Mycobacterial DNA Extraction using Bead Beating in Custom Buffer Followed by NGS Workflow

Summary

This protocol shows bead-beating combined with DNA capture bead purification provides a fast and consistent method for extracting DNA from Mycobacterium tuberculosis samples, making it an effective choice for next-generation sequencing applications.

Abstract

Tuberculosis is a deadly disease, and the emergence of antibiotic drug resistance in the causative agent bacterium, Mycobacterium tuberculosis, worsens treatment outcomes. Precise and rapid drug resistance identification through sequencing technologies is needed to improve tuberculosis patient outcomes through tailored therapeutic regimens. The DNA extraction method is critical for downstream molecular assays and is complicated by the tough cell wall of Mycobacterium, the low bacillary load of many clinical samples, and the complexity of the sputum matrix. There are numerous M. tuberculosis DNA extraction methods reported, but there is currently no gold standard. Furthermore, few of these methods are shown to work consistently, and many are not suitable for low-resource and high-burden tuberculosis settings. Consequently, laboratories frequently introduce their own procedure modifications, resulting in significant method variability. Here, we present a cost-effective, rapid, and standardized protocol for Mycobacterial DNA extraction from both clinical sputum and culture that produces DNA suitable for qPCR, and which should be considered for use in clinical diagnostics laboratories.

Introduction

Extracting high-quality DNA from M. tuberculosis is necessary for the detection of drug-resistant tuberculosis (TB) using targeted next-generation sequencing (NGS) and whole genome sequencing (WGS) but is often overlooked. We developed a standardized protocol to provide consistent, high-quality DNA for clinical NGS applications, including targeted NGS approaches like Deeplex-MycTB (GenoScreen) and whole genome sequencing, which are now recommended by the World Health Organization (WHO) for the diagnosis of drug-resistant tuberculosis. Notably, while the WHO recommends these NGS-based diagnostic strategies, it does not specify the particular DNA extraction protocols to support them. Our method can be used with WHO-endorsed tests as well as with emerging technologies that require high-quality mycobacterial DNA.

The extraction challenge stems from M. tuberculosis's unique cell wall, comprised of mycolic acids and lipids that make it exceptionally difficult to break open. Current published extraction solutions have substantial variation in lysis (e.g., sonication, chemical, heat, and bead-beating) and DNA extraction methods (e.g., phenol-chloroform extraction, ethanol precipitation, CTAB-based and column and bead-based methods), which results in differences in DNA yield, purity, and quality^{1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16}. In addition, research groups rarely use the same DNA extraction method and often measure success differently. This makes determining which method works best difficult since the optimal approach depends on the type of molecular application. For example, resolving M. tuberculosis structural variants in sputum using long-read sequencing requires higher-quality DNA and more accurate polymerase than running a paid diagnostic tool that only targets a small region of rpoB. Several factors further complicate DNA extraction success. The amount of DNA we can extract varies based on the sample type, how many bacteria are present, and whether there are substances (co-extracted non-mycobacterial DNA and PCR inhibitors) that interfere with the process. Even technical aspects like how precisely a lab technician pipettes can affect the results. Current methods often fall short when processing samples with low bacterial loads or high levels of contaminating DNA, which are commonly encountered in clinical settings^17,18,19.

Bead beating in custom buffer, followed by a bead clean-up protocol, offers key advantages over other methods. It is a simple and rapid workflow that reduces the opportunity for operator-dependent variation and maintains DNA integrity for downstream NGS applications. This standardized approach particularly suits clinical laboratories seeking reliable, reproducible results using WHO-recommended NGS drug resistance assays and all WGS applications.

Protocol

This study was conducted at the University of California San Francisco (UCSF) under Institutional Biosafety Committee approval (BUA #BU198320-01GBUA/BABB) and follows UCSF research ethics guidelines. We obtained remnant sputum samples collected by Discovery Life Sciences under an IRB-approved Waiver of Consent protocol from individuals with non-TB respiratory conditions.

1. Preparation of buffers

1. Custom Triton buffer (Table 1): To prepare 100 mL of custom Triton buffer, start by combining 2 mL of 5 M NaCl, 1 mL of 1 M Tris-HCl (pH 8), 1 mL of Triton X-100, and 0.2 mL of 0.5 M ethylenediaminetetraacetic acid (EDTA). Add ultrapure water to bring the total volume to 100 mL. Filter sterilize before use. The final buffer contains 100 mM NaCl, 10 mM Tris-HCl, 1 mM EDTA, and 1% Triton X-100.
2. Low EDTA TE (Table 2): To prepare 100 mL of Low EDTA TE Buffer, combine 1 mL of 1M Tris-HCl (pH 8) and 0.02 mL of 0.5 M EDTA. Add ultrapure water to bring the total volume to 100 mL. The final buffer contains 10 mM Tris-HCl and 0.1 mM EDTA.

2. Preparation of lysis tubes

1. Using a scalpel blade carefully cut the bottom off a 1.5 mL screw cap tube just below the inflection point.
2. Cut the tip off a P1000 tip, cut a V shaped wedge near the end, and wedge the prepared bottom of the screw cap tube in it. Refer to Figure 1 for a diagram of the scoop.
3. Fill a sterile container (e.g., a reservoir or Petri dish) with 0.1 mm Zirconia-Silicate Beads and use the prepared scoop to distribute one scoopful of beads (~200 mg) into 1.5 mL screw cap tubes.

Figure 1: In-house bead distribution scoop. The scoop was designed for the easy transfer of ~200 mg of 0.1 mm zirconium beads into processing tubes. Please click here to view a larger version of this figure.

3. Preparation of input

NOTE: All sample preparation should be conducted according to your facility's biosafety protocols. We strongly recommend handling infectious materials inside a Class II Biosafety Cabinet (BSC) to minimize the risk of aerosol exposure.

1. Bacterial cell culture
   1. Centrifuge ~ 5 mL of M. tuberculosis culture (either MGIT or turbid liquid culture) in a 15 mL conical centrifuge tube at max speed (≥ 3,000 x g) for 10 min.
   2. Using a 10 mL serological pipette, carefully remove all but ~ 500 µL of the supernatant without disturbing the pellet. Remove the remaining supernatant with a P1000 pipette without disturbing the pellet.
   3. Resuspend the pellet in 350 µL of custom Triton buffer by pipetting up and down. If required (i.e., to remove samples for processing outside a BSL-3), inactivate the sample according to the standard operating procedures.
2. Sputum preparation
   1. Transfer 1-5 mL of sputum sample (spontaneous or induced) into a sterile 50 mL centrifuge tube.
3. DTT liquefaction
   1. Add four volumes of 100 mM dithiothreitol to the sputum sample (volume may vary). If using a commercial reagent, follow the manufacturer's dilution instructions.
   2. Vortex thoroughly for 30 s. Incubate at room temperature (20-25 °C) for 7 min. Vortex again for 30 s.
   3. Repeat steps 3.3.1. and 3.3.2. 1x, for very viscous samples, perform up to 5 incubation-vortex cycles.
   4. Centrifuge at maximum speed (≥ 3,000 x g) for 10 min. Using a 10 mL serological pipette, carefully discard all but ~ 500 µL of the supernatant. Remove the remaining supernatant with a P1000 pipette without disturbing the pellet.
   5. Resuspend the pellet in 350 µL of custom Triton buffer.
4. NALC-NaOH liquefaction
   1. To prepare the NALC-NaOH solution, follow the manufacturer's instructions for preparation and dilution.
   2. Add four volumes of NALC-NaOH solution to the sputum sample (spontaneous or induced, volume may vary).
   3. Vortex for 30 s. Incubate at room temperature (20-25 °C) for 7 min. Repeat steps 3.4.1 and 3.4.2. 1x. For very viscous samples, perform up to 5 incubation-vortex cycles.
   4. Add PBS to the 50 mL mark. Vortex briefly to mix. Centrifuge at maximum speed (≥ 3,000 x g) for 10 min.
   5. Using a 50 mL serological pipette, carefully discard all but ~ 500 µL of the supernatant. Remove the remaining supernatant with a P1000 pipette without disturbing the pellet.
   6. Resuspend the pellet in 350 µL of custom Triton buffer. If required (i.e., to remove samples for processing outside a BSL-3), inactivate the sample according to the standard operating procedures.

4. Extraction of DNA

1. Transfer the inactivated bacterial suspension (350 µL from step 3) to a new well-labeled 1.5 mL screw cap tube containing ~250 µL of 0.1 mm Zirconia-Silicate Beads.
2. Bead beat the lysate at 6.5 m/s for 45 s with 2 min rest between runs. Repeat for a total of three bead-beating cycles.
3. Centrifuge at max speed (≥ 12,000 x g) for 2 min and transfer 150 µL of the supernatant to a new well-labeled tube. Take care not to transfer beads or cell debris.
4. Allow cleanup magnetic beads to equilibrate to room temperature for 30 min and vortex thoroughly to ensure complete resuspension before use.
5. Add 180 µL (1.2x volume) of cleanup magnetic beads and mix by pipetting up and down 10x. Incubate at room temperature for 2 min.
6. Place on a magnetic rack and wait for the solution to clear for ~ 2 min. Using a P200 pipette, carefully discard the supernatant without disturbing the magnetic beads.
7. With the tube still on the magnetic rack, add 500 µL of freshly prepared 70 % (v/v) ethanol, dispensing along the opposite tube wall to the magnetic beads. Wait for 30 s.
8. Repeat steps 4.5. - 4.7. for a total of two washes. At the end of the last wash, remove residual ethanol with a P10 pipette. Dry the beads briefly for ~ 2 min.
9. Immediately after the bead pellet becomes opaque, remove the tube from the magnetic rack and resuspend in 20 µL of Low EDTA Tris Buffer. Do not allow the beads to become dry and cracked.
10. Mix by pipetting or vortexing to ensure all the beads are in solution. Incubate at room temperature for 5 min.
11. Place on a magnetic rack and wait for the solution to become clear for ~ 2 min. Transfer the eluted DNA to a new well-labeled tube for downstream analysis. Aspirate <20 µL of extracted DNA to avoid magnetic bead carry-over.

5. qPCR enumeration of mycobacterial DNA

1. To quantify mycobacterial DNA using a quantitative PCR targeting 99 nucleotides of the mycobacterial atpE (Rv1305), assemble a 10 µL reaction mixture per sample on ice containing 5 µL of universal probe master mix (2x), 0.4 µL each of forward primer (5'-AATTCCTGGTGTAGCGGTGG-3', 10 µM), and reverse primer (5'-GTTTACGGCGTGGACTACCA-3', 10 µM), 0.2 µL of TaqMan probe (5'-VIC-AGGAGGAACACCGGTGGCGA-MGB-3', 10 µM), 2 µL of DNA template, and 2 µL of nuclease-free water (Table 3).
2. Run the reaction using the following thermal cycling conditions: initial denaturation at 95 °C for 60 s, followed by 35 cycles of 95 °C for 10 s and 60 °C for 30 s (with a capture here, using a ramp rate of 2.11 °C/s; Table 4).
   NOTE: In this case, qPCR was performed using a TaqMan assay with VIC-labeled probe on a QuantStudio 3 Real-Time PCR System,
3. Run all samples, standards, and controls in technical triplicates. Generate standard curves using serial dilutions of purified M. tuberculosis DNA. Perform relative quantification analysis using analysis Software.
4. Export the resulting relative quantification values to CSV format and visualize using R Studio (version 2024.09.1+394) to generate box plots comparing DNA yields across extraction methods.

Results

We tested the DNA extraction protocol on both cultured M. tuberculosis and M. tuberculosis spiked sputum samples (n = 3 for each condition). Using cultured M. tuberculosis H37Rv mc² 7901, we standardized the input to 8.4 x 10⁶ cells per 50 µL, equivalent to 1 mL of a MGIT culture at 200 GU. For sputum experiments, we spiked 1 mL of sputum pooled from individuals with non-TB respiratory conditions (obtained commercially) with two different bacterial concentrations (50,000, roughly a 1...

Discussion

In this work, we present a robust, validated protocol for extracting high-quality M. tuberculosis DNA using bead-beating with magnetic bead cleanup for downstream molecular and NGS applications.

The method offers several advantages over existing M. tuberculosis DNA extraction protocols. While traditional phenol-chloroform extraction typically takes several days and introduces hazardous chemicals, this method is completed in under 60 min with minimal hazardous waste. This appr...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
0.1 mm Zirconia-Silicate Beads	Biospec Products	11079101z	Beads used for bead-beating step to lyse mycobacterial cells
AMPure XP Beads	Beckman Coulter	A63880	Magnetic beads for DNA cleanup post-lysis
EDTA (0.5M, pH 8.0)	Thermo Fisher Scientific	AM9260G	Custom Triton/ Low EDTA Buffer Components
Fastprep 24	MPbio, USA	116004500	Equipment for bead beating at 6.5 m/s
Forward Primer	Thermo Fisher Scientific	Custom synthesis	Primer sequence: AATTCCTGGTGTAGCGGTGG
H2O (Water, molecular biology grade)	Thermo Fisher Scientific	BP2819-1	Custom Triton/ Low EDTA Buffer Components
Luna Universal Probe	New England Biolabs	M3004	qPCR reagent for Mycobacterial DNA enumeration
MycoPrep Kit	BD	SKU/REF 240863	BD MycoPrep Specimen Digestion for NALC-NaOH Sputum Processing
NaCl (Sodium Chloride, 5M solution)	Thermo Fisher Scientific	AM9759	Custom Triton/ Low EDTA Buffer Components
PBS	Millipore Sigma	P2272	Sputum Processing
Reverse Primer	Thermo Fisher Scientific	Custom synthesis	Primer sequence: GTTTACGGCGTGGACTACCA
TaqMan Probe	Thermo Fisher Scientific	Custom synthesis	Probe sequence: AGGAGGAACACCGGTGGCGA
Tris-HCl (1M, pH 8.0)	Thermo Fisher Scientific	AM9855G	Custom Triton/ Low EDTA Buffer Components
Triton X-100	Thermo Fisher Scientific	28314	Custom Triton/ Low EDTA Buffer Components