Mycobacterial DNA Extraction using Bead Beating in Custom Buffer Followed by NGS Workflow

Summary

This protocol shows bead-beating combined with DNA capture bead purification provides a fast and consistent method for extracting DNA from Mycobacterium tuberculosis samples, making it an effective choice for next-generation sequencing applications.

Abstract

Tuberculosis is a deadly disease, and the emergence of antibiotic drug resistance in the causative agent bacterium, Mycobacterium tuberculosis, worsens treatment outcomes. Precise and rapid drug resistance identification through sequencing technologies is needed to improve tuberculosis patient outcomes through tailored therapeutic regimens. The DNA extraction method is critical for downstream molecular assays and is complicated by the tough cell wall of Mycobacterium, the low bacillary load of many clinical samples, and the complexity of the sputum matrix. There are numerous M. tuberculosis DNA extraction methods reported, but there is currently no gold standard. Furthermore, few of these methods are shown to work consistently, and many are not suitable for low-resource and high-burden tuberculosis settings. Consequently, laboratories frequently introduce their own procedure modifications, resulting in significant method variability. Here, we present a cost-effective, rapid, and standardized protocol for Mycobacterial DNA extraction from both clinical sputum and culture that produces DNA suitable for qPCR, and which should be considered for use in clinical diagnostics laboratories.

Introduction

Extracting high-quality DNA from M. tuberculosis is necessary for the detection of drug-resistant tuberculosis (TB) using targeted next-generation sequencing (NGS) and whole genome sequencing (WGS) but is often overlooked. We developed a standardized protocol to provide consistent, high-quality DNA for clinical NGS applications, including targeted NGS approaches like Deeplex-MycTB (GenoScreen) and whole genome sequencing, which are now recommended by the World Health Organization (WHO) for the diagnosis of drug-resistant tuberculosis. Notably, while the WHO recommends these NGS-based diagnostic strategies, it does not specify the particular DNA extraction pro....

Protocol

This study was conducted at the University of California San Francisco (UCSF) under Institutional Biosafety Committee approval (BUA #BU198320-01GBUA/BABB) and follows UCSF research ethics guidelines. We obtained remnant sputum samples collected by Discovery Life Sciences under an IRB-approved Waiver of Consent protocol from individuals with non-TB respiratory conditions.

1. Preparation of buffers

1. Custom Triton buffer (Table 1): To prepare 100 mL of custom Triton buffer, start by combining 2 mL of 5 M NaCl, 1 mL of 1 M Tris-HCl (pH 8), 1 mL of Triton X-100, and 0.2 mL of 0.5 M ethylenediaminetetr....

Results

We tested the DNA extraction protocol on both cultured M. tuberculosis and M. tuberculosis spiked sputum samples (n = 3 for each condition). Using cultured M. tuberculosis H37Rv mc² 7901, we standardized the input to 8.4 x 10⁶ cells per 50 µL, equivalent to 1 mL of a MGIT culture at 200 GU. For sputum experiments, we spiked 1 mL of sputum pooled from individuals with non-TB respiratory conditions (obtained commercially) with two different bacterial concentrations (50,000, roughly a 1.......

Discussion

In this work, we present a robust, validated protocol for extracting high-quality M. tuberculosis DNA using bead-beating with magnetic bead cleanup for downstream molecular and NGS applications.

The method offers several advantages over existing M. tuberculosis DNA extraction protocols. While traditional phenol-chloroform extraction typically takes several days and introduces hazardous chemicals, this method is completed in under 60 min with minimal hazardous waste. This appr.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
0.1 mm Zirconia-Silicate Beads	Biospec Products	11079101z	Beads used for bead-beating step to lyse mycobacterial cells
AMPure XP Beads	Beckman Coulter	A63880	Magnetic beads for DNA cleanup post-lysis
EDTA (0.5M, pH 8.0)	Thermo Fisher Scientific	AM9260G	Custom Triton/ Low EDTA Buffer Components
Fastprep 24	MPbio, USA	116004500	Equipment for bead beating at 6.5 m/s
Forward Primer	Thermo Fisher Scientific	Custom synthesis	Primer sequence: AATTCCTGGTGTAGCGGTGG
H2O (Water, molecular biology grade)	Thermo Fisher Scientific	BP2819-1	Custom Triton/ Low EDTA Buffer Components
Luna Universal Probe	New England Biolabs	M3004	qPCR reagent for Mycobacterial DNA enumeration
MycoPrep Kit	BD	SKU/REF 240863	BD MycoPrep Specimen Digestion for NALC-NaOH Sputum Processing
NaCl (Sodium Chloride, 5M solution)	Thermo Fisher Scientific	AM9759	Custom Triton/ Low EDTA Buffer Components
PBS	Millipore Sigma	P2272	Sputum Processing
Reverse Primer	Thermo Fisher Scientific	Custom synthesis	Primer sequence: GTTTACGGCGTGGACTACCA
TaqMan Probe	Thermo Fisher Scientific	Custom synthesis	Probe sequence: AGGAGGAACACCGGTGGCGA
Tris-HCl (1M, pH 8.0)	Thermo Fisher Scientific	AM9855G	Custom Triton/ Low EDTA Buffer Components
Triton X-100	Thermo Fisher Scientific	28314	Custom Triton/ Low EDTA Buffer Components