This protocol outlines a fluorescence microscopy-based single-molecule DNA replication assay, enabling real-time visualization of interactions between DNA polymerases and obstacles such as G-quadruplex structures.
Method Article
This protocol outlines a fluorescence microscopy-based single-molecule DNA replication assay, enabling real-time visualization of interactions between DNA polymerases and obstacles such as G-quadruplex structures.
The ability of proteins involved in eukaryotic DNA replication to overcome obstacles — such as protein and DNA 'roadblocks' — is critical for ensuring faithful genome duplication. G-quadruplexes are higher-order nucleic acid structures that form in guanine-rich regions of DNA and have been shown to act as obstacles, interfering with genomic maintenance pathways. This study introduces a real-time, fluorescence microscopy-based method to observe DNA polymerase interactions with G-quadruplex structures. Short, primed DNA oligonucleotides containing a G-quadruplex were immobilized on functionalized glass coverslips within a microfluidic flow cell. Fluorescently labeled DNA polymerases were introduced, allowing their behavior and stoichiometry to be monitored over time. This approach enabled the observation of polymerase behavior as it was stalled by a G-quadruplex. Specifically, using fluorescently labeled yeast polymerase δ, it was found that upon encountering a G-quadruplex, the polymerase undergoes a continuous cycle of binding and unbinding. This single-molecule assay can be adapted to study interactions between various DNA-maintenance proteins and obstacles on the DNA substrate.
DNA polymerases are enzymes that catalyze the incorporation of nucleoside triphosphates to duplicate DNA1,2,3,4,5. As such, they play a key role in essential DNA maintenance processes, including DNA replication6,7,8 and repair9,10,11,12. DNA polymerases must replicate the genome accurately and efficiently to ensure genomic integrity, preventing the accumulation of mutations in the genome. During synthesis, polymerases often encounter "roadblocks" such as DNA-bound proteins or secondary DNA structures13. These roadblocks can slow or even block polymerase progression14. Overcoming these roadblocks is important to ensure faithful genome duplication, as failure to do so can lead to genomic instability15,16.
One major class of roadblocks is G-quadruplexes (G4), non-canonical secondary DNA structures that have been shown to form in guanine-rich sequences within the human genome17. There are over 700,000 different sequences in the human genome capable of forming a G4, including regions within telomeres and oncogene promoters18. These DNA structures adopt various conformations depending on the nucleotide sequence, length, and bound metal cation19,20,21. This diversity means polymerases must overcome a range of different G4 topologies, potentially with varying degrees of efficiency. Failure of polymerases to overcome or bypass a G4 structure has been shown to impede replication fork progression in vivo, leading to genomic instability22. In vitro studies have shown that G4 structures can stall or completely block yeast polymerases23,24,25,26,27. The ability of G4 structures to stall or block DNA polymerases is entirely dependent on their kinetic and thermodynamic stability, with some polymerases being able to unfold certain G4's28. While these studies provide insight into the polymerases' ability to overcome G-quadruplex roadblocks, they lack the ability to directly visualize the polymerase's behavior upon encountering a G4. The fate of the polymerases - whether they remain bound, fall off, or dynamically exchange - determines what downstream processes are accessible to resolve the G4.
In this study, a fluorescence-based single-molecule microscopy assay was developed to directly visualize and monitor DNA polymerase binding with G4 structures in real-time. This assay involves tethering G4-forming DNA templates to a biotinylated coverslip in a microfluidic flow cell, where fluorescently labeled DNA polymerases can be introduced to initiate DNA synthesis. By measuring the fluorescence of the polymerases over time, their behavior upon encountering a G4 structure can be directly observed. The G4 structure found in the c-MYC cancer oncogene was chosen for this assay due to its high level of stability. This protocol can now be adapted to catalog the behavior of a variety of polymerases across all domains of life associated with different G4 topologies and stabilities. This assay offers an innovative and high-throughput approach to elucidate the mechanisms by which DNA polymerases navigate DNA obstacles, providing a powerful tool for advancing the understanding of polymerase dynamics.
Details of the reagents and the equipment used are listed in the Table of Materials.
1. Circular dichroism spectroscopy
NOTE: Prior to developing the assay, it was necessary to conduct circular dichroism (CD) spectroscopy on the selected G4 sequence to ensure correct folding. The 22 nt sequence (5′-TGAGGGTGGGGAGGGTGGGGAA-3′) forms the G4 structure derived from the c-MYC cancer oncogene. CD spectroscopy was also performed on a control sequence (5′- TGAGTGTGAAGACGATGTAGAA -3) which has key nucleotides altered that prevent G4 formation.
2. Preparation of DNA templates
NOTE: The templates capable of being replicated are short, 100 nt primed linear templates prepared using standard molecular biology techniques. The G4-forming template (5′-GAATTACATTTAAATTTTACACAGATACAGTCAATGAGAA
CTTCCAGGCGTAACGAGAGCACGGGGTGGGAGGGGT
GGGACCTTAGCTTCGAGTTCCGAT-3′) contains the sequence capable of forming a MYC-derived G-quadruplex (from step 1) in its center. The control template (5′-GAATTACATTTAAATTTTACACAGATACAGTCAATGAGA
ACTTCCAGGCGTAACGAGAGCACGATGTAGCAGAACT
GTGACCTTAGCTTCGAGTTCCGAT-3′) has the same control region (from step 1) also in its center.
3. Labeling of DNA polymerase with AF647
4. Ensemble primer extension assay
NOTE: Before performing single-molecule replication experiments, it is necessary to confirm the DNA polymerase is blocked by the G-quadruplex via bulk replication assays.
5. Single-molecule fluorescence microscopy
For this assay, two DNA substrates with a fluorescently labeled 20-nt primer were designed: one containing a G4-forming sequence (Figure 1A, left) and one lacking this sequence (Figure 1A, right). To confirm that the G-quadruplex is an effective roadblock to polymerase activity, DNA synthesis by Pol δ was monitored on a denaturing PAGE gel. The activity of the purified labeled Pol δ on the DNA substrates was examined by gel electrophoresis. Figure 1B (left) shows that the fluorescently labeled Pol δ is unable to synthesize past the G-quadruplex. Before the initiation of synthesis (t = 0 min), a band corresponding to 20 nt is present, representing the labeled primer that has been denatured from the template strand. After 3 min, this 20-nt band was converted to a 60-nt band, indicating synthesis occurred on all DNA and confirming that the polymerase was completely blocked by the G-quadruplex structure. This blocking implies the polymerase could neither unfold nor bypass the structure. In contrast, the synthesis of a control template that does not contain the G-quadruplex-forming sequence (Figure 1A, right) produced a 100-nt band after 3 min (Figure 1B, right).
After confirming synthesis on the templates and efficient blocking by the G-quadruplex, these measurements were repeated on a single-molecule fluorescence microscope to monitor polymerase behavior. The DNA templates were tethered to functionalized coverslips (Figure 2A) in a microfluidic flow cell, and the position of each substrate was determined by visualizing the fluorescently labeled primer. Then, labeled Pol δ was loaded in the presence of dNTPs to initiate synthesis. Within a typical FOV, individual spots are tracked to quantify how often Pol δ binds and dissociates from the DNA (Figure 2B,C). By measuring the intensity as a function of time at each DNA substrate, single-molecule trajectories can be generated (Figure 2C, Supplementary Figure 3). The characteristic "dwell time", or the average duration in which Pol δ remains bound to the template, can be measured. For the G4 substrate, the dwell time was determined to be 6 s ± 2 s, while for the control substrate, it was 10 s ± 3 s (Figure 2D, Supplementary Figure 4). Additionally, for each trajectory, the number of times Pol δ binds to the template can be quantified. The number of binding events to the G4 substrate is much higher compared to the control template (Figure 2E). While there are instances of more than one binding event in the control template due to scholastic binding and unbinding, there is a clear increase in the number of binding events on average for the G4-forming template. This suggests that, after synthesis is halted by the G-quadruplex, the bound polymerase dissociates from the DNA before new polymerases from the solution engage a continuous cycle of binding and unbinding. Hence, this single-molecule assay provides unparalleled insight into how DNA polymerases respond to DNA roadblocks.

Figure 1: Ensemble primer extension assay. (A) Schematic representation of the DNA substrates. The G4 substrate (left) contains a G-quadruplex-forming sequence, whereas the control substrate (right) does not. (B) Ensemble DNA primase-extension assay of the primed G4 and control DNA substrates showing that fluorescently-labeled yeast Pol δ is fully blocked by the G-quadruplex. The PAGE gel shows the replication of the DNA templates over time, resulting in a shift of the labeled 20 nt primer into the 60-nt product for the G4 substrate (left), and the 100-nt product for the control template (right). M represents a ladder containing labeled 20 nt, 60 nt, and 100 nt oligos. Please click here to view a larger version of this figure.

Figure 2: Single-molecule fluorescence microscopy. (A) Schematic representation of the single-molecule primer extension assay using AF647-labeled yeast Pol δ. (B) Typical FOV obtained from a single-molecule assay. Each spot represents a fluorescently labeled Pol δ binding to a DNA template. Scale bar: 10 µm. (C) (Top) Example molecule from the single-molecule assay showing on/off binding as the Pol δ exchanges. (Bottom) Single-molecule trajectory of the same molecule showing the intensity over the time course of the experiment. The black line represents the Hidden Markov Model (HMM) fit to the data. (D) Dwell time of Pol δ on the G4 substrate (purple) and the control substrate (gray). The lines represent exponential fits, giving a lifetime of 6 s ± 2 s on the G4 substrate and 10 s ± 3 s on the control substrate. (E) Number of Pol δ binding events to single DNA substrates. The median number of binding events on the G4 substrate (purple) is 3.5, compared to the control substrate 1 (gray). Please click here to view a larger version of this figure.
Supplementary Figure 1:CD spectroscopy. CD spectra of the G4-forming (purple) and control sequence (gray) in TE buffer containing 200 mM of KCl at 25 °C. The characteristic peak at 260 nm, followed by the negative peak at 240 nm, is characteristic of a parallel, intramolecular GQ. Please click here to download this File.
Supplementary Figure 2: Flow cell construction. (A) Schematic of the individual pieces of the flow cell. The square PDMS block sits on top of the microscope coverslip. These pieces are then fit together inside the lid and bottom of the flow cell holder. (B) The complete flow cell. Tubes can be inserted into each side of the PDMS block to form the channels through which buffers can be flowed through the device via microfluidics. Please click here to download this File.
Supplementary Figure 3: Single-molecule trajectories. (A) Example trajectory of a molecule undergoing a single binding event during the 10 min time frame of the experiment. (B) Example trajectory of a molecule undergoing zero binding events during the 10 min time frame of the experiment. The black line in (A) and (B) represents the Hidden Markov Model (HMM) fit to the data. Please click here to download this File.
Supplementary Figure 4: Dwell times. (A) Dwell time of Pol δ on the G4 substrate. The line represents the exponential fit, giving a lifetime of 6 s ± 2 s. (B) Dwell time of Pol δ on the control substrate. The exponential fit gives a lifetime of 10 s ± 3 s. Please click here to download this File.
Supplementary Figure 5: Photobleaching control. The plot shows the average time for an individual AF647-labeled yeast Pol δ enzyme to be photobleached by the 647 nm laser. The line represents the exponential fit, giving a lifetime of 39 ± 6 s. Please click here to download this File.
Here, a single-molecule fluorescence-based assay has been described that provides insight into the behavior of a DNA polymerase as it encounters a G-quadruplex. While the protocols of DNA template generation, Pol δ labeling, and bulk DNA replication assays are all straightforward, executing single-molecule microscopy assays is more technically challenging. Due to the nature of single-molecule techniques, great care must be taken to avoid the introduction of dust, contamination, or air bubbles, as these will obscure the FOV and hamper data collection.
A limitation of single-molecule TIRF microscopy experiments is the photobleaching of the fluorophores that are covalently coupled to the biomolecules of interest. Photobleaching is an irreversible process leading to permanent fluorescence loss35. To mitigate this during experiments, it is essential to limit laser exposure duration, adjust laser intensity, and optimize imaging timing. These strategies help preserve fluorescence signals, ensuring more reliable and extended observation periods. By fine-tuning these parameters, the Pol δ signal remains for the duration of the measurement. To optimize laser power for the single-molecule fluorescence microscopy synthesis assays, it is advisable to measure the photobleaching rate by imaging the labeled polymerase on a clean glass coverslip. By systematically varying the laser power and assessing the photobleaching rate across the field of view, one can identify the optimal laser intensity that balances fluorophore signal strength with resistance to photobleaching (see Supplementary Figure 5).
The key advantage of this single-molecule approach over traditional ensemble-based methods is its ability to directly visualize when an individual DNA polymerase encounters and interacts with a G4 structure. Traditional ensemble-based methods (such as gel electrophoresis) have demonstrated the capacity for G4 structures to block DNA polymerases23,36,37. These techniques, however, fail to provide the real-time kinetic and mechanistic information of this interaction, which is necessary to disentangle different molecular kinetic steps and outcomes. Single-molecule techniques offer unparalleled insight into the kinetics, mechanisms, and behaviors of biomolecules often hidden by ensemble averaging38. It is now possible to see how DNA polymerases are acting in real-time - whether they exchange, stall, dissociate, or bypass DNA roadblocks39. With this protocol established, the identity of the G4 can easily be changed from the chosen parallel c-MYC structure to any parallel, anti-parallel, or hybrid topology. Applying this single-molecule assay will reveal whether the same DNA polymerases behave differently when encountering alternate G4 topologies. As such, single-molecule methods are vital for answering specific questions regarding how the body's proteins and DNA interact.
Through direct visualization of DNA polymerase interactions with G-quadruplexes, a previously uncharacterized exchange pathway for yeast Pol δ has been identified. This discovery suggests that the polymerase disengages upon encountering a G-quadruplex, awaiting the intervention of another protein to resolve the structure before reinitiating DNA synthesis. This protocol can be adapted to investigate interactions between various genome maintenance proteins and DNA obstacles, offering unparalleled insights into how cellular enzymes navigate genomic impediments. For example, this assay's roadblock can be altered from a G4 structure to a protein-DNA crosslink, a type of DNA lesion in which a protein is irreversibly covalently bound to DNA, acting as an obstacle for DNA replication40. Such examinations are crucial for understanding the fundamental processes of DNA replication, repair, and recombination. By enabling the study of DNA-protein dynamics at the molecular level, this assay provides a powerful tool for elucidating the mechanisms underlying genomic integrity.
The authors declare they have no competing financial interests.
N.K.-A. acknowledges the funding given by the Australian Government Research Training Program Scholarship. L.M.S. is grateful for the funding she has received from the National Health and Medical Research Council (Investigator Grant 2007778). J.S.L is grateful to be the recipient of a Discovery Early Career Award (DE240100780) and NHMRC Investigator EL1 (2025412) funded by the Australian Government. S.H.M is grateful to be the recipient of the Bruce Warren Molecular Horizons Ealy career fellowship.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| 100 nt control DNA template | Integrated DNA Technologies | Primary control template in primer extension assays | |
| 100 nt G4-forming DNA template | Integrated DNA Technologies | Primary G4-forming template in primer extension assays | |
| 15% Mini-PROTEAN TBE-Urea Gel, 12 well, 20 µL | Bio-Rad | 4566055 | Gel electrophoresis |
| 20 nt labelled/biotinylated primer oligonucleotide | Integrated DNA Technologies | Required for primer extension of the 100 nt templates | |
| 22 nt control DNA template | Integrated DNA Technologies | Primary control template in circular dichroism spectroscopy experiments | |
| 22 nt G4-forming DNA template | Integrated DNA Technologies | Primary G4-forming template in circular dichroism spectroscopy experiments | |
| 24 x 24 mm coverslip | Marienfeld Superior | 100062 | Required for TIRF microscopy |
| 3-aminopropyltriethoxysilane | Thermo Fisher Scientific | A10668.22 | Coverslip functionalization |
| 647 nm laser | Coherent | 1196627 | Select wavelength to correspond to stain/dye of choice |
| 670 nm emission filter | Chroma Technology Corp | ET655lp | Ensures only the relevant wavelengths are let through to the detector |
| Amersham Typhoon 5 biomolecular imager | Cytiva | 29187191 | Gel analysis |
| Biotin-PEG-SVA (MW 5000) | Laysan Bio | BIO-PEG-SVA-5K-100MG | Coverslip functionalization |
| Deoxynucleotides triphosphate solution mix | Jena Bioscience | NU-1005L | Replication building blocks |
| Digital dry bath (115V) | Bio-Rad | 1660571 | Heating solutions |
| Dithiothreitol | Sigma-Aldrich | 646563 | Disulfide bond reduction |
| EM-CCD camera | Andor | iXon 897 | Capturing single-molecule movies |
| Formamide | Sigma-Aldrich | F9037 | DNA denaturing during ensemble DNA replication assays |
| Gas tight syringe, 1 mL | SGE | 21964 | Filling cuvette for circular dichroism spectroscopy |
| Inverted microscope with CFI Apo TIRF 100x oil-immersion objective | Nikon | Eclipse Ti-E | Facilitates single-molecule TIRF microscopy |
| J-810 Spectrophotometer | Jasco | J-810 | Measuring circular dichroism spectroscopy |
| mPEG-SVA (MW 5000) | Laysan Bio | MPEG-SVA-5K-100MG | Coverslip functionalization |
| NanoDrop One Spectrophotometer | Thermofisher Scientific | ND-ONE | Measuring protein and label concentrations |
| NeutrAvidin | Thermo Fisher Scientific | 31000 | Tethering DNA templates to the functionalized coverslips during single-molecule experiments |
| Polyethylene tubing | Instech | BTPE-60 | Needed for flow cell construction |
| Quartz cuvette, 10 mm | Starna Scientific | 1/Q/10/CD | Holds sample for circular dichroism spectroscopy |
| Syringe pump | Adelab Scientific | NE-1002X | Used to flow buffers and substrates through a microfluidic flow cell |
| Tris-EDTA buffer | Thermofisher Scientific | 93283 | DNA solution buffer |
| Yeast polymerase δ | Michael O'Donnell Lab | Replicating the DNA templates | |
| Zeba spin desalting column, 7 K MWCO, 0.5 mL | Thermo Fisher Scientific | 89882 | Polymerase purification |
Request permission to reuse the text or figures of this JoVE article
Request Permission