Genome-Wide CRISPR Screen for Unveiling Radiosensitive and Radioresistant Genes

Summary

A meticulous and structured approach is given to select resistant and sensitive genes of radiation through the application of a genome-wide CRISPR/Cas9 screen method. This protocol also has the potential to serve as a versatile framework for other research endeavors investigating the mechanisms of resistance to clinically administered chemical drugs.

Abstract

The CRISPR-Cas9 system has been harnessed and repurposed into a powerful genome editing tool. By leveraging this technology, researchers can precisely cut, paste, and even rewrite DNA sequences within living cells. Nevertheless, the application of CRISPR screen technology goes far beyond mere experimentation. It serves as a pivotal tool in the fight against genetic diseases, systematically dissecting complex genetic landscapes, empowering researchers to unravel the molecular mechanisms underlying biological phenomena, and enabling scientists to identify and target the root causes of illnesses such as cancer, cystic fibrosis, and sickle cell anemia. Among all, cancer poses a formidable challenge for medicine, spurring eradication efforts. Radiotherapy, as a traditional treatment, yields results but has limitations. It eradicates cancer cells but also damages healthy tissues, causing adverse effects that reduce quality of life. Additionally, not all cancer cells respond to radiotherapy, and some may develop resistance, worsening the condition. To address this, a comprehensive whole-genome CRISPR screen technology is introduced, as it enables the efficient identification of radiosensitive and radioresistant genes, thereby advancing the field of cancer research and treatment. A genome-wide CRISPR screen was conducted in lung adenocarcinoma cells exposed to irradiation following the described protocol, through which both radioresistance- and radiosensitivity-associated genes were identified.

Introduction

The investigation of biological phenomena is inherently intertwined with the study of cellular behaviors, and in turn, the examination of cellular behaviors is fundamentally connected to the exploration of its genome. As modern technology continues to evolve, medical researchers are progressively redirecting their attention toward altering cellular behaviors via gene editing in order to enhance the treatment outcomes of various diseases. In this regard, clustered regularly interspaced short palindromic repeats (CRISPR) technology has emerged as a revolutionary tool for genome editing due to its relatively simple application¹. The CRISP....

Protocol

The reagents and the equipment used in this study are listed in the Table of Materials.

1. Selecting an appropriate dose of radiation

1. Preparation and plating of adherent cells
   1. Adjust the cell density to 5 x 10⁵ cells per mL with RPMI 1640 complete cell culture medium containing 10% FBS for passage and cell growth. Distribute the cells into 3.5-cm culture dishes for radiation at different doses. Add 2 mL (1 x 10⁶ cells) to each dish and incubate overnight at 37 °C with 5% CO₂.
2. Application of different radiation doses
   ....

Results

Lung cancer, with the leading mortality rate, represents a highly aggressive and prevalent medical disease. Using the lung cancer cell line A549 as an example to conduct a genome-wide CRISPR screen with radiation as the screening condition, the schematic workflow is shown in Figure 1. First, explore the sensitivity of A549 cells to different doses of radiation through clone formation and CCK8 experiments (Figure 2). In the clonogenic assay, the colony count was .......

Discussion

As a cutting-edge gene editing technology, the CRISPR screen has sparked profound changes in the field of scientific research⁵. Arising from the CRISPR-Cas9 system, this technology has become an essential tool for studying gene functions due to its high efficiency and precision⁹. The CRISPR/Cas9 engineering principle involves designing and introducing specific sgRNAs with approximately 20 nucleotides to guide the Cas9 nuclease to precisely locate and cut target DNA sequence.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
150 mm cell and tissue culture dish	Wuxi NEST Biotechnology Co., Ltd.	715011	Cell culture
35 mm cell and tissue culture dish	Wuxi NEST Biotechnology Co., Ltd.	706011	Cell culture
A549 cell line	ATCC	-	-
Cell counting kit-8	Shanghai Beyotime Biotech Inc	C0041	For cell viability assay
CO2-independent medium	PHCbi	MCO-50AIC	Cell culture
Countess 3 FL automated cell counter	Themo Scientific	AMQAF2001	For cell counting
EDTA	Gibco	25200056	Cell culture
Fetal bovine serum	Gibco	10099141	Cell culture
Fluorescence microscopy	LEICA	ebq 100-04	For fluorescence microscope
Genome-wide CRISPR lentiviral library	Shanghai OBiO Technology Co., Ltd.	H5070	For lentiviral infection
MiniAmp plus PCR	Themo Scientific	C37835	For PCR amplification
NEST cell culture plates, 12-well	Wuxi NEST Biotechnology Co., Ltd.	712002	Cell culture
NEST cell culture plates, 6-well	Wuxi NEST Biotechnology Co., Ltd.	703002	Cell culture
NEST cell culture plates, 96-well	Wuxi NEST Biotechnology Co., Ltd.	701001	Cell culture
PBS	Gibco	C10010500BT	Cell culture
PCR forward primer (AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG)	Beijing AuGCT Biotech Co., Ltd.	-	For PCR amplification
PCR reverse primer (GATGTGCGCTCTGCCCACTGACGGGCA)	Beijing AuGCT Biotech Co., Ltd.	-	For PCR amplification
Polybrene	Shanghai Beyotime Biotech Inc	C0351	For lentiviral infection
Puromycin	MCE	HY-K1057	For seletion post lentiviral infection
RPMI 1640 cell culture medium	Gibco	23400-021	Cell culture
TIANGENamp genomic DNA kit	Beijing TIANGEN Biotech Co.,Ltd.	DP304	For genomic DNA extraction
X-ray powder diffractometer	PerkinElmer		For radiotherapy