °C for 1 h. Hold at 4 °C indefinitely.
    4. Transfer 1x volumes, or 50 μL, of PEG/NaCl SPRI solution to the adapter-ligated DNA and purify according to steps 4.3-4.6. Elute with 30 μL of TE, pH 8.0, and decant the supernatants into a new semi-skirted PCR plate. Combine and quantify the DNA using the dsDNA BR assay. If needed, store purified adapter-ligated DNA for up to 1 month at -20 °C.
  5. Prepare the Lambda Exonuclease/Exonuclease I (E. coli) Master Mix (functions in eliminating single- or double-stranded DNA without adapters ligated to both ends).
    1. Take 1 μg of Adapter Ligated DNA from step 7.4.4, diluting it to 40 μL. Mix 5 μL of 10x Exonuclease I reaction buffer (Final Concentration 1x), 4 μL of Lambda Exonuclease (Final Concentration 0.4 U/μL), and 1 μL of Exonuclease I (E. coli) (Final Concentration 0.4 U/μL) for a total volume of the Lambda Exonuclease/Exonuclease I Master Mix of 10 μL.
    2. Pipette 10 μL of the Lambda Exonuclease/Exonuclease I Master Mix to 40 μL (1 μg) of adapter-ligated DNA (total volume of 50 μL). Place in a thermocycler at 37 °C for 1 h, then 75 °C for 10 min. Hold at 4 °C indefinitely.
    3. Pipette 1.8x volumes, or 90 μL, of XP beads to the Lambda Exonuclease/Exonuclease I-treated DNA. Purify according to instructions given in steps 4.3-4.6. Elute in 40 μL of TE, pH 8.0. Make sure the beads remain in solution for the next enzymatic step.
  6. Treat with USER Enzyme and T4 Polynucleotide Kinase (PNK). Prepare the USER/T4 PNK Master Mix (required to release the 4-bp overhangs and to prepare the ligation-ready DNA ends necessary for the subsequent ligation reaction).
    1. Mix 5 μL of 10x T4 DNA Ligase Buffer (Final Concentration 1x), 3 μL of USER Enzyme (Final Concentration 0.05 U/μL), and 2 μL of T4 PNK (Final Concentration 0.4 U/μL), for a total volume of the USER/PNK master mix of 10 μL.
    2. Pipette 10 μL of the USER Enzyme/T4 PNK Master Mix to 40 μL of lambda and exonuclease I-treated DNA specimen containing beads from step 7.5.3 for a total volume of 50 μL. Place in a thermocycler at 37 °C for 1 h. Hold at 4 °C indefinitely.
    3. Pipette 1.8x volumes, or 90 μL, of PEG/NaCl SPRI solution to the DNA treated with USER/T4 PNK and purify according to steps 4.3-4.6. Elute in 35 μL of TE, pH 8.0. Decant the supernatant into a new semi-skirted PCR plate. Combine and quantify the DNA using the dsDNA HS assay.
  7. Perform Intramolecular circularization. Prepare the Circularization Master Mix.
    1. Mix 8 μL of Nuclease-free H2O, 10 μL of 10x T4 DNA ligase buffer (Final Concentration 1x), and 2 μL of T4 DNA ligase (Final Concentration 8 U/μL), for a total volume of the Circularization Master Mix of 20 μL.
    2. Pipette 20 μL of the Circularization Master Mix to 500 ng of DNA treated with USER/PNK from step 7.6.3. Dilute 500 ng of DNA treated with USER/PNK in 80 μL, then add 20 μL of the Circularization Master Mix (total volume of 100 μL). Incubate in a thermocycler at 16 °C for 16 h (overnight).
    3. Add 1x volumes, or 100 μL, of XP beads to the circularized DNA and purify according to steps 4.3-4.6. Elute in 38 μL of TE, pH 8.0. Decant the supernatant into a new semi-skirted PCR plate.
  8. Treat with Plasmid-Safe ATP-Dependent DNase. Prepare the Plasmid-Safe ATP-Dependent DNase Master Mix (Required for the degradation of residual linear DNA).
    1. Mix 5 μL of 10x Plasmid-safe Reaction Buffer (Final Concentration 1x), 2 μL of ATP (Final Concentration 1 mM), and 5 μL of Plasmid-Safe ATP-Dependent DNase (Final Concentration 1 U/μL), for a total volume of the Plasmid-Safe Master Mix of 12 μL.
    2. Pipette 12 μL of the ATP-dependent DNase Master Mix to 38 μL of circularized DNA from step 7.7.3 (total volume of 50 μL). Incubate in a thermocycler at 37 °C for 1 h, then 70 °C for 30 min. Hold at 4 °C indefinitely.
    3. Pipette 1x volumes, or 50 μL, of XP beads into the DNA treated with Plasmid-Safe ATP-Dependent DNase and purify according to steps 4.3-4.6. Elute in 15 μL of TE, pH 8.0. Decant the supernatant into a new semi-skirted PCR plate.
    4. Combine the DNA and quantify using the dsDNA HS assay. If needed, store the circularized DNA at -20 °C for up to several months.

8. Cleaving enzymatically purified, circularized gDNA in vitro (2 h)

  1. Perform in vitro cleavage with the Cas9:gRNA complex. Prepare the in vitro Cleavage Master Mix. Mix 5 μL of 10x Cas9 Buffer (Final Concentration 1x), 4.5 μL of S. Pyogenes Cas9 (Final Concentration 90 nM), and 1.5 μL of gRNA (Final Concentration 90 nM) for a total Cleavage Master Mix volume of 11 μL.
  2. Keep the cleavage master mix at RT for 10 min to form Cas9:gRNA RNP complexes.
  3. Dilute 125 ng of Plasmid-Safe DNase-treated DNA from step 7.8.3 to a final volume of 39 μL. Then, add 11 μL of the Cleavage Master Mix to 39 μL Plasmid-Safe DNase-treated DNA for a total volume of 50 μL.
    NOTE: Include a negative control specimen in this step, which comprises circularized DNA mixed with Cas9 buffer, without the Cas9:gRNA complex.
  4. Incubate in a thermocycler for 1 h at 37 °C. Maintain at 4 °C indefinitely. Add 50 µL (1x volume) of XP beads to the in vitro-cleaved DNA and purify the DNA following steps 4.3-4.6. Elute in 42 µL of TE buffer, pH 8.0. Ensure the beads stay in solution for the next step.

9. Preparation of the next-generation sequencing library (4 - 6 h)

  1. Perform A-tailing. Prepare the A-tailing Master Mix.
    1. Mix 5 μL of 10x A-tailing Buffer (Final Concentration 1x), and 3 μL of A-tailing Enzyme (total volume of the A-tailing master mix is 8 μL).
    2. Pipette 8 μL of the A-tailing Master Mix to 42 μL of eluted DNA sample containing beads from step 8.4 (total volume of 50 μL). Place in a thermocycler for 30 min at 30 °C. Hold at 4 °C indefinitely.
    3. Pipette 1.8x volumes of PEG/NaCl SPRI solution, or 90 μL, to the A-tailed DNA and purify the DNA according to steps 4.3-4.6. Elute in 25 μL of TE, pH 8.0. Make sure to keep the beads in solution for the following step.
  2. Perform Adapter ligation. Prepare the Adapter Ligation Master Mix.
    ​NOTE: Single-use aliquots of NEB adapters must be prepared in order to prevent the formation of adapter dimers caused by freeze-thaw-induced hydrolysis of the 3' T'.
    1. Mix 10 μL of 5x Ligation Buffer (Final Concentration 1x), 5 μL of DNA Ligase, and 10 μL of Adapter for sequencing (Final concentration is 3 μM), for a total of 25 μL.
    2. Pipette 25μL of the Adapter Ligation Master Mix into 25 μL of A-tailed DNA sample containing beads from step 9.1.3. Place in a thermocycler for 1 h at 20 °C. Hold at 4 °C indefinitely.
    3. Pipette 1x volumes, or 50 μL, of PEG/NaCl SPRI solution to the adapter-ligated DNA and purify the DNA according to steps 4.3-4.6. Elute in 47 μL of TE, pH 8.0. Make sure the beads remain in solution for the next enzymatic step.
  3. Perform treatment with USER Enzyme (generates a single nucleotide gap at uracil residues).
    1. Add 3 μL of USER enzyme (included in Dual Index Primers Kit) to the adapter-ligated DNA specimen containing beads from step 9.2.3. Incubate at 37 °C for 15 min.
    2. Add 35 µL (0.7x volume) of PEG/NaCl SPRI solution to the USER enzyme-treated DNA and purify according to steps 4.3-4.6. Elute in 20 µL of TE buffer, pH 8.0. Transfer the supernatant to a new semi-skirted PCR plate and measure the DNA concentration using the dsDNA HS assay. The expected concentration should be approx. 2-5 ng/µL.
  4. (Optional) Before proceeding to the next step, DNA size selection can be carried out using PippinHT. Use the 1.5% PippinHT cassette with a size range of 250-850 bp. The resulting samples can be directly utilized in the PCR in the next step.
  5. Perform PCR for barcode addition
    NOTE: Ensure that the chosen primer sequence combinations for each sample are unique. If possible, each sample should have unique i5 and i7 barcodes.
    1. Prepare the PCR Master Mix to add paired-index barcodes. Mix 5 μL of Nuclease-free H2O, 25 μL of 2x HotStart Ready Mix (Final Concentration 1x), 5 μL of i5 Primer (Final Concentration 1 μM), and 5 μL of i7 Primer (Final Concentration 1 μM) (total master mix volume of 40 μL).
    2. Pipette 40 μL of the PCR Master Mix to 10 μL of purified DNA treated with USER enzyme (approx. 20 ng) from step 9.3.2 (total volume of 50 μL).
    3. Choose the following PCR thermocycling conditions: Denaturation: 98 °C for 45 s for 1 cycle, Denaturation: 98 °C for 15 s for 20 cycles, Annealing: 65 °C for 30 s for 20 cycles, Extension: 72 °C for 30 s for 20 cycles, Final Extension: 72 °C for 1 min for 1 cycle, Hold: 4 °C indefinitely.
    4. Add 0.7x volumes, or 35 μL, of XP beads to the PCR product and purify according to steps 4.3-4.6. Elute in 30 μL of TE, pH 8.0. Decant the supernatant into a new semi-skirted PCR plate. If needed, store the circularized DNA at -20°C for up to several months.
      NOTE: Run a sample of the PCR on Tapestation to control for the quality of the library and to assess the formation of adapter dimers. If adapter dimers are detected, repeat step 9.5.4.

10. Quantification of CIRCLE-seq libraries by droplet digital PCR (dd_PCR) (6 h)

NOTE: Quantification may also be performed using qPCR, Tapestation, or a similar method.

  1. Start with 5 μL of DNA from the library (PCR step 9.5.4) mixed well with 45 μL of nuclease-free TE, then make 1:10 serial dilutions of each sample in 50 μL volumes, ranging from 10-1 to 10-8 dilution.
    1. Set up the dd_PCR Master Mix stock solution. Mix 11 μL of 2x dd_PCR mix for probes (Final Concentration 1x), 0.055 μL of Probe oSQT1310 (Final Concentration 250 nM), 0.055 μL of Probe oSQT1311 (Final Concentration 250 nM), 0.099 μL of Primer oSQT1274 (Final Concentration 450 nM), 0.099 μL of Primer oSQT1275 (Final Concentration 450 nM), and 6.292 μL of Nuclease-free H2O, for a total dd_PCR Master Mix volume of 17.6 μL. Prepare a master mix for all samples to ensure the volumes are sufficient for accurate pipetting.
    2. Assay the three lowest dilutions (10-6,10-7 and 10-8) in duplicate (in a 96-well plate). A non-template control (NTC) must be used.
    3. Pipette 17.6 μL of dd_PCR Master Mix to each specimen as follows: Mix 17.6 μL with 4.4 μL of the sample (adding nuclease-free H2O to the well with NTC), for a total volume of 22 μL. Seal the plate, then centrifuge at 2000 x g for 1 min at RT.
  2. Perform Droplet generation, thermocycling, and analysis. Using a Droplet Reader PCR system, transfer a DG8 cartridge (8-well) into the cartridge holder. In the oil row of the cartridge, dispense 70 μL of droplet generation oil for probes.
    ​NOTE: Take 20 μL of the sample from step 10.1.2. and add it to the sample row of the 8-well cartridge, covering the cartridge with the DG8 rubber gasket, placing it into the droplet generator, and then closing it to begin the process (automatic). When complete, remove the cartridge and move 40 μL from the droplet row of the 8-well cartridge into a semi-skirted 96-well PCR plate, making sure to pipette slowly.
    1. Place the heat block into the PX1 PCR plate sealer. The sealer will begin heating up to 180 °C when turned on. Put the foil heat seal on the plate, ensuring the red line is on top. Place the plate into the PX1 and press Seal.
    2. Choose the following Thermocycler conditions: Enzyme Activation: 95 °C for 10 min for 1 cycle, Denaturation: 94 °C for 30 s for 40 cycles, Annealing/Extension: 60 °C for 1 min for 40 cycles, Enzyme Deactivation: 98 °C for 10 min for 1 cycle, Hold: 4 °C indefinitely.
    3. On the droplet reader, open the compatible software and select which wells are to be read. Select ABS as the experiment type and dd_PCR Supermix for probes. Choose Ch1 Unknown for Target 1 and Ch2 Unknown for Target 2. Select Apply, then OK. Put the plate into the droplet reader. For the dye set, choose FAM/HEX and click on Run.
  3. Analyze the dd_PCR results. Gate the double positive droplet population using the negative control as a reference. Calculate the average of the duplicate values, then multiply by the dilution factor and the 5-fold dilution factor of the dd_PCR.
    NOTE: The total copies per microliter are calculated as follows: total copies per microliter = mean value × 5 × dilution factor, where 'mean value' represents the average quantification value from Ch1 and Ch2.
  4. Combine all samples into a single library at equimolar concentrations. The 1x pooled library should contain approx. 4.5 x 109 molecules and have a total volume of 5 μL.

11. Next-generation sequencing

  1. Submit the samples for sequencing to an external agency, ensuring the correct adapter sequences are noted.

12. CIRCLE-seq data analysis (1 - 3 h)

  1. Install Python version 2.7, Burrows-Wheeler Aligner (BWA), and SAMtools. Download the reference genome (e.g., hg38) from http://hgdownload.cse.ucsc.edu/goldenPath/hg38/bigZips/hg38.fa.gz.
    NOTE: If the genome of the target species is unavailable, the CIRCLE-seq computational workflow can be run in a reference-independent mode. In this situation, this step can be skipped.
  2. Download and install the CIRCLE-seq pipeline with the following commands: (1) git clone https://github.com/tsailabSJ/circleseq.git, (2) cd circleseq, (3) pip install -r requirements.txt.
  3. Create a manifest file in YAML format (.yaml). Below is a sample manifest that can be used with the example dataset provided in the CIRCLE-seq software to test the workflow.
    NOTE: (1) reference genome: data/input/CIRCLEseq_test_genome.fa; (2) analysis_folder: data/output; (3) bwa: bwa; (4) samtools: samtools; (5) read_threshold: <Value>; (6) window_size: <Value>; (7) mapq_threshold: <Value>; (8) start_threshold: <Value>; (9) gap_threshold: <Value>; (10) mismatch_threshold: <Value>; (11) merged_analysis: True; (12) samples: U2OS_EMX1; (13) target: GAGTCCGAGCAGAAGAAGAANGG; (14) read1: data/input/EMX1.r1.fastq.gz; (15) read2: data/input/EMX1.r2.fastq.gz; (16) controlread1: data/input/EMX1_control.r1.fastq.gz; (17) controlread2: data/input/EMX1_control.r2.fastq.gz; (18) description: U2OS. The following manifest values were used: read_threshold: 4, window_size: 3, mapq_threshold: 50, start_threshold: 1, gap_threshold: 3, mismatch_threshold: 6
  4. Define the reference genome FASTA file, the output directory for analysis, and the paths to the BWA and SAMtools commands. Define the target sequences and the paths to the demultiplexed FASTQ files for both the nuclease-cleaved and control samples. Multiple experiments can be processed simultaneously in batch mode by including all of them in a single manifest file.
  5. Execute the following command for standard reference-based analyses: (1) python /path/to/circleseq.py all - manifest; (2) /path/to/manifest.yaml.
  6. Alternatively, execute the following command for standard non-reference-based analyses: (1) Python /path/to/circleseq.py reference-free - manifest; (2) /path/to/manifest.yaml.
  7. When executing the full pipeline, find the output results of each step in a distinct output_folder designated for that specific step.

Results

Here, CIRCLE-seq is utilized to investigate the nuclease-induced cleavage sites of Cas9 in a complex with the gRNA designed to target the adeno-associated virus integration site 1 (AAVS1) using DNA isolated from induced pluripotent stem cells (iPSCs). This gRNA was previously described in our publication27. Approximately 25 μg of gDNA was isolated from iPSCs, sheared through focused ultrasonication, and size selected using AMPure XP bead purification to yield fragments of approx. 300 bps. From this 25 μg of DNA, approx. 2-5 ng of DNA was successfully circularized for in vitro Cas9:gRNA cleavage. The entire procedure is depicted in Figure 1.

Following a CIRCLE-seq procedure and analysis using our computation workflow, a visualization of all detected on- and off-target cleavage sites is presented in Figure 2A. The CIRCLE-seq pipeline also provided 'merged reads', analyzed via R statistical software to yield a Manhattan plot showing the detected nuclease-induced cleavage sites mapped along each chromosome (Figure 2B).

CIRCLE-seq workflow diagram: cell culture, gDNA isolation, cleavage, circularization, sequencing.
Figure 1: CIRCLE-seq workflow schematics. Major steps of the protocol are indicated. Please click here to view a larger version of this figure.

AAVS1 gene editing analysis; sequence alignment chart and CIRCLE-seq read count graph by chromosome.
Figure 2: CIRCLE-seq visualization and Manhattan Plot. (A) Alignment of off-target sites against the intended target for the AAVS1 locus. The target sequence is displayed at the top, where off-targets are ranked by read count in descending order. Differences in the original target sequences are shown by colored nucleotides. A sample of the top unintended cleavage sites for the AAVS1 locus is shown. (B) Manhattan plot illustrating the detected unintended cleavage sites for the AAVS1 locus. Bar heights represent read counts for each chromosomal position. Please click here to view a larger version of this figure.

PrimerSequence (5'-3')Comments/Description
AAVS1 Single guide RNA (sgRNA)GGGGCCACUAGGGACAGGAUFor AAVS1 Locus' Fluorescent Protein Knock-In
AAVS1 Forward PrimerGCTCTGGGCGGAGGAATATGFor gRNA in vitro cleavage test
AAVS1 Reverse PrimerATTCCCAGGGCCGGTTAATGFor gRNA in vitro cleavage test
oSQT1288/5Phos/CGGTGGACCGATGATC /ideoxyU/ATCGGTCCACCGaTCIRCLE-seq hairpin adapter
oSQT1274AATGATACGGCGACCACCGAGTruSeq F1
oSQT1275CAAGCAGAAGACGGCATACGAGATTruSeqF2
oSQT1310/56-FAM/CCTACACGA/ZEN/CGCTCTTCCGATCT/3IABkFQ/TruSeq probe
oSQT1311/5HEX/TCGGAAGAG/ZEN/CACACGTCTGAACT/3IABkFQ/TruSeq probe

Table 1: Sequences of gRNA and primers used for CIRCLE-seq analysis of AAVS1 locus.

Discussion

Here, CIRCLE-seq is demonstrated to be an unbiased and highly sensitive technique for identifying nuclease-induced DSBs across the genome resulting from targeting the AAVS1 locus in gDNA derived from iPSCs. The AAVS1 site within iPSCs is well-known as a safe harbor locus that is often used as an integration site of exogenous genes using CRISPR-Cas928. Our recent report studied the potential of EGFP-labeled iPSCs by performing CRISPR-mediated integration of a constitutively expressed EGFP reporter into the AAVS1 site, which enables labeling and tracking of both iPSCs and differentiated iPSCs due to the persistence of EGFP throughout the cell's lineage27. This iPSC line can be used in vivo to evaluate the organismal distribution of iPSC-derived cells after transplantation. As this cell line has been CRISPR-modified and is also being used to test the clinical application of iPSCs, it is imperative that the potential AAVS1 off-target sites are known and interrogated to ensure safety and efficacy, making it an ideal locus to test CIRCLE-seq.

A notable difference between Butterfield et al., previously published study27 and this one was the use of a modified gRNA to target the AAVS1 locus. A gRNA can be designed to improve genome editing accuracy24. The guide sequence is the most critical factor that influences on- and off-target efficiencies. Therefore, the chosen gRNA was tested against several other guides and found to have superior fidelity. In addition, a methods article on reprogramming human fibroblasts substantiated the finding that synthetic capped mRNAs containing modified nucleobases benefit from low activation of antiviral responses29,30. While low immunogenicity might not be relevant in an in vitro assay, it becomes crucial when the ultimate goal is to develop a clinically relevant therapy that can be used in living cells.

CIRCLE-seq holds many advantages over similar methods. For instance, Digenome-seq sequences both nuclease-cleaved and uncleaved gDNA, using ~400 million reads21. This results in a high background, making it challenging to filter out low-frequency bona fide cut sites. CIRCLE-seq only uses ~3-5 million reads due to the enrichment of nuclease-cleaved gDNA, resulting in low background. Additionally, Digenome-seq and a similar method, SITE-seq, rely on sequencing a single nuclease-cleaved DNA end. In contrast, CIRCLE-seq reads include both ends of the cut site, enabling the identification of off-target sites without the need for a reference21,22,26.

An advantage of CIRCLE-seq is its greater sensitivity compared to the methods that rely on cell culture, such as GUIDE-seq. When the two methods were compared, CIRCLE-seq was able to capture all off-target sites detected by GUIDE-seq and uncovered additional unintended cleavage sites that GUIDE-seq had missed. However, a notable difference is that GUIDE-seq may be hindered by the epigenetic landscape, whereas CIRCLE-seq can access the entire genome.

As an in vitro assay, CIRCLE-seq presents several limitations, the first of which is the detection of false positives. Whereas epigenetics will impede nuclease activity at certain sites in vivo, ultrasonication removes these obstacles in vitro, allowing off-target activity at locations that may not normally be accessible in a cellular context. Furthermore, Cas9 is present at high concentrations in this in vitro assay, permitting cleavage that would not otherwise be possible in vivo. This assay also requires a relatively large amount of starting gDNA, which, depending on available resources, can negate the use of this protocol. Lastly, it is possible for some off-target sites to be undetectable due to the limitations of current next-gen sequencing technologies.

A recent study used an in silico approach whose algorithm identified a number of relevant parameters with which to compare different nuclease characterization methods, including CIRCLE-seq and GUIDE-seq31. Two of the relevant parameters were 'cut-site enrichment' and '% false positives'. Interestingly, CIRCLE-seq's false-positive rate was calculated at 88%, but its cut-site enrichment was folds higher than the other in vitro methods. Comparative analyses of every method revealed that GUIDE-seq was the best performer, as it demonstrated the greatest on-target specificity with only a moderate false-positive rate32. This does not invalidate CIRCLE-seq, but rather hints at the possibility of utilizing CIRCLE-seq and GUIDE-seq in tandem, validating CIRCLE-seq's findings with GUIDE-seq since the former has higher sensitivity, while the latter is a cell-based method with high cut-site enrichment. Data also indicate that amplicon-based next-generation sequencing (NGS) should be the preferred method for identifying genuine off-target modifications at potential candidate sites31. This data suggests a potential strategy of using CIRCLE-seq, followed by GUIDE-seq, and then amplicon-based NGS to examine off-target effects.

Disclosures

The authors have nothing to disclose.

Acknowledgements

Extending the deepest gratitude for funding support provided by the National Institutes of Health (R01AR078551 and T32AR007411), the Dystrophic Epidermolysis Bullosa Research Association (DEBRA) Austria, the Gates Grubstake Fund and the Gates Frontiers Fund.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
0.2-mL Thin-walled Tubes and Flat CapsThermoFisher ScientificAB1114
1.5% PippinHT cassetteSage ScienceHTC1510
10 mL Serological Pipettes FisherScientific12567603
15 mL Conical TubeFisherScientific339651
150 x 25 mm Tissue Culture Dish FisherScientific877224
25 mL Reagent Reservoir FisherScientific2138127C
2x Kapa KiFi HotStart Ready Mix Kapa BiosystemsKK2602
5 mL Serological Pipettes FisherScientific170355
50 mL Conical TubeFisherScientific339653
50x TAE Electrophoresis Buffer ThermoFisher ScientificB49
6 Well Cell Culture PlateCorning3516
Agencourt AMPure XP Reagent, 60 mLBeckman CoulterA63881
Benchtop Microcentrifuge Eppendorf5400002
BsaI-HF New England BioLabs
Buffer QX1Qiagen20912
Cas9 nuclease, Streptococcus Pyogenes New England BioLabsM0386M
CIRCLE-seq Library Preparation and NGS
Corning Matrigel hESC-Qualified MatrixCorning354277Extracellular matrix (ECM) for culturing iPSCs
ddPCR SuperMix for Probes Bio-Rad1863010
DG8 Cartridge Holder Bio-Rad1863051
DG8 Cartridges Bio-Rad1864008
DG8 Gaskets Bio-Rad1863009
DPBS, no calcium, no magnesiumThermoFisher Scientific14190144Made by Invitrogen
Droplet Generation Oil for Probes Bio-Rad1863005
Droplet Reader Oil Bio-Rad1863004
EDTA (0.5 M)ThermoFisher Scientific15575020
EDTA (0.5 M), pH 8.0, RNase-freeThermoFisher ScientificAM9260GMade by Invitrogen
Eppendorf  ThermoMixer Eppendorf5384000020
Equipment
Ethyl Alcohol, PureSigma-AldrichE7023
Exonuclease I New England BioLabsM0293LE. coli
Filter Unit FisherScientificFB0875713
Filtered Sterile Pipette Tips
Focused Ultrasonicator CovarisME220
Genomic DNA Isolation
Genomic DNA Shearing
Gentra Puregene Cell Core Kit Qiagen158043
gRNAsSynthego
HClThermoFisher ScientificA144500
Heracell VIOS Tri-gas Humidified Tissue Culture IncubatorThermoFisher Scientific51030411Need for culturing and expanding iPSCs (37 °C/5% CO2/5% O2)
High Sensitivity D1000 DNA ScreenTapeAgilent5067-5584
High Sensitivity D1000 ReagentsAgilent5067-5585
HTP Library Preparation Kit Kapa BiosystemsKK8235
HyClone Antibiotic Antimycotic SolutionCytivaSV30079.01
IDTE pH 8.0 (1x TE Solution)Integrated DNA Technologies11050204
Inverted MicroscopeNeed for imaging iPS colonies in bright-field and fluorescent channels
iPSC Culture
IsopropanolSigma-Aldrich190764
Lambda Exonuclease New England BioLabsM0262L
Loading Tips, 10 packAgilent5067-5599
Magnum FLX Enhanced Universal Magnet Plate AlpaquaA00400
Microcentrifuge TubeAxygen31104051
Microtube AFA Fiber Pre-Slit Snap-Cap Covaris520045
mTeSR-1 5x SupplementStemCell Technology85852
mTeSR-1 Basal Medium (400 mL)StemCell Technology85851Media for maintaining iPSC in culture
Nanodrop 8000 Spectrophotometer ThermoFisher ScientificND-8000-GL
NEBNext Multiplex Oligos for Illumina New England BioLabsE7600SDual Index Primers Set 1
Optical tube strip caps, 8x stripAgilent401425
Optical tube strips, 8x stripAgilent401428
Other Reagents
PCR Plate Sealer Bio-RadPX1Model Number PX1
PEG/NaCl SPRI Solution Kapa Biosystems
Phusion Hot Start Flex 2x Master Mix New England BioLabsM0536L
Pierceable Foil Heat Seal Bio-Rad1814040
Plasmid-Safe ATP-dependent DNase EpicentreE3110K
Primers, Adapters and ProbesIDTSequences are listed in Table 1
Proteinase K Qiagen19131
QIAquick Gel Extraction Kit Qiagen28704
QIAxcel Gel Analysis System Qiagen9001941
Qubit Assay TubesThermoFisher ScientificQ32856
Qubit dsDNA BR Assay Kit ThermoFisher ScientificQ32853
Qubit dsDNA BR Assay Kit ThermoFisher ScientificQ32853
Qubit dsDNA HS Assay Kit ThermoFisher ScientificQ32854
Qubit Fluorometer ThermoFisher ScientificQ33226
QX200 Droplet Digital PCR SystemBio-Rad1864001Contain a QX200 droplet generator and a QX200 droplet reader
RNase AQiagen19101
Semi-skirted PCR Plate ThermoFisher Scientific14230244
SeqPlaque GTG Agarose Lonza50110
SYBR Safe DNA Gel Stain ThermoFisher ScientificS33102
T4 DNA Ligase New England BioLabsM0202L
T4 Polynucleotide Kinase (PNK)New England BioLabsM0201L
T-75 Flasks FisherScientific7202000
Tapestation 4150AgilentG2992AA
Thermocycler with programmable temperature-stepping functionalityBio-Rad C1000 Touch
Tris baseThermoFisher ScientificBP1521
Twin.tec PCR Plate EppendorfE95102034696 wells, semi-skirted, green
UltraPure DNase/RNase-Free Distilled Water ThermoFisher Scientific10977015
USER Enzyme New England BioLabsM5505L

References

  1. Jinek, M., et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337 (6096), 816-821 (2012).
  2. Frangoul, H., et al. CRISPR-Cas9 gene editing for sickle cell disease and beta-thalassemia. N Engl J Med. 384 (3), 252-260 (2021).
  3. Ledford, H. CRISPR treatment inserted directly into the body for first time. Nature. 579 (7798), 185(2020).
  4. Gillmore, J. D., et al. CRISPR-Cas9 in vivo gene editing for transthyretin amyloidosis. N Engl J Med. 385 (6), 493-502 (2021).
  5. Fu, Y., et al. High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 31 (9), 822-826 (2013).
  6. Hsu, P. D., et al. DNA targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol. 31 (9), 827-832 (2013).
  7. Anzalone, A. V., et al. Search-and-replace genome editing without double-strand breaks or donor DNA. Nature. 576 (7785), 149-157 (2019).
  8. Hong, S. A., et al. Therapeutic base editing and prime editing of COL7A1 mutations in recessive dystrophic epidermolysis bullosa. Mol Ther. 30 (8), 2664-2679 (2022).
  9. Zhang, G., et al. Enhancement of prime editing via xrRNA motif-joined pegRNA. Nat Commun. 13 (1), 1856(2022).
  10. Lee, J., et al. Prime editing with genuine Cas9 nickases minimizes unwanted indels. Nat Commun. 14 (1), 1786(2023).
  11. Howe, S. J., et al. Insertional mutagenesis combined with acquired somatic mutations causes leukemogenesis following gene therapy of SCID-X1 patients. J Clin Invest. 118 (9), 3143-3150 (2008).
  12. Hacein-Bey-Abina, S., et al. Insertional oncogenesis in 4 patients after retrovirus-mediated gene therapy of SCID-X1. J Clin Invest. 118 (9), 3132-3142 (2008).
  13. Has, C., Kiritsi, D. Therapies for inherited skin fragility disorders. Exp Dermatol. 24 (5), 325-331 (2015).
  14. Murnane, J. P., Yezzi, M. J., Young, B. R. Recombination events during integration of transfected DNA into normal human cells. Nucleic Acids Res. 18 (9), 2733-2738 (1990).
  15. Hsieh, M. M., et al. Myelodysplastic syndrome unrelated to lentiviral vector in a patient treated with gene therapy for sickle cell disease. Blood Advances. 4 (9), 2058-2063 (2020).
  16. Tsai, S. Q., et al. GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases. Nat Biotechnol. 33 (2), 187-197 (2015).
  17. Wang, X., et al. Unbiased detection of off-target cleavage by CRISPR-Cas9 and TALENs using integrase-defective lentiviral vectors. Nat Biotechnol. 33 (2), 175-178 (2015).
  18. Lensing, S. V., et al. DSBCapture: In situ capture and sequencing of DNA breaks. Nat Methods. 13 (10), 855-857 (2016).
  19. Crosetto, N., et al. Nucleotide-resolution DNA double-strand break mapping by next-generation sequencing. Nat Methods. 10 (4), 361-365 (2013).
  20. Yan, W. X., et al. BLISS is a versatile and quantitative method for genome-wide profiling of DNA double-strand breaks. Nat Commun. 8, 15058(2017).
  21. Kim, D., et al. Digenome-seq: Genome-wide profiling of CRISPR-Cas9 off-target effects in human cells. Nat Methods. 12 (3), 237-243 (2015).
  22. Cameron, P., et al. Mapping the genomic landscape of CRISPR-Cas9 cleavage. Nat Methods. 14 (6), 600-606 (2017).
  23. Wienert, B., Wyman, S. K., Yeh, C. D., Conklin, B. R., Corn, J. E. CRISPR off-target detection with DISCOVER-seq. Nat Protoc. 15 (5), 1775-1799 (2020).
  24. Guo, C., Ma, X., Gao, F., Guo, Y. Off-target effects in CRISPR/Cas9 gene editing. Front Bioeng Biotechnol. 11, 1143157(2023).
  25. Conant, D., et al. Inference of CRISPR edits from Sanger trace data. CRISPR J. 5 (1), 123-130 (2022).
  26. Lazzarotto, C. R., et al. Defining CRISPR-Cas9 genome-wide nuclease activities with CIRCLE-seq. Nat Protoc. 13 (11), 2615-2642 (2018).
  27. Butterfield, K. T., McGrath, P. S., Han, C. M., Kogut, I., Bilousova, G. Generation of an induced pluripotent stem cell line with the constitutive EGFP reporter. Methods Mol Biol. 2155, 11-21 (2020).
  28. Hayashi, H., Kubo, Y., Izumida, M., Matsuyama, T. Efficient viral delivery of Cas9 into human safe harbor. Sci Rep. 10 (1), 21474(2020).
  29. Kogut, I., et al. High-efficiency RNA-based reprogramming of human primary fibroblasts. Nat Commun. 9 (1), 745(2018).
  30. Kariko, K., Buckstein, M., Ni, H., Weissman, D. Suppression of RNA recognition by Toll-like receptors: The impact of nucleoside modification and the evolutionary origin of RNA. Immunity. 23 (2), 165-175 (2005).
  31. Bao, X. R., Pan, Y., Lee, C. M., Davis, T. H., Bao, G. Tools for experimental and computational analyses of off-target editing by programmable nucleases. Nat Protoc. 16 (1), 10-26 (2021).
  32. Cromer, M. K., et al. Comparative analysis of CRISPR off-target discovery tools following ex vivo editing of CD34(+) hematopoietic stem and progenitor cells. Mol Ther. 31 (4), 1074-1087 (2023).

Reprints and Permissions

Tags

CRISPR Cas9Genomic DNA CircularizationIn Vitro CleavageIllumina SequencingInduced Pluripotent Stem CellsGenome Wide Cleavage SitesLibrary PreparationNext Generation Sequencing