This protocol shows bead-beating combined with DNA capture bead purification provides a fast and consistent method for extracting DNA from Mycobacterium tuberculosis samples, making it an effective choice for next-generation sequencing applications.
Method Article
* These authors contributed equally
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| 0.1 mm Zirconia-Silicate Beads | Biospec Products | 11079101z | Beads used for bead-beating step to lyse mycobacterial cells |
| AMPure XP Beads | Beckman Coulter | A63880 | Magnetic beads for DNA cleanup post-lysis |
| EDTA (0.5M, pH 8.0) | Thermo Fisher Scientific | AM9260G | Custom Triton/ Low EDTA Buffer Components |
| Fastprep 24 | MPbio, USA | 116004500 | Equipment for bead beating at 6.5 m/s |
| Forward Primer | Thermo Fisher Scientific | Custom synthesis | Primer sequence: AATTCCTGGTGTAGCGGTGG |
| H2O (Water, molecular biology grade) | Thermo Fisher Scientific | BP2819-1 | Custom Triton/ Low EDTA Buffer Components |
| Luna Universal Probe | New England Biolabs | M3004 | qPCR reagent for Mycobacterial DNA enumeration |
| MycoPrep Kit | BD | SKU/REF 240863 | BD MycoPrep Specimen Digestion for NALC-NaOH Sputum Processing |
| NaCl (Sodium Chloride, 5M solution) | Thermo Fisher Scientific | AM9759 | Custom Triton/ Low EDTA Buffer Components |
| PBS | Millipore Sigma | P2272 | Sputum Processing |
| Reverse Primer | Thermo Fisher Scientific | Custom synthesis | Primer sequence: GTTTACGGCGTGGACTACCA |
| TaqMan Probe | Thermo Fisher Scientific | Custom synthesis | Probe sequence: AGGAGGAACACCGGTGGCGA |
| Tris-HCl (1M, pH 8.0) | Thermo Fisher Scientific | AM9855G | Custom Triton/ Low EDTA Buffer Components |
| Triton X-100 | Thermo Fisher Scientific | 28314 | Custom Triton/ Low EDTA Buffer Components |
Access restricted. Please log in or start a trial to view this content.
Request permission to reuse the text or figures of this JoVE article
Request Permission