Name: CIRCLE-Seq for Interrogation of Off-Target Gene Editing (Video) | JoVE Journal
Uploaded: 2024-11-01T13:30:00.000+00:00
Duration: 8 min 23 s
Description: Learn CIRCLE-seq for identifying off-target CRISPR-Cas9 cleavage sites using next-generation sequencing and bioinformatics tools. This computational method enhances gene therapy safety by mapping unintended genome edits.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

Extending the deepest gratitude for funding support provided by the National Institutes of Health (R01AR078551 and T32AR007411), the Dystrophic Epidermolysis Bullosa Research Association (DEBRA) Austria, the Gates Grubstake Fund and the Gates Frontiers Fund.

Detecting Off-Target CRISPR-Cas9 Cleavage Events with CIRCLE-Seq

<ol><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li>
<li>Frangoul, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR-Cas9+gene+editing+for+sickle+cell+disease+and+beta-thalassemia%5BTitle%5D)+AND+%22N+Engl+J+Med%22%5BJournal%5D)">CRISPR-Cas9 gene editing for sickle cell disease and beta-thalassemia.</a> N Engl J Med. 384 (3), 252-260 (2021).</li>
<li>Ledford, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR+treatment+inserted+directly+into+the+body+for+first+time%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">CRISPR treatment inserted directly into the body for first time.</a> Nature. 579 (7798), 185(2020).</li>
<li>Gillmore, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR-Cas9+in+vivo+gene+editing+for+transthyretin+amyloidosis%5BTitle%5D)+AND+%22N+Engl+J+Med%22%5BJournal%5D)">CRISPR-Cas9 in vivo gene editing for transthyretin amyloidosis.</a> N Engl J Med. 385 (6), 493-502 (2021).</li>
<li>Fu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((High-frequency+off-target+mutagenesis+induced+by+CRISPR-Cas+nucleases+in+human+cells%5BTitle%5D)+AND+%22Nat+Biotechnol%22%5BJournal%5D)">High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells.</a> Nat Biotechnol. 31 (9), 822-826 (2013).</li>
<li>Hsu, P. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+targeting+specificity+of+RNA-guided+Cas9+nucleases%5BTitle%5D)+AND+%22Nat+Biotechnol%22%5BJournal%5D)">DNA targeting specificity of RNA-guided Cas9 nucleases.</a> Nat Biotechnol. 31 (9), 827-832 (2013).</li>
<li>Anzalone, A. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Search-and-replace+genome+editing+without+double-strand+breaks+or+donor+DNA%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Search-and-replace genome editing without double-strand breaks or donor DNA.</a> Nature. 576 (7785), 149-157 (2019).</li>
<li>Hong, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Therapeutic+base+editing+and+prime+editing+of+COL7A1+mutations+in+recessive+dystrophic+epidermolysis+bullosa%5BTitle%5D)+AND+%22Mol+Ther%22%5BJournal%5D)">Therapeutic base editing and prime editing of COL7A1 mutations in recessive dystrophic epidermolysis bullosa.</a> Mol Ther. 30 (8), 2664-2679 (2022).</li>
<li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Enhancement+of+prime+editing+via+xrRNA+motif-joined+pegRNA%5BTitle%5D)+AND+%22Nat+Commun%22%5BJournal%5D)">Enhancement of prime editing via xrRNA motif-joined pegRNA.</a> Nat Commun. 13 (1), 1856(2022).</li>
<li>Lee, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Prime+editing+with+genuine+Cas9+nickases+minimizes+unwanted+indels%5BTitle%5D)+AND+%22Nat+Commun%22%5BJournal%5D)">Prime editing with genuine Cas9 nickases minimizes unwanted indels.</a> Nat Commun. 14 (1), 1786(2023).</li>
<li>Howe, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Insertional+mutagenesis+combined+with+acquired+somatic+mutations+causes+leukemogenesis+following+gene+therapy+of+SCID-X1+patients%5BTitle%5D)+AND+%22J+Clin+Invest%22%5BJournal%5D)">Insertional mutagenesis combined with acquired somatic mutations causes leukemogenesis following gene therapy of SCID-X1 patients.</a> J Clin Invest. 118 (9), 3143-3150 (2008).</li>
<li>Hacein-Bey-Abina, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Insertional+oncogenesis+in+4+patients+after+retrovirus-mediated+gene+therapy+of+SCID-X1%5BTitle%5D)+AND+%22J+Clin+Invest%22%5BJournal%5D)">Insertional oncogenesis in 4 patients after retrovirus-mediated gene therapy of SCID-X1.</a> J Clin Invest. 118 (9), 3132-3142 (2008).</li>
<li>Has, C., Kiritsi, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Therapies+for+inherited+skin+fragility+disorders%5BTitle%5D)+AND+%22Exp+Dermatol%22%5BJournal%5D)">Therapies for inherited skin fragility disorders.</a> Exp Dermatol. 24 (5), 325-331 (2015).</li>
<li>Murnane, J. P., Yezzi, M. J., Young, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Recombination+events+during+integration+of+transfected+DNA+into+normal+human+cells%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">Recombination events during integration of transfected DNA into normal human cells.</a> Nucleic Acids Res. 18 (9), 2733-2738 (1990).</li>
<li>Hsieh, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Myelodysplastic+syndrome+unrelated+to+lentiviral+vector+in+a+patient+treated+with+gene+therapy+for+sickle+cell+disease%5BTitle%5D)+AND+%22Blood+Advances%22%5BJournal%5D)">Myelodysplastic syndrome unrelated to lentiviral vector in a patient treated with gene therapy for sickle cell disease.</a> Blood Advances. 4 (9), 2058-2063 (2020).</li>
<li>Tsai, S. Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((GUIDE-seq+enables+genome-wide+profiling+of+off-target+cleavage+by+CRISPR-Cas+nucleases%5BTitle%5D)+AND+%22Nat+Biotechnol%22%5BJournal%5D)">GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases.</a> Nat Biotechnol. 33 (2), 187-197 (2015).</li>
<li>Wang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Unbiased+detection+of+off-target+cleavage+by+CRISPR-Cas9+and+TALENs+using+integrase-defective+lentiviral+vectors%5BTitle%5D)+AND+%22Nat+Biotechnol%22%5BJournal%5D)">Unbiased detection of off-target cleavage by CRISPR-Cas9 and TALENs using integrase-defective lentiviral vectors.</a> Nat Biotechnol. 33 (2), 175-178 (2015).</li>
<li>Lensing, S. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DSBCapture%3A+In+situ+capture+and+sequencing+of+DNA+breaks%5BTitle%5D)+AND+%22Nat+Methods%22%5BJournal%5D)">DSBCapture: In situ capture and sequencing of DNA breaks.</a> Nat Methods. 13 (10), 855-857 (2016).</li>
<li>Crosetto, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Nucleotide-resolution+DNA+double-strand+break+mapping+by+next-generation+sequencing%5BTitle%5D)+AND+%22Nat+Methods%22%5BJournal%5D)">Nucleotide-resolution DNA double-strand break mapping by next-generation sequencing.</a> Nat Methods. 10 (4), 361-365 (2013).</li>
<li>Yan, W. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((BLISS+is+a+versatile+and+quantitative+method+for+genome-wide+profiling+of+DNA+double-strand+breaks%5BTitle%5D)+AND+%22Nat+Commun%22%5BJournal%5D)">BLISS is a versatile and quantitative method for genome-wide profiling of DNA double-strand breaks.</a> Nat Commun. 8, 15058(2017).</li>
<li>Kim, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Digenome-seq%3A+Genome-wide+profiling+of+CRISPR-Cas9+off-target+effects+in+human+cells%5BTitle%5D)+AND+%22Nat+Methods%22%5BJournal%5D)">Digenome-seq: Genome-wide profiling of CRISPR-Cas9 off-target effects in human cells.</a> Nat Methods. 12 (3), 237-243 (2015).</li>
<li>Cameron, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Mapping+the+genomic+landscape+of+CRISPR-Cas9+cleavage%5BTitle%5D)+AND+%22Nat+Methods%22%5BJournal%5D)">Mapping the genomic landscape of CRISPR-Cas9 cleavage.</a> Nat Methods. 14 (6), 600-606 (2017).</li>
<li>Wienert, B., Wyman, S. K., Yeh, C. D., Conklin, B. R., Corn, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR+off-target+detection+with+DISCOVER-seq%5BTitle%5D)+AND+%22Nat+Protoc%22%5BJournal%5D)">CRISPR off-target detection with DISCOVER-seq.</a> Nat Protoc. 15 (5), 1775-1799 (2020).</li>
<li>Guo, C., Ma, X., Gao, F., Guo, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Off-target+effects+in+CRISPR%2FCas9+gene+editing%5BTitle%5D)+AND+%22Front+Bioeng+Biotechnol%22%5BJournal%5D)">Off-target effects in CRISPR/Cas9 gene editing.</a> Front Bioeng Biotechnol. 11, 1143157(2023).</li>
<li>Conant, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Inference+of+CRISPR+edits+from+Sanger+trace+data%5BTitle%5D)+AND+%22CRISPR+J%22%5BJournal%5D)">Inference of CRISPR edits from Sanger trace data.</a> CRISPR J. 5 (1), 123-130 (2022).</li>
<li>Lazzarotto, C. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Defining+CRISPR-Cas9+genome-wide+nuclease+activities+with+CIRCLE-seq%5BTitle%5D)+AND+%22Nat+Protoc%22%5BJournal%5D)">Defining CRISPR-Cas9 genome-wide nuclease activities with CIRCLE-seq.</a> Nat Protoc. 13 (11), 2615-2642 (2018).</li>
<li>Butterfield, K. T., McGrath, P. S., Han, C. M., Kogut, I., Bilousova, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Generation+of+an+induced+pluripotent+stem+cell+line+with+the+constitutive+EGFP+reporter%5BTitle%5D)+AND+%22Methods+Mol+Biol%22%5BJournal%5D)">Generation of an induced pluripotent stem cell line with the constitutive EGFP reporter.</a> Methods Mol Biol. 2155, 11-21 (2020).</li>
<li>Hayashi, H., Kubo, Y., Izumida, M., Matsuyama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Efficient+viral+delivery+of+Cas9+into+human+safe+harbor%5BTitle%5D)+AND+%22Sci+Rep%22%5BJournal%5D)">Efficient viral delivery of Cas9 into human safe harbor.</a> Sci Rep. 10 (1), 21474(2020).</li>
<li>Kogut, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((High-efficiency+RNA-based+reprogramming+of+human+primary+fibroblasts%5BTitle%5D)+AND+%22Nat+Commun%22%5BJournal%5D)">High-efficiency RNA-based reprogramming of human primary fibroblasts.</a> Nat Commun. 9 (1), 745(2018).</li>
<li>Kariko, K., Buckstein, M., Ni, H., Weissman, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Suppression+of+RNA+recognition+by+Toll-like+receptors%3A+The+impact+of+nucleoside+modification+and+the+evolutionary+origin+of+RNA%5BTitle%5D)+AND+%22Immunity%22%5BJournal%5D)">Suppression of RNA recognition by Toll-like receptors: The impact of nucleoside modification and the evolutionary origin of RNA.</a> Immunity. 23 (2), 165-175 (2005).</li>
<li>Bao, X. R., Pan, Y., Lee, C. M., Davis, T. H., Bao, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Tools+for+experimental+and+computational+analyses+of+off-target+editing+by+programmable+nucleases%5BTitle%5D)+AND+%22Nat+Protoc%22%5BJournal%5D)">Tools for experimental and computational analyses of off-target editing by programmable nucleases.</a> Nat Protoc. 16 (1), 10-26 (2021).</li>
<li>Cromer, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Comparative+analysis+of+CRISPR+off-target+discovery+tools+following+ex+vivo+editing+of+CD34%28%2B%29+hematopoietic+stem+and+progenitor+cells%5BTitle%5D)+AND+%22Mol+Ther%22%5BJournal%5D)">Comparative analysis of CRISPR off-target discovery tools following ex vivo editing of CD34(+) hematopoietic stem and progenitor cells.</a> Mol Ther. 31 (4), 1074-1087 (2023).</li>
</ol>

The authors have nothing to disclose.

Here, CIRCLE-seq is demonstrated to be an unbiased and highly sensitive technique for identifying nuclease-induced DSBs across the genome resulting from targeting the AAVS1 locus in gDNA derived from iPSCs. The AAVS1 site within iPSCs is well-known as a safe harbor locus that is often used as an integration site of exogenous genes using CRISPR-Cas928. Our recent report studied the potential of EGFP-labeled iPSCs by performing CRISPR-mediated integration of a constitutively expressed EGFP reporter into the AAVS1 site, which enables labeling and tracking of both iPSCs and differentiated iPSCs due to the persistence of EGFP throughout the cell&#39;s lineage27. This iPSC line can be used in vivo to evaluate the organismal distribution of iPSC-derived cells after transplantation. As this cell line has been CRISPR-modified and is also being used to test the clinical application of iPSCs, it is imperative that the potential AAVS1 off-target sites are known and interrogated to ensure safety and efficacy, making it an ideal locus to test CIRCLE-seq.
A notable difference between Butterfield et al., previously published&#160;study27 and this one was the use of a modified gRNA to target the AAVS1 locus. A gRNA can be designed to improve genome editing accuracy24. The guide sequence is the most critical factor that influences on- and off-target efficiencies. Therefore, the chosen gRNA was tested against several other guides and found to have superior fidelity. In addition, a methods article on reprogramming human fibroblasts substantiated the finding that synthetic capped mRNAs containing modified nucleobases benefit from low activation of antiviral responses29,30. While low immunogenicity might not be relevant in an in vitro assay, it becomes crucial when the ultimate goal is to develop a clinically relevant therapy that can be used in living cells.
CIRCLE-seq holds many advantages over similar methods. For instance, Digenome-seq sequences both nuclease-cleaved and uncleaved gDNA, using ~400 million reads21. This results in a high background, making it challenging to filter out low-frequency bona fide cut sites. CIRCLE-seq only uses ~3-5 million reads due to the enrichment of nuclease-cleaved gDNA, resulting in low background. Additionally, Digenome-seq and a similar method, SITE-seq, rely on sequencing a single nuclease-cleaved DNA end. In contrast, CIRCLE-seq reads include both ends of the cut site, enabling the identification of off-target sites without the need for a reference21,22,26.
An advantage of CIRCLE-seq is its greater sensitivity compared to the methods that rely on cell culture, such as GUIDE-seq. When the two methods were compared, CIRCLE-seq was able to capture all off-target sites detected by GUIDE-seq and uncovered additional unintended cleavage sites that GUIDE-seq had missed. However, a notable difference is that GUIDE-seq may be hindered by the epigenetic landscape, whereas CIRCLE-seq can access the entire genome.
As an in vitro assay, CIRCLE-seq presents several limitations, the first of which is the detection of false positives. Whereas epigenetics will impede nuclease activity at certain sites in vivo, ultrasonication removes these obstacles in vitro, allowing off-target activity at locations that may not normally be accessible in a cellular context. Furthermore, Cas9 is present at high concentrations in this in vitro assay, permitting cleavage that would not otherwise be possible in vivo. This assay also requires a relatively large amount of starting gDNA, which, depending on available resources, can negate the use of this protocol. Lastly, it is possible for some off-target sites to be undetectable due to the limitations of current next-gen sequencing technologies.
A recent study used an in silico approach whose algorithm identified a number of relevant parameters with which to compare different nuclease characterization methods, including CIRCLE-seq and GUIDE-seq31. Two of the relevant parameters were &#39;cut-site enrichment&#39; and &#39;% false positives&#39;. Interestingly, CIRCLE-seq&#39;s false-positive rate was calculated at 88%, but its cut-site enrichment was folds higher than the other in vitro methods. Comparative analyses of every method revealed that GUIDE-seq was the best performer, as it demonstrated the greatest on-target specificity with only a moderate false-positive rate32. This does not invalidate CIRCLE-seq, but rather hints at the possibility of utilizing CIRCLE-seq and GUIDE-seq in tandem, validating CIRCLE-seq&#39;s findings with GUIDE-seq since the former has higher sensitivity, while the latter is a cell-based method with high cut-site enrichment. Data also indicate that amplicon-based next-generation sequencing (NGS) should be the preferred method for identifying genuine off-target modifications at potential candidate sites31. This data suggests a potential strategy of using CIRCLE-seq, followed by GUIDE-seq, and then amplicon-based NGS to examine off-target effects.

Genome engineering has seen significant advancements over the past twenty years, with a major milestone being the discovery of clustered regularly interspaced short palindromic repeats (CRISPR)-Cas9 in 20121. Leveraging the programmable nature of bacterial DNA endonucleases, CRISPR-Cas9 technology enables precise targeting and modification of almost any DNA sequence. Since its inception, the system has been optimized to rely only on the Cas9 endonuclease and a guide RNA (gRNA) to edit specific genomic regions. CRISPR-Cas9&#39;s potential as a curative therapy has been demonstrated in clinical trials for various conditions such as Leber&#39;s congenital amaurosis, transthyretin amyloidosis, and sickle cell anemia, among others2,3,4.
CRISPR-Cas9 induces double-stranded breaks (DSBs), which are typically resolved by one of two mechanisms: the error-prone non-homologous end joining (NHEJ) or the more precise homology-directed repair (HDR), provided a template DNA is available. The tendency of CRISPR-Cas9 to cause NHEJ-associated insertions and deletions (indels), along with cleavage at unintended genomic sites, limits its application in clinical settings5,6,7,8,9,10. Additionally, unintended genomic modifications can create cryptic splice sites, nonsense or missense mutations, induce chromothripsis, or confer oncogenic potential to cells-outcomes that have been observed in several genome editing trials11,12,13,14,15. In conclusion, accurately identifying the off-target activity of CRISPR-Cas9 is crucial for its clinical applications, particularly in systemic gene therapies that may alter billions of cells.
Various methods can be employed to identify CRISPR-Cas9 off-target cleavage sites, including Genome-wide Unbiased Identification of Double-stranded breaks (GUIDE)-seq16, which uses double-stranded oligodeoxynucleotides to tag DSBs in living cells. Nevertheless, a criticism of this method is that false positives can arise from random DSBs or from PCR artifacts, which must be discarded by excluding captured sites that show poor similarity to the on-target sites. The method based on the use of Integrase-Defective Lentiviral Vector (IDLV) is less sensitive and likely to miss many off-target sites17. Other in situ methods like DSBCapture, BLESS, and BLISS18,19,20 involve fixed cells and label DSBs directly, however they are constrained by their dependency on immediate DSB capture and the absence of exogenous DNA. Digenome-seq21, an in vitro method, and Selective enrichment and Identification of Tagged genomic DNA Ends by sequencing (SITE-seq)22 both provide sequencing solutions but have their limitations in background noise and single-end analysis, respectively. Discovery of in situ Cas off-targets and verification by sequencing (Discover-Seq)23 offers in vivo and in situ identification of Cas9 activity via MRE11 binding, but only detects DSBs that exist at the time of sample preparation24. Lastly, Inference of CRISPR Edits (ICE) uses a bioinformatics approach to robustly analyze CRISPR edits using Sanger data25.
This article describes a detailed procedure for Circularization for In Vitro Reporting of Cleavage Effects by Sequencing (CIRCLE-seq): an in vitro&#160;technique that sensitively and impartially maps the genome-wide off-target activity of Cas9 nuclease in a complex with the gRNA of interest26. This approach begins with culturing the cells of interest and isolating DNA, followed by random shearing through focused ultrasonication, then exonuclease and ligase treatment. This process ultimately produces circular double-stranded DNA molecules, which are then purified through plasmid-safe DNase treatment. This circular DNA is then exposed to the Cas9-gRNA complex, which cleaves at both intended and unintended cleavage sites, leaving behind exposed DNA ends that act as substrates for Illumina adapter ligation. This process produces a diverse library of genomic DNA (gDNA) containing both ends of each nuclease-induced DSB, ensuring that each read has all the information necessary for each cleavage site. This allows for the use of Illumina sequencing with lower sequencing coverage requirements, setting CIRCLE-seq apart from other similar methods mentioned above. It is important to note that while CIRCLE-seq does have higher off-target sensitivity than other protocols as an in vitro method, this comes at the cost of higher false-positives due to the absence of the epigenetic landscape that is present in other methods such as GUIDE-seq16. Additionally, DSB DNA repair and its associated machinery are not present in CIRCLE-seq, abrogating indels or proper repair that would otherwise be observed.
In addition to describing the step-by-step protocol to perform CIRCLE-seq, the protocol is validated by identifying genome-wide unintended cleavage sites of CRISPR-Cas9 that occur during the modification of the AAVS1 locus, as an example. This easy-to-follow protocol provides detailed instructions, from the culture of induced pluripotent stem cells (iPSCs) and gDNA isolation to gDNA circularization, Cas9-gRNA cleavage, library preparation, sequencing, and pipeline analysis. Given the low sequencing coverage requirements, CIRCLE-seq is available to any lab with access to next-generation sequencing.

<table><tbody><tr><td>0.2-mL Thin-walled Tubes and Flat Caps</td><td>ThermoFisher Scientific</td><td>AB1114</td><td></td></tr><tr><td>1.5% PippinHT cassette</td><td>Sage Science</td><td>HTC1510</td><td></td></tr><tr><td>10 mL Serological Pipettes&amp;nbsp;</td><td>FisherScientific</td><td>12567603</td><td></td></tr><tr><td>15 mL Conical Tube</td><td>FisherScientific</td><td>339651</td><td></td></tr><tr><td>150 x 25 mm Tissue Culture Dish&amp;nbsp;</td><td>FisherScientific</td><td>877224</td><td></td></tr><tr><td>25 mL Reagent Reservoir&amp;nbsp;</td><td>FisherScientific</td><td>2138127C</td><td></td></tr><tr><td>2x Kapa KiFi HotStart Ready Mix&amp;nbsp;</td><td>Kapa Biosystems</td><td>KK2602</td><td></td></tr><tr><td>5 mL Serological Pipettes&amp;nbsp;</td><td>FisherScientific</td><td>170355</td><td></td></tr><tr><td>50 mL Conical Tube</td><td>FisherScientific</td><td>339653</td><td></td></tr><tr><td>50x TAE Electrophoresis Buffer&amp;nbsp;</td><td>ThermoFisher Scientific</td><td>B49</td><td></td></tr><tr><td>6 Well Cell Culture Plate</td><td>Corning</td><td>3516</td><td></td></tr><tr><td>Agencourt AMPure XP Reagent, 60 mL</td><td>Beckman Coulter</td><td>A63881</td><td></td></tr><tr><td>Benchtop Microcentrifuge&amp;nbsp;</td><td>Eppendorf</td><td>5400002</td><td></td></tr><tr><td>BsaI-HF&amp;nbsp;</td><td>New England BioLabs</td><td></td><td></td></tr><tr><td>Buffer QX1</td><td>Qiagen</td><td>20912</td><td></td></tr><tr><td>Cas9 nuclease, &lt;em&gt;Streptococcus Pyogenes&amp;nbsp;&lt;/em&gt;</td><td>New England BioLabs</td><td>M0386M</td><td></td></tr><tr><td>CIRCLE-seq Library Preparation and NGS</td><td></td><td></td><td></td></tr><tr><td>Corning Matrigel hESC-Qualified Matrix</td><td>Corning</td><td>354277</td><td>Extracellular matrix (ECM) for culturing iPSCs</td></tr><tr><td>ddPCR SuperMix for Probes&amp;nbsp;</td><td>Bio-Rad</td><td>1863010</td><td></td></tr><tr><td>DG8 Cartridge Holder&amp;nbsp;</td><td>Bio-Rad</td><td>1863051</td><td></td></tr><tr><td>DG8 Cartridges&amp;nbsp;</td><td>Bio-Rad</td><td>1864008</td><td></td></tr><tr><td>DG8 Gaskets&amp;nbsp;</td><td>Bio-Rad</td><td>1863009</td><td></td></tr><tr><td>DPBS, no calcium, no magnesium</td><td>ThermoFisher Scientific</td><td>14190144</td><td>Made by Invitrogen</td></tr><tr><td>Droplet Generation Oil for Probes&amp;nbsp;</td><td>Bio-Rad</td><td>1863005</td><td></td></tr><tr><td>Droplet Reader Oil&amp;nbsp;</td><td>Bio-Rad</td><td>1863004</td><td></td></tr><tr><td>EDTA (0.5 M)</td><td>ThermoFisher Scientific</td><td>15575020</td><td></td></tr><tr><td>EDTA (0.5 M), pH 8.0, RNase-free</td><td>ThermoFisher Scientific</td><td>AM9260G</td><td>Made by Invitrogen</td></tr><tr><td>Eppendorf&amp;nbsp; ThermoMixer&amp;nbsp;</td><td>Eppendorf</td><td>5384000020</td><td></td></tr><tr><td>Equipment</td><td></td><td></td><td></td></tr><tr><td>Ethyl Alcohol, Pure</td><td>Sigma-Aldrich</td><td>E7023</td><td></td></tr><tr><td>Exonuclease I&amp;nbsp;</td><td>New England BioLabs</td><td>M0293L</td><td>&lt;em&gt;E. coli&lt;/em&gt;</td></tr><tr><td>Filter Unit&amp;nbsp;</td><td>FisherScientific</td><td>FB0875713</td><td></td></tr><tr><td>Filtered Sterile Pipette Tips</td><td></td><td></td><td></td></tr><tr><td>Focused Ultrasonicator&amp;nbsp;</td><td>Covaris</td><td>ME220</td><td></td></tr><tr><td>Genomic DNA Isolation</td><td></td><td></td><td></td></tr><tr><td>Genomic DNA Shearing</td><td></td><td></td><td></td></tr><tr><td>Gentra Puregene Cell Core Kit&amp;nbsp;</td><td>Qiagen</td><td>158043</td><td></td></tr><tr><td>gRNAs</td><td>Synthego</td><td></td><td></td></tr><tr><td>HCl</td><td>ThermoFisher Scientific</td><td>A144500</td><td></td></tr><tr><td>Heracell VIOS Tri-gas Humidified Tissue Culture Incubator</td><td>ThermoFisher Scientific</td><td>51030411</td><td>Need for culturing and expanding iPSCs (37 &amp;deg;C/5% CO2/5% O2)</td></tr><tr><td>High Sensitivity D1000 DNA ScreenTape</td><td>Agilent</td><td>5067-5584</td><td></td></tr><tr><td>High Sensitivity D1000 Reagents</td><td>Agilent</td><td>5067-5585</td><td></td></tr><tr><td>HTP Library Preparation Kit&amp;nbsp;</td><td>Kapa Biosystems</td><td>KK8235</td><td></td></tr><tr><td>HyClone Antibiotic Antimycotic Solution</td><td>Cytiva</td><td>SV30079.01</td><td></td></tr><tr><td>IDTE pH 8.0 (1x TE Solution)</td><td>Integrated DNA Technologies</td><td>11050204</td><td></td></tr><tr><td>Inverted Microscope</td><td></td><td></td><td>Need for imaging iPS colonies in bright-field and fluorescent channels</td></tr><tr><td>iPSC Culture</td><td></td><td></td><td></td></tr><tr><td>Isopropanol</td><td>Sigma-Aldrich</td><td>190764</td><td></td></tr><tr><td>Lambda Exonuclease&amp;nbsp;</td><td>New England BioLabs</td><td>M0262L</td><td></td></tr><tr><td>Loading Tips, 10 pack</td><td>Agilent</td><td>5067-5599</td><td></td></tr><tr><td>Magnum FLX Enhanced Universal Magnet Plate&amp;nbsp;</td><td>Alpaqua</td><td>A00400</td><td></td></tr><tr><td>Microcentrifuge Tube</td><td>Axygen</td><td>31104051</td><td></td></tr><tr><td>Microtube AFA Fiber Pre-Slit Snap-Cap&amp;nbsp;</td><td>Covaris</td><td>520045</td><td></td></tr><tr><td>mTeSR-1 5x Supplement</td><td>StemCell Technology</td><td>85852</td><td></td></tr><tr><td>mTeSR-1 Basal Medium (400 mL)</td><td>StemCell Technology</td><td>85851</td><td>Media for maintaining iPSC in culture</td></tr><tr><td>Nanodrop 8000 Spectrophotometer&amp;nbsp;</td><td>ThermoFisher Scientific</td><td>ND-8000-GL</td><td></td></tr><tr><td>NEBNext Multiplex Oligos for Illumina&amp;nbsp;</td><td>New England BioLabs</td><td>E7600S</td><td>Dual Index Primers Set 1</td></tr><tr><td>Optical tube strip caps, 8x strip</td><td>Agilent</td><td>401425</td><td></td></tr><tr><td>Optical tube strips, 8x strip</td><td>Agilent</td><td>401428</td><td></td></tr><tr><td>Other Reagents</td><td></td><td></td><td></td></tr><tr><td>PCR Plate Sealer&amp;nbsp;</td><td>Bio-Rad</td><td>PX1</td><td>Model Number PX1</td></tr><tr><td>PEG/NaCl SPRI Solution&amp;nbsp;</td><td>Kapa Biosystems</td><td></td><td></td></tr><tr><td>Phusion Hot Start Flex 2x Master Mix&amp;nbsp;</td><td>New England BioLabs</td><td>M0536L</td><td></td></tr><tr><td>Pierceable Foil Heat Seal&amp;nbsp;</td><td>Bio-Rad</td><td>1814040</td><td></td></tr><tr><td>Plasmid-Safe ATP-dependent DNase&amp;nbsp;</td><td>Epicentre</td><td>E3110K</td><td></td></tr><tr><td>Primers, Adapters and Probes</td><td>IDT</td><td></td><td>Sequences are listed in Table 1</td></tr><tr><td>Proteinase K&amp;nbsp;</td><td>Qiagen</td><td>19131</td><td></td></tr><tr><td>QIAquick Gel Extraction Kit&amp;nbsp;</td><td>Qiagen</td><td>28704</td><td></td></tr><tr><td>QIAxcel Gel Analysis System&amp;nbsp;</td><td>Qiagen</td><td>9001941</td><td></td></tr><tr><td>Qubit Assay Tubes</td><td>ThermoFisher Scientific</td><td>Q32856</td><td></td></tr><tr><td>Qubit dsDNA BR Assay Kit&amp;nbsp;</td><td>ThermoFisher Scientific</td><td>Q32853</td><td></td></tr><tr><td>Qubit dsDNA BR Assay Kit&amp;nbsp;</td><td>ThermoFisher Scientific</td><td>Q32853</td><td></td></tr><tr><td>Qubit dsDNA HS Assay Kit&amp;nbsp;</td><td>ThermoFisher Scientific</td><td>Q32854</td><td></td></tr><tr><td>Qubit Fluorometer&amp;nbsp;</td><td>ThermoFisher Scientific</td><td>Q33226</td><td></td></tr><tr><td>QX200 Droplet Digital PCR System</td><td>Bio-Rad</td><td>1864001</td><td>Contain a QX200 droplet generator and a QX200 droplet reader</td></tr><tr><td>RNase A</td><td>Qiagen</td><td>19101</td><td></td></tr><tr><td>Semi-skirted PCR Plate&amp;nbsp;</td><td>ThermoFisher Scientific</td><td>14230244</td><td></td></tr><tr><td>SeqPlaque GTG Agarose&amp;nbsp;</td><td>Lonza</td><td>50110</td><td></td></tr><tr><td>SYBR Safe DNA Gel Stain&amp;nbsp;</td><td>ThermoFisher Scientific</td><td>S33102</td><td></td></tr><tr><td>T4 DNA Ligase&amp;nbsp;</td><td>New England BioLabs</td><td>M0202L</td><td></td></tr><tr><td>T4 Polynucleotide Kinase (PNK)</td><td>New England BioLabs</td><td>M0201L</td><td></td></tr><tr><td>T-75 Flasks&amp;nbsp;</td><td>FisherScientific</td><td>7202000</td><td></td></tr><tr><td>Tapestation 4150</td><td>Agilent</td><td>G2992AA</td><td></td></tr><tr><td>Thermocycler with programmable temperature-stepping functionality</td><td>Bio-Rad C1000 Touch</td><td></td><td></td></tr><tr><td>Tris base</td><td>ThermoFisher Scientific</td><td>BP1521</td><td></td></tr><tr><td>Twin.tec PCR Plate&amp;nbsp;</td><td>Eppendorf</td><td>E951020346</td><td>96 wells, semi-skirted, green</td></tr><tr><td>UltraPure DNase/RNase-Free Distilled Water&amp;nbsp;</td><td>ThermoFisher Scientific</td><td>10977015</td><td></td></tr><tr><td>USER Enzyme&amp;nbsp;</td><td>New England BioLabs</td><td>M5505L</td><td></td></tr></tbody></table>

circle-seq for interrogation of off-target gene editing

CIRCLE-Seq for Interrogation of Off-Target Gene Editing

Circularization for In Vitro Reporting of Cleavage Effects by Sequencing (CIRCLE-seq) is a novel technique developed for the impartial identification of unintended cleavage sites of CRISPR-Cas9 through targeted sequencing of CRISPR-Cas9 cleaved DNA. The protocol involves circularizing genomic DNA (gDNA), which is subsequently treated with the Cas9 protein and a guide RNA (gRNA) of interest. Following treatment, the cleaved DNA is purified and prepared as a library for Illumina sequencing. The sequencing process generates paired-end reads, offering comprehensive data on each cleavage site. CIRCLE-seq provides several advantages over other in vitro methods, including minimal sequencing depth requirements, low background, and high enrichment for Cas9-cleaved gDNA. These advantages enhance sensitivity in identifying both intended and unintended cleavage events. This study provides a comprehensive, step-by-step procedure for examining the off-target activity of CRISPR-Cas9 using CIRCLE-seq. As an example, this protocol is validated by mapping genome-wide unintended cleavage sites of CRISPR-Cas9 during the modification of the AAVS1 locus. The entire CIRCLE-seq process can be completed in two weeks, allowing sufficient time for cell growth, DNA purification, library preparation, and Illumina sequencing. The input of sequencing data into the CIRCLE-seq pipeline facilitates streamlined interpretation and analysis of cleavage sites.

Here, CIRCLE-seq is utilized to investigate the nuclease-induced cleavage sites of Cas9 in a complex with the gRNA designed to target the adeno-associated virus integration site 1 (AAVS1) using DNA isolated from induced pluripotent stem cells (iPSCs). This gRNA was previously described in our publication27. Approximately 25 μg of gDNA was isolated from iPSCs, sheared through focused ultrasonication, and size selected using AMPure XP bead purification to yield fragments of approx. 300 bps. From this 25 μg of DNA, approx. 2-5 ng of DNA was successfully circularized for in vitro Cas9:gRNA cleavage. The entire procedure is depicted in Figure 1.
Following a CIRCLE-seq procedure and analysis using our computation workflow, a visualization of all detected on- and off-target cleavage sites is presented in Figure 2A. The CIRCLE-seq pipeline also provided 'merged reads', analyzed via R statistical software to yield a Manhattan plot showing the detected nuclease-induced cleavage sites mapped along each chromosome (Figure 2B).
<img alt="CIRCLE-seq workflow diagram: cell culture, gDNA isolation, cleavage, circularization, sequencing." class="xfigimg" src="/files/ftp_upload/67069/67069fig01.jpg" data-altupdatedat="1788304762000" data-alt="Figure 1"> 
Figure 1: CIRCLE-seq workflow schematics. Major steps of the protocol are indicated. <a href="https://www.jove.com/files/ftp_upload/67069/67069fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="AAVS1 gene editing analysis; sequence alignment chart and CIRCLE-seq read count graph by chromosome." class="xfigimg" src="/files/ftp_upload/67069/67069fig02.jpg" data-altupdatedat="1788304762000" data-alt="Figure 2"> 
Figure 2: CIRCLE-seq visualization and Manhattan Plot. (A) Alignment of off-target sites against the intended target for the AAVS1 locus. The target sequence is displayed at the top, where off-targets are ranked by read count in descending order. Differences in the original target sequences are shown by colored nucleotides. A sample of the top unintended cleavage sites for the AAVS1 locus is shown. (B) Manhattan plot illustrating the detected unintended cleavage sites for the AAVS1 locus. Bar heights represent read counts for each chromosomal position. <a href="https://www.jove.com/files/ftp_upload/67069/67069fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primer</td>
			<td>Sequence (5'-3')</td>
			<td>Comments/Description</td>
		</tr>
		<tr>
			<td>AAVS1 Single guide RNA (sgRNA)</td>
			<td>GGGGCCACUAGGGACAGGAU</td>
			<td>For AAVS1 Locus' Fluorescent Protein Knock-In</td>
		</tr>
		<tr>
			<td>AAVS1 Forward Primer</td>
			<td>GCTCTGGGCGGAGGAATATG</td>
			<td>For gRNA in vitro cleavage test</td>
		</tr>
		<tr>
			<td>AAVS1 Reverse Primer</td>
			<td>ATTCCCAGGGCCGGTTAATG</td>
			<td>For gRNA in vitro cleavage test</td>
		</tr>
		<tr>
			<td>oSQT1288</td>
			<td>/5Phos/CGGTGGACCGATGATC /ideoxyU/ATCGGTCCACCGaT</td>
			<td>CIRCLE-seq hairpin adapter</td>
		</tr>
		<tr>
			<td>oSQT1274</td>
			<td>AATGATACGGCGACCACCGAG</td>
			<td>TruSeq F1</td>
		</tr>
		<tr>
			<td>oSQT1275</td>
			<td>CAAGCAGAAGACGGCATACGAGAT</td>
			<td>TruSeqF2</td>
		</tr>
		<tr>
			<td>oSQT1310</td>
			<td>/56-FAM/CCTACACGA/ZEN/CGCTCTTCCGATCT/3IABkFQ/</td>
			<td>TruSeq probe</td>
		</tr>
		<tr>
			<td>oSQT1311</td>
			<td>/5HEX/TCGGAAGAG/ZEN/CACACGTCTGAACT/3IABkFQ/</td>
			<td>TruSeq probe</td>
		</tr>
	</tbody>
</table>
Table 1: Sequences of gRNA and primers used for CIRCLE-seq analysis of AAVS1 locus.

A significant barrier to technologies like CRISPR is the off-target events that can disrupt vital genes. 'Circularization for In Vitro Reporting of Cleavage Effects by Sequencing' (CIRCLE-seq) is a technique designed to identify unintended cleavage sites. This method maps the genome-wide activity of CRISPR-Cas9 with high sensitivity and without bias.

Circularization for In Vitro Reporting of Cleavage Effects by Sequencing (CIRCLE-seq) is a novel technique developed for the impartial identification of ...

circle-seq-for-interrogation-of-off-target-gene-editing

Research

JoVE Journal

Genetics

Genome editing tools such as the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas (CRISPR-associated) system have greatly improved gene targeting efficiency in human induced pluripotent stem cells (hiPSCs). This manuscript describes a protocol for generating lineage specific hiPSC reporter using CRISPR/Cas system assisted homologous recombination.

Efficient Generation of hiPSC Neural Lineage Specific Knockin Reporters Using the CRISPR/Cas9 and Cas9 Double Nickase System

This protocol outlines the workflow of a CRISPR/Cas9-based gene editing system for the repair of point mutations in mammalian cells. Here, we use a combinatorial approach to gene editing with a detailed follow-on experimental strategy for measuring indel formation at the target site—in essence, analyzing onsite mutagenesis.

A Standard Methodology to Examine On-site Mutagenicity As a Function of Point Mutation Repair Catalyzed by CRISPR/Cas9 and SsODN in Human Cells

Targeted gene editing using CRISPR/Cas9 has greatly facilitated the understanding of the biological functions of genes. Here, we utilize the CRISPR/Cas9 methodology to model calreticulin mutations in cytokine-dependent hematopoietic cells in order to study their oncogenic activity.

Using CRISPR/Cas9 Gene Editing to Investigate the Oncogenic Activity of Mutant Calreticulin in Cytokine Dependent Hematopoietic Cells

Utilizing a preassembled Cas9 ribonucleoprotein complex (RNP) is a powerful method for precise, efficient genome editing. Here, we highlight its utility across a broad range of cells and organisms, including primary human cells and both classic and emerging model organisms.

Enhanced Genome Editing with Cas9 Ribonucleoprotein in Diverse Cells and Organisms

CRISPR-Cas is a powerful technology to engineer the complex genomes of plants and animals. Here, we detail a protocol to efficiently edit the human genome using different Cas endonucleases. We highlight important considerations and design parameters to optimize editing efficiency.

Genome Editing in Mammalian Cell Lines using CRISPR-Cas

This protocol outlines the steps needed to generate a model system in which the transcription of an endogenous gene of interest can be conditionally controlled in live animals or cells using enhanced lac repressor and/or tet activator systems.

In vivo Application of the REMOTE-control System for the Manipulation of Endogenous Gene Expression

The goal of this protocol is to enable seamless CRISPR/Cas9 editing of the C. elegans genome using assembled ribonucleoprotein complexes and the dpy-10 co-CRISPR marker for screening. This protocol can be used to make a variety of genetic modifications in C. elegans including insertions, deletions, gene replacements and codon substitutions.

CRISPR/Cas9 Editing of the C. elegans rbm-3.2 Gene using the dpy-10 Co-CRISPR Screening Marker and Assembled Ribonucleoprotein Complexes.

This protocol describes a high-throughput clustered regularly interspaced short palindromic repeats (CRISPR) gene editing workflow for microRNA cluster network analysis that allows the rapid generation of a panel of genetically modified cell lines carrying unique miRNA cluster member deletion combinations as large as 35 kb within a single experiment.

CRISPR Gene Editing Tool for MicroRNA Cluster Network Analysis

Here, we present a protocol that integrates CRISPR/Cas9 technology with the Cell Counting Kit-8 (CCK-8) assay to identify candidate genes that are crucial for the abnormal proliferative capacity of hematopoietic stem and progenitor cells.

Evaluation of Abnormal Growth-related Genes of Hematopoietic Stem and Progenitor Cells by Combining CRISPR/Cas9 Technology with Cell Counting

The efficiency of the Improved Genome Editing via Oviductal Nucleic Acids Delivery (I-GONAD) method is comparable to traditional microinjection, which requires zygote collection from donor females and transfer to pseudo-pregnant females. This protocol demonstrates its effectiveness by introducing CRISPR/Cas9-induced mutations into the ROSA26 locus on chromosome 6.

Improved Genome Editing via Oviductal Nucleic Acids Delivery-based In Vivo Electroporation Technique for Knockout Mice Generation

The delivery of genome editors as RNAs is a particularly potent means of modifying the genomes of primary mammalian cells and cell lines. The goal of this protocol is to deliver genome editors as mRNA into primary mammalian cells and cell lines, followed by targeted Illumina sequencing and analysis to quantify editing outcomes.

Genome Editing in Primary Mammalian Cells via Electroporation of Editor RNA

Learn CIRCLE-seq for identifying off-target CRISPR-Cas9 cleavage sites using next-generation sequencing and bioinformatics tools. This computational method enhances gene therapy safety by mapping unintended genome edits.

CIRCLE-Seq for Interrogation of Off-Target Gene Editing

Explore More Videos