This protocol shows bead-beating combined with DNA capture bead purification provides a fast and consistent method for extracting DNA from Mycobacterium tuberculosis samples, making it an effective choice for next-generation sequencing applications.
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
* These authors contributed equally
This protocol shows bead-beating combined with DNA capture bead purification provides a fast and consistent method for extracting DNA from Mycobacterium tuberculosis samples, making it an effective choice for next-generation sequencing applications.
Tuberculosis is a deadly disease, and the emergence of antibiotic drug resistance in the causative agent bacterium, Mycobacterium tuberculosis, worsens treatment outcomes. Precise and rapid drug resistance identification through sequencing technologies is needed to improve tuberculosis patient outcomes through tailored therapeutic regimens. The DNA extraction method is critical for downstream molecular assays and is complicated by the tough cell wall of Mycobacterium, the low bacillary load of many clinical samples, and the complexity of the sputum matrix. There are numerous M. tuberculosis DNA extraction methods reported, but there is currently no gold standard. Furthermore, few of these methods are shown to work consistently, and many are not suitable for low-resource and high-burden tuberculosis settings. Consequently, laboratories frequently introduce their own procedure modifications, resulting in significant method variability. Here, we present a cost-effective, rapid, and standardized protocol for Mycobacterial DNA extraction from both clinical sputum and culture that produces DNA suitable for qPCR, and which should be considered for use in clinical diagnostics laboratories.
Extracting high-quality DNA from M. tuberculosis is necessary for the detection of drug-resistant tuberculosis (TB) using targeted next-generation sequencing (NGS) and whole genome sequencing (WGS) but is often overlooked. We developed a standardized protocol to provide consistent, high-quality DNA for clinical NGS applications, including targeted NGS approaches like Deeplex-MycTB (GenoScreen) and whole genome sequencing, which are now recommended by the World Health Organization (WHO) for the diagnosis of drug-resistant tuberculosis. Notably, while the WHO recommends these NGS-based diagnostic strategies, it does not specify the particular DNA extraction protocols to support them. Our method can be used with WHO-endorsed tests as well as with emerging technologies that require high-quality mycobacterial DNA.
The extraction challenge stems from M. tuberculosis's unique cell wall, comprised of mycolic acids and lipids that make it exceptionally difficult to break open. Current published extraction solutions have substantial variation in lysis (e.g., sonication, chemical, heat, and bead-beating) and DNA extraction methods (e.g., phenol-chloroform extraction, ethanol precipitation, CTAB-based and column and bead-based methods), which results in differences in DNA yield, purity, and quality1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16. In addition, research groups rarely use the same DNA extraction method and often measure success differently. This makes determining which method works best difficult since the optimal approach depends on the type of molecular application. For example, resolving M. tuberculosis structural variants in sputum using long-read sequencing requires higher-quality DNA and more accurate polymerase than running a paid diagnostic tool that only targets a small region of rpoB. Several factors further complicate DNA extraction success. The amount of DNA we can extract varies based on the sample type, how many bacteria are present, and whether there are substances (co-extracted non-mycobacterial DNA and PCR inhibitors) that interfere with the process. Even technical aspects like how precisely a lab technician pipettes can affect the results. Current methods often fall short when processing samples with low bacterial loads or high levels of contaminating DNA, which are commonly encountered in clinical settings17,18,19.
Bead beating in custom buffer, followed by a bead clean-up protocol, offers key advantages over other methods. It is a simple and rapid workflow that reduces the opportunity for operator-dependent variation and maintains DNA integrity for downstream NGS applications. This standardized approach particularly suits clinical laboratories seeking reliable, reproducible results using WHO-recommended NGS drug resistance assays and all WGS applications.
Access restricted. Please log in or start a trial to view this content.
This study was conducted at the University of California San Francisco (UCSF) under Institutional Biosafety Committee approval (BUA #BU198320-01GBUA/BABB) and follows UCSF research ethics guidelines. We obtained remnant sputum samples collected by Discovery Life Sciences under an IRB-approved Waiver of Consent protocol from individuals with non-TB respiratory conditions.
1. Preparation of buffers
2. Preparation of lysis tubes

Figure 1: In-house bead distribution scoop. The scoop was designed for the easy transfer of ~200 mg of 0.1 mm zirconium beads into processing tubes. Please click here to view a larger version of this figure.
3. Preparation of input
NOTE: All sample preparation should be conducted according to your facility's biosafety protocols. We strongly recommend handling infectious materials inside a Class II Biosafety Cabinet (BSC) to minimize the risk of aerosol exposure.
4. Extraction of DNA
5. qPCR enumeration of mycobacterial DNA
Access restricted. Please log in or start a trial to view this content.
We tested the DNA extraction protocol on both cultured M. tuberculosis and M. tuberculosis spiked sputum samples (n = 3 for each condition). Using cultured M. tuberculosis H37Rv mc² 7901, we standardized the input to 8.4 x 106 cells per 50 µL, equivalent to 1 mL of a MGIT culture at 200 GU. For sputum experiments, we spiked 1 mL of sputum pooled from individuals with non-TB respiratory conditions (obtained commercially) with two different bacterial concentrations (50,000, roughly a 1...
Access restricted. Please log in or start a trial to view this content.
In this work, we present a robust, validated protocol for extracting high-quality M. tuberculosis DNA using bead-beating with magnetic bead cleanup for downstream molecular and NGS applications.
The method offers several advantages over existing M. tuberculosis DNA extraction protocols. While traditional phenol-chloroform extraction typically takes several days and introduces hazardous chemicals, this method is completed in under 60 min with minimal hazardous waste. This appr...
Access restricted. Please log in or start a trial to view this content.
The authors have nothing to disclose.
R01AI153213 National Institute of Allergy and Infectious Diseases (NIAID).
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| 0.1 mm Zirconia-Silicate Beads | Biospec Products | 11079101z | Beads used for bead-beating step to lyse mycobacterial cells |
| AMPure XP Beads | Beckman Coulter | A63880 | Magnetic beads for DNA cleanup post-lysis |
| EDTA (0.5M, pH 8.0) | Thermo Fisher Scientific | AM9260G | Custom Triton/ Low EDTA Buffer Components |
| Fastprep 24 | MPbio, USA | 116004500 | Equipment for bead beating at 6.5 m/s |
| Forward Primer | Thermo Fisher Scientific | Custom synthesis | Primer sequence: AATTCCTGGTGTAGCGGTGG |
| H2O (Water, molecular biology grade) | Thermo Fisher Scientific | BP2819-1 | Custom Triton/ Low EDTA Buffer Components |
| Luna Universal Probe | New England Biolabs | M3004 | qPCR reagent for Mycobacterial DNA enumeration |
| MycoPrep Kit | BD | SKU/REF 240863 | BD MycoPrep Specimen Digestion for NALC-NaOH Sputum Processing |
| NaCl (Sodium Chloride, 5M solution) | Thermo Fisher Scientific | AM9759 | Custom Triton/ Low EDTA Buffer Components |
| PBS | Millipore Sigma | P2272 | Sputum Processing |
| Reverse Primer | Thermo Fisher Scientific | Custom synthesis | Primer sequence: GTTTACGGCGTGGACTACCA |
| TaqMan Probe | Thermo Fisher Scientific | Custom synthesis | Probe sequence: AGGAGGAACACCGGTGGCGA |
| Tris-HCl (1M, pH 8.0) | Thermo Fisher Scientific | AM9855G | Custom Triton/ Low EDTA Buffer Components |
| Triton X-100 | Thermo Fisher Scientific | 28314 | Custom Triton/ Low EDTA Buffer Components |
Access restricted. Please log in or start a trial to view this content.