Method Article

Mycobacterial DNA Extraction using Bead Beating in Custom Buffer Followed by NGS Workflow

DOI:

10.3791/68037

June 13th, 2025

* These authors contributed equally

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

This protocol shows bead-beating combined with DNA capture bead purification provides a fast and consistent method for extracting DNA from Mycobacterium tuberculosis samples, making it an effective choice for next-generation sequencing applications.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Tuberculosis is a deadly disease, and the emergence of antibiotic drug resistance in the causative agent bacterium, Mycobacterium tuberculosis, worsens treatment outcomes. Precise and rapid drug resistance identification through sequencing technologies is needed to improve tuberculosis patient outcomes through tailored therapeutic regimens. The DNA extraction method is critical for downstream molecular assays and is complicated by the tough cell wall of Mycobacterium, the low bacillary load of many clinical samples, and the complexity of the sputum matrix. There are numerous M. tuberculosis DNA extraction methods reported, but there is currently no gold standard. Furthermore, few of these methods are shown to work consistently, and many are not suitable for low-resource and high-burden tuberculosis settings. Consequently, laboratories frequently introduce their own procedure modifications, resulting in significant method variability. Here, we present a cost-effective, rapid, and standardized protocol for Mycobacterial DNA extraction from both clinical sputum and culture that produces DNA suitable for qPCR, and which should be considered for use in clinical diagnostics laboratories.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Extracting high-quality DNA from M. tuberculosis is necessary for the detection of drug-resistant tuberculosis (TB) using targeted next-generation sequencing (NGS) and whole genome sequencing (WGS) but is often overlooked. We developed a standardized protocol to provide consistent, high-quality DNA for clinical NGS applications, including targeted NGS approaches like Deeplex-MycTB (GenoScreen) and whole genome sequencing, which are now recommended by the World Health Organization (WHO) for the diagnosis of drug-resistant tuberculosis. Notably, while the WHO recommends these NGS-based diagnostic strategies, it does not specify the particular DNA extraction pro....

Access restricted. Please log in or start a trial to view this content.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

This study was conducted at the University of California San Francisco (UCSF) under Institutional Biosafety Committee approval (BUA #BU198320-01GBUA/BABB) and follows UCSF research ethics guidelines. We obtained remnant sputum samples collected by Discovery Life Sciences under an IRB-approved Waiver of Consent protocol from individuals with non-TB respiratory conditions.

1. Preparation of buffers

  1. Custom Triton buffer (Table 1): To prepare 100 mL of custom Triton buffer, start by combining 2 mL of 5 M NaCl, 1 mL of 1 M Tris-HCl (pH 8), 1 mL of Triton X-100, and 0.2 mL of 0.5 M ethylenediaminetetr....

Access restricted. Please log in or start a trial to view this content.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

We tested the DNA extraction protocol on both cultured M. tuberculosis and M. tuberculosis spiked sputum samples (n = 3 for each condition). Using cultured M. tuberculosis H37Rv mc² 7901, we standardized the input to 8.4 x 106 cells per 50 µL, equivalent to 1 mL of a MGIT culture at 200 GU. For sputum experiments, we spiked 1 mL of sputum pooled from individuals with non-TB respiratory conditions (obtained commercially) with two different bacterial concentrations (50,000, roughly a 1.......

Access restricted. Please log in or start a trial to view this content.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

In this work, we present a robust, validated protocol for extracting high-quality M. tuberculosis DNA using bead-beating with magnetic bead cleanup for downstream molecular and NGS applications.

The method offers several advantages over existing M. tuberculosis DNA extraction protocols. While traditional phenol-chloroform extraction typically takes several days and introduces hazardous chemicals, this method is completed in under 60 min with minimal hazardous waste. This appr.......

Access restricted. Please log in or start a trial to view this content.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors have nothing to disclose.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

R01AI153213 National Institute of Allergy and Infectious Diseases (NIAID).

....

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
0.1 mm Zirconia-Silicate BeadsBiospec Products11079101zBeads used for bead-beating step to lyse mycobacterial cells
AMPure XP BeadsBeckman CoulterA63880Magnetic beads for DNA cleanup post-lysis
EDTA (0.5M, pH 8.0) Thermo Fisher ScientificAM9260GCustom Triton/ Low EDTA Buffer Components
Fastprep 24MPbio, USA116004500Equipment for bead beating at 6.5 m/s
Forward PrimerThermo Fisher ScientificCustom synthesisPrimer sequence: AATTCCTGGTGTAGCGGTGG
H2O (Water, molecular biology grade)Thermo Fisher ScientificBP2819-1Custom Triton/ Low EDTA Buffer Components
Luna Universal ProbeNew England BiolabsM3004qPCR reagent for Mycobacterial DNA enumeration
MycoPrep KitBDSKU/REF 240863BD MycoPrep Specimen Digestion for NALC-NaOH Sputum Processing
NaCl (Sodium Chloride, 5M solution)Thermo Fisher ScientificAM9759Custom Triton/ Low EDTA Buffer Components
PBSMillipore SigmaP2272Sputum Processing
Reverse PrimerThermo Fisher ScientificCustom synthesisPrimer sequence: GTTTACGGCGTGGACTACCA
TaqMan ProbeThermo Fisher ScientificCustom synthesisProbe sequence: AGGAGGAACACCGGTGGCGA
Tris-HCl (1M, pH 8.0)Thermo Fisher ScientificAM9855GCustom Triton/ Low EDTA Buffer Components
Triton X-100Thermo Fisher Scientific28314Custom Triton/ Low EDTA Buffer Components

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Jouet, A., et al. Deep amplicon sequencing for culture-free prediction of susceptibility or resistance to 13 anti-tuberculous drugs. Eur Respir J. 57 (3), 2002338(2021).
  2. George, S., et al. DNA Thermo-Protection Facilitates Whole Genome Sequencing of Mycobacteria Direct from Clinical Samples by the Nanopore Platform.

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Tuberculosis DiagnosticsDrug Resistance DetectionSputum Sample ProcessingMagnetic Bead CleanupQuantitative PCRNext Generation SequencingCell Lysis

Related Articles