RESEARCH
Peer reviewed scientific video journal
Video encyclopedia of advanced research methods
Visualizing science through experiment videos
EDUCATION
Video textbooks for undergraduate courses
Visual demonstrations of key scientific experiments
BUSINESS
Video textbooks for business education
OTHERS
Interactive video based quizzes for formative assessments
Products
RESEARCH
JoVE Journal
Peer reviewed scientific video journal
JoVE Encyclopedia of Experiments
Video encyclopedia of advanced research methods
EDUCATION
JoVE Core
Video textbooks for undergraduates
JoVE Science Education
Visual demonstrations of key scientific experiments
JoVE Lab Manual
Videos of experiments for undergraduate lab courses
BUSINESS
JoVE Business
Video textbooks for business education
Solutions
Language
English
Menu
Menu
Menu
Menu
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Research Article
Erratum Notice
Important: There has been an erratum issued for this article. View Erratum Notice
Retraction Notice
The article Assisted Selection of Biomarkers by Linear Discriminant Analysis Effect Size (LEfSe) in Microbiome Data (10.3791/61715) has been retracted by the journal upon the authors' request due to a conflict regarding the data and methodology. View Retraction Notice
By conducting both organismal and cell culture-based studies, it was demonstrated that inhibiting Raf kinase inhibitor protein (RKIP) can mitigate neuronal ferroptosis following spontaneous intracerebral hemorrhage, thereby reducing brain injury. The observed cytoprotection arises through NRF2/HO-1 signaling axis modulation.
Raf kinase inhibitor protein (RKIP), a primary member of the phosphatidylethanolamine-binding protein family, is recognized for its involvement in various physiological processes, including cell differentiation, migration, cell cycle, and apoptosis. This study explored its function in neuronal ferroptosis following spontaneous intracerebral hemorrhage (ICH) and the associated mechanisms. A cellular model of spontaneous ICH was developed using cultured rat pheochromocytoma (PC12) cells stimulated with hemin. Cell viability, RNA expression, reactive oxygen species (ROS) levels, and lipid hydroperoxide (LPO) were assessed. Additionally, protein expression levels were measured. This study confirmed that RKIP inhibition is neuroprotective in vitro following ICH. This effect was associated with increased expression of glutathione peroxidase 4 (GPX4) and decreased expression of acyl-CoA synthetase long-chain family 4 (ACSL4), along with ROS and LPO levels in neurons. RKIP inhibition demonstrated a protective role against neuronal ferroptosis in vitro following ICH, potentially via activation of the nuclear factor E2-related factor 2/heme oxygenase-1 (NRF2/HO-1) pathway. This mechanism may offer insights into therapeutic strategies targeting neuronal ferroptosis in ICH.
Spontaneous intracerebral hemorrhage (ICH) is a cerebrovascular condition characterized by bleeding due to intracranial vascular damage, necrosis, and vessel rupture, commonly affecting the basal ganglia and representing a major subtype of hemorrhagic stroke1. The mortality rate among patients diagnosed with ICH is approximately 50%, and a significant proportion of survivors experience severe loss of independence2. Current treatment options for spontaneous ICH are limited, with no existing therapies shown to significantly reduce mortality or markedly enhance neurological outcomes post-ICH.
Ferroptosis, an iron-dependent form of programmed cell death, is defined by lipid peroxidation, accumulation of ferrous ions, and depletion of glutathione, distinguishing it from other forms of programmed cell death in genetic, morphological, and biological terms3. Increasing evidence highlights the role of neuronal ferroptosis in the pathology of ICH. Raf kinase inhibitor protein (RKIP), also known as phosphatidylethanolamine-binding protein 1 (PEBP1), is involved in neural development and forms the 15LOX/PEBP1 complex through its binding with 15-lipoxygenase (15LOX), a key regulator of ferroptosis4. However, the specific role and mechanisms of RKIP in ferroptosis linked to the progression of spontaneous ICH remain unexplored.
This study examined the anti-ferroptosis effects of RKIP inhibition on neurons, demonstrating that inhibition of RKIP expression could suppress neuronal ferroptosis following ICH, potentially through activation of the nuclear factor E2-related factor 2/heme oxygenase-1 (NRF2/HO-1) pathway. These findings are significant for the development of novel therapeutic strategies targeting the pathogenesis of ICH.
Culture of PC12 cells
The PC12 cell line was propagated in Roswell Park Memorial Institute 1640 (RPMI-1640) growth medium containing 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin, with routine maintenance under standard culture conditions (37 °C, 5% CO2 humidified atmosphere). For experimental procedures, adherent cells were plated onto culture vessels and allowed to proliferate until achieving near-confluent monolayers (approximately 90% surface coverage). Cellular dissociation was accomplished through enzymatic treatment using 0.25% trypsin-EDTA solution, followed by three successive subculturing cycles to ensure population stability. Processed cells were subsequently allocated for downstream experimental applications and analytical assessments.
Cell viability assays
Cell viability was assessed to evaluate the cytotoxicity of hemin and Locostatin on PC12 cells, following the instructions provided by the assay kit's manufacturer. PC12 cells were uniformly seeded in 96-well plates and cultured with hemin or Locostatin for 24 h. Following washing with phosphate-buffered saline (PBS), the cells were incubated in RPMI-1640 medium containing 10% tetrazolium salt solution for 90 min at 37 °C. Optical Density (OD) values were then measured at 450 nm using a microplate reader.
Quantitative reverse transcription-polymerase chain reaction (RT-qPCR)
Total RNA was extracted from PC12 cells using the RNA extraction reagent. First, the sample was homogenized in the extraction reagent, ensuring thorough lysis. Chloroform was added to the mixture, shaken vigorously, and centrifuged to separate the phases (12,000 × g, 15 min, 4 °C). The aqueous phase containing the RNA was collected, and the RNA was precipitated by adding isopropanol (aqueous phase : iPrOH = 1:1) and incubating at room temperature. Centrifugation was done to pellet the RNA (12,000 × g, 10 min, 4 °C), 1 mL of 70% ethanol was added to remove impurities, and finally, the RNA pellet was dissolved in RNase-free water for storage at -80 °C. Complementary DNA (cDNA) templates were generated by reverse transcription with the RT Master Mix. The resulting templates were then diluted at a 1:5 ratio and subjected to quantitative real-time PCR on a real-time PCR instrument. Each sample was amplified in triplicate, and the relative amount of PCR product was averaged. The primers used are listed in Table 1, with β-actin serving as the housekeeping gene. Relative mRNA concentration was determined using the formula E = 2−ΔΔCt, and the Critical Threshold Cycle (CT) Value was recorded for each reaction.
Intracellular reactive oxygen species (ROS) and lipid hydroperoxide (LPO) assays
ROS and LPO levels were measured using flow cytometry. PC12 cells were treated with hemin (80 µM), Locostatin (5 µM), and ML385 (5 µM) for 24 h and washed 3x with PBS in dishes. The cells were then incubated at 37 °C with 5% CO2 for 40 min in the presence of 2',7'-dichlorodihydrofluorescein diacetate (DCFH-DA), a ROS probe, and BODIPY 581/591 C11, an LPO probe. Following PBS washes to remove excess probes, fluorescence intensity was measured by flow cytometry. A consistent gating strategy was applied across all samples: first, cells were gated on FSC-A vs. SSC-A to exclude debris, then, single cells were selected by FSC-A vs. FSC-H gating. Unstained cells and cells treated with hemin alone were used as negative and positive controls to establish the fluorescence compensation and gates. Data were analyzed using the linked software.
Protein extraction and western blot
Total protein extraction
The supernatant of treated PC12 cells was discarded, followed by three washes with ice-cold PBS. Cells were harvested using trypsin and centrifuged at 200 × g for 5 min. After removing the supernatant, the cell pellet was homogenized in cold Radio-Immunoprecipitation Assay (RIPA) lysis buffer containing 10% protease inhibitor and 10% phosphatase inhibitor. After a 30 min incubation on ice, the lysate was centrifuged at 12,000 × g for 15 min at 4 °C. The clear supernatant was mixed with Loading Buffer (4:1) and heated at 95 °C for 5 min to denature proteins. Protein samples were stored at -80 °C for subsequent use.
Western blot analysis
Proteins were separated by SDS-PAGE using a stacking gel and resolving gel, with samples loaded into wells. Electrophoresis was performed at 80 V for the stacking gel and 120 V for the resolving gel. Proteins were transferred onto a polyvinylidene fluoride (PVDF) membrane (pre-activated in methanol for 1 min) using a transfer system at a constant current of 300 mA for 1-2 h. The membrane was blocked with 5% skim milk in TBST for 2 h at room temperature to prevent nonspecific binding. After three washes with TBST (10 min each), the membrane was incubated overnight at 4 °C with the following primary antibodies diluted in TBST: Rabbit anti-ACSL4 (1:1,000), Rabbit anti-GPX4 (1:1,000), Rabbit anti-HO-1 (1:2,000), Rabbit anti-NRF2 (1:1,000), Rabbit anti-RKIP (1:1,500), and Mouse anti-β-actin (1:5,000). The membrane was washed for 3 x 10 min with TBST and incubated with HRP-conjugated secondary antibodies for 2 h at room temperature: HRP-labeled Goat Anti-Mouse IgG (1:1,000), HRP-labeled Goat Anti-Rabbit IgG (1:1,000). After additional TBST washes for 3 x 5 min, protein signals were visualized using an ECL Western Blot Kit and quantified using ImageJ software.
Immunofluorescence staining
Cells were seeded onto coverslips pre-placed in culture plates and allowed to adhere. After experimental treatments, the supernatant was discarded, and cells were washed 3x with PBS. Cells were fixed with 4% paraformaldehyde (PFA) for 15 min at room temperature, followed by three PBS washes. Subsequently, cells were permeabilized with 0.1% Triton X-100 for 10 min at room temperature and washed 3x with PBS. Nonspecific binding was blocked by incubating with 3% bovine serum albumin (BSA) for 30 min at room temperature. Primary antibodies were applied overnight at 4 °C: Rabbit anti-HO-1 (1:500), Rabbit anti-NRF2 (1:500). After three PBS washes the next day, cells were incubated with fluorescent secondary antibodies in the dark for 1 h at room temperature: Alexa Fluor 488-labeled Goat Anti-Rabbit IgG (1:500). Following the final washes, the samples were mounted with mounting medium containing 4',6-diamidino-2'-phenylindole (DAPI) for nuclear counterstaining. Images were captured using a confocal laser scanning microscope.
Statistical analysis
Measurement data were expressed as mean ± standard deviation (S.D.). Quantitative data representing results from three independent replicate assays were taken for analysis. For comparisons between two groups, a t-test was applied, while a one-way analysis of variance (ANOVA) was used for comparisons among multiple groups, followed by Tukey's post hoc test for multiple comparisons. A p-value < 0.05 was considered statistically significant.
Hemin can induce plasma membrane damage, thus it is frequently used for the construction of in vitro cell models of ICH. This study investigated the effects of hemin treatment at varying concentrations and durations on PC12 cell viability, while simultaneously analyzing RKIP protein expression dynamics under corresponding experimental conditions through western blot analysis (Figure 1A). Cell viability was significantly reduced at hemin concentrations of 60 µM or higher (Figure 1B), and this reduction occurred in a dose-dependent manner with increasing concentrations. Furthermore, hemin cytotoxicity was time-dependent, peaking within the first 24 h of exposure before gradually declining (Figure 1C). Western blot analysis indicated that RKIP protein expression was significantly elevated at 80 µM hemin (Figure 1D,E) and reached its peak at 24 h post stimulation (Figure 1F,G). Based on these findings, we chose 80 µM hemin and a 24 h treatment period for subsequent experiments to elucidate the underlying mechanisms and signaling pathways involved.
To investigate RKIP's role in neuronal ferroptosis following ICH, we used Locostatin to inhibit RKIP expression (Figure 2A). Locostatin binds to RKIP, disrupts the interactions between RKIP and both Raf-1 kinase and GRK2, thereby attenuating the functional effects of RKIP to achieve the inhibitory purpose. In this study, we employed Locostatin as an RKIP inhibitor to investigate the associated molecular mechanisms5,6. Locostatin's cytotoxicity was first assessed across a concentration range of 0-40 µM using the viability assay. The results showed no significant cytotoxicity at ≤5 µM, establishing a safe concentration range for subsequent experiments (Figure 2B). We further confirmed the inhibitory effect of 5 µM Locostatin on RKIP expression using western blotting and RT-qPCR analyses. Western blot revealed a significant decrease in RKIP protein levels (Figure 2C,D), while RT-qPCR showed decreased RKIP mRNA levels (Figure 2E). These findings demonstrate the efficacy of 5 µM Locostatin in inhibiting RKIP expression.
In this study, a hemin-induced PC12 cell model of intracerebral hemorrhage (ICH) was developed to delineate RKIP's regulatory function in ferroptosis. Our results indicated that hemin stimulation significantly increased RKIP expression while decreasing cell viability. Based on existing studies, we speculated that hemin-induced cell death might be closely related to ferroptosis, an iron-catalyzed lipid peroxidation process marked by pathological iron deposition within cellular compartments and elevated levels of reactive oxygen species (ROS).
To further explore the relationship between RKIP and ferroptosis, we treated hemin-stimulated PC12 cells with Locostatin. Western blot analysis revealed that the expression of acyl-CoA synthetase long-chain family 4 (ACSL4), a key driver of ferroptosis, was significantly increased in the hemin-treated group (Figure 3A,B). ACSL4 is a critical pro-death gene in ferroptosis, promoting the esterification of polyunsaturated fatty acids (PUFAs) and thereby increasing cellular sensitivity to ferroptosis. Additionally, the expression of glutathione peroxidase 4 (GPX4), a ferroptosis inhibitor, was significantly decreased in the hemin-treated group (Figure 3A,C). GPX4 is a key regulator of ferroptosis that inhibits lipid peroxidation by scavenging lipid peroxides, thereby protecting cells from oxidative damage. These results indicate that hemin stimulation increases ferroptosis in PC12 cells. However, compared to the hemin group, pharmacological inhibition of RKIP with Locostatin reversed these alterations, indicating that suppression of RKIP expression inhibited ferroptosis in PC12 cells. Consistent results were also observed at the mRNA level (Figure 3 F,G).
We also investigated the expression of ferroptosis-related pathway molecules. The NRF2/HO-1 pathway has been shown to play a key role in ferroptosis. Based on this, we hypothesized that RKIP inhibition might suppress neuronal ferroptosis by activating the NRF2/HO-1 pathway. To test this hypothesis, we first stimulated PC12 cells with hemin and found that the expression of NRF2 protein was significantly increased (Figure 3A,D), along with a significant increase in its downstream product HO-1 (Figure 3A,E). These findings suggest that hemin-induced ferroptosis activates the NRF2/HO-1 pathway, which exerts a protective effect on cells. As a major regulator of cellular antioxidant responses, NRF2 enhances cellular antioxidant capacity by regulating the expression of downstream target genes such as HO-1, thereby inhibiting ferroptosis. Subsequently, treatment of Locostatin further increased the expression of HO-1 and NRF2 compared to the hemin-treated group (Figure 3A,D). Consistent results were also observed at the mRNA level (Figure 3I,J), further confirming that the inhibition of RKIP suppresses ferroptosis in hemin-stimulated PC12 cells by modulating NRF2 and its downstream molecule HO-1.
Notably, another ferroptosis inhibitor, ferritin heavy chain 1 (FTH1), showed increased expression upon hemin stimulation, and its expression was further elevated when RKIP was inhibited (Figure 3H). FTH1 is a major component of ferritin, responsible for iron storage and oxidation. It converts iron ions into a more stable form, reducing free iron-induced oxidative stress. The upregulation of FTH1 upon hemin stimulation may represent a compensatory response to iron overload, as cells attempt to store excess iron to avoid oxidative damage. The further increase in FTH1 expression upon Locostatin treatment suggests reduced free iron levels and enhanced antioxidant capacity, reinforcing the conclusion that RKIP inhibition suppresses hemin-induced ferroptosis in PC12 cells.
ROS and lipid hydroperoxide (LPO) levels in PC12 cells were assessed via flow cytometry. Hemin treatment led to a significant increase in ROS and LPO levels, which was reversed following Locostatin administration. This finding indicates that inhibiting RKIP may help suppress ferroptosis in neurons (Figure 4A-D).
In summary, hemin-induced dose and time-dependent reductions in PC12 cell viability, concomitant with a marked increase in RKIP protein levels. This process was associated with elevated levels of ACSL4 and suppressed expression of GPX4. Concurrently, a significant accumulation of oxidative damage markers (ROS and LPO) was observed, with both serving as core drivers of ferroptosis by mediating oxidative stress and lipid membrane disruption. Furthermore, upregulation of the iron-storage protein FTH1 suggested a compensatory cellular response to iron overload. Critically, pharmacological inhibition of RKIP by Locostatin reversed these alterations and abrogated hemin-induced ferroptosis (Figure 1, Figure 2, Figure 3, and Figure 4).
The results from the assays indicated that inhibiting RKIP effectively suppressed neuronal ferroptosis and regulated NRF2/HO-1 expression. Given that the NRF2/HO-1 pathway plays a key role in ferroptosis, it was hypothesized that the suppression of neuronal ferroptosis observed with RKIP inhibition might be mediated through stimulation of this pathway. To test this hypothesis, further experiments were conducted (Figure 5A).
ML385, a selective NRF2 inhibitor, was used, and results confirmed that NRF2 expression was effectively reduced at both protein (Figure 5B,C) and mRNA levels (Figure 5E). Additionally, the expression of HO-1, a downstream molecule of NRF2, was assessed. Findings indicated that while RKIP inhibition initially increased HO-1 expression, this effect was reversed following NRF2 inhibition (Figure 5B,D,F). These results suggest that RKIP inhibition may attenuate neuronal ferroptosis by activating the NRF2/HO-1 pathway. Immunofluorescence staining further supported these findings, as nuclear translocation of NRF2 was observed following RKIP inhibition (Figure 5G-J).
Subsequently, we further assessed the levels of ROS and LPO in PC12 cells using flow cytometry. We found that inhibition of NRF2 with ML385 reversed the Locostatin-induced reduction in ROS and LPO levels. These findings suggest that RKIP suppression may inhibit neuronal ferroptosis by activating the NRF2/HO-1 pathway (Figure 6A-D).
DATA AVAILABILITY:
The datasets generated during the current study are included in Supplemental File 1.

Figure 1: Construction of an in vitro disease model by hemin-stimulated PC12 cells. (A) Schematic illustration of the construction of the hemin-stimulated PC12 cell model. (B) Determination of optimal hemin concentration for in vitro intracerebral hemorrhage model establishment using the cell viability assay to assess cellular viability. (C) Cell viability assay with PC12 cells treated with hemin (80 µM) for various time points. (D,E) Representative western blot analysis and quantitative evaluation of RKIP expression levels in PC12 cells treated with different hemin concentrations (24 h). (F,G) Representative western blot analysis and quantitative evaluation of RKIP expression levels in PC12 cells exposed to hemin (80 µM) for varying durations. All data are presented as mean ± SD (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001. Abbreviations: CCK8 = Cell Counting Kit-8; WB = western blot; RKIP = Raf kinase inhibitor protein. Please click here to view a larger version of this figure.

Figure 2: Effect of Locostatin on RKIP expression in PC12 cells stimulated with hemin. (A) Schematic illustration of the experimental procedure for Locostatin treatment in PC12 cells. (B) Cell viability of PC12 cells treated with different concentrations of Locostatin was assessed using the cell viability assay. (C,D) Expression of RKIP in PC12 cells treated with hemin (80 µM,24 h) and/or locostatin (5 µM,24 h) was analyzed by western blot, with representative blots and statistical analysis shown. (E) RKIP mRNA expression in PC12 cells treated with hemin (80 µM,24 h) and/or Locostatin (5 µM,24 h) was measured using RT-qPCR. All data are presented as mean ± SD (n=3). *p < 0.05, **p < 0.01, ***p < 0.001. Abbreviations: CCK8 = Cell Counting Kit-8; WB = western blot; RT-qPCR = Quantitative Reverse Transcription-Polymerase Chain Reaction; ROS = Reactive oxygen species; LPO = lipid peroxidation. Please click here to view a larger version of this figure.

Figure 3: Effect of RKIP inhibition on ferroptosis in PC12 cells following hemin stimulation. (A-E) Western blot analysis of protein expression changes in ACSL4, GPX4, NRF2, and HO-1 in PC12 cells treated with hemin (80 µM,24 h) and/or Locostatin (5 µM,24 h). (F-J) RT-qPCR analysis of mRNA expression levels of ACSL4, GPX4, NRF2, HO-1, and FTH1 in PC12 cells treated with hemin (80 µM,24 h) and/or Locostatin (5 µM,24 h). All data are presented as mean ± SD (n=3). *p < 0.05, **p < 0.01, ***p < 0.001. Abbreviations: WB = western blot; RT-qPCR = Quantitative Reverse Transcription-Polymerase Chain Reaction; RKIP = Raf kinase inhibitor protein; ACSL4 = Acyl-CoA synthetase long-chain family 4; GPX4 = Glutathione peroxidase 4; NRF2 = Nuclear factor E2-related factor 2; HO-1 = Heme oxygenase-1; FTH1 = Ferritin heavy chain 1. Please click here to view a larger version of this figure.

Figure 4: Effect of RKIP inhibition on oxidative stress in PC12 cells following hemin stimulation. (A,C) Flow cytometry analysis of reactive oxygen species production in PC12 cells treated with hemin (80 µM,24 h) and/or Locostatin (5 µM,24 h). (B,D) Flow cytometry analysis of lipid peroxidation in PC12 cells treated with hemin (80 µM,24 h) and/or Locostatin (5 µM,24 h). All data are presented as mean ± SD (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001. Abbreviations: ROS = Reactive oxygen species; LPO = lipid peroxidation. Please click here to view a larger version of this figure.

Figure 5: The role of NRF2 in anti-ferroptotic effects mediated by RKIP inhibition. (A) Schematic illustration of the experimental procedure for treating PC12 cells under different conditions. (B-D) Western blot analysis of protein expression changes in NRF2 and HO-1 under different treatment conditions in PC12 cells with hemin (80 µM, 24 h) and/or Locostatin (5 µM,24 h) and/or ML385 (5 µM, 24 h). (E,F) RT-qPCR analysis of mRNA expression levels of NRF2 and HO-1 in PC12 cells treated with hemin (80 µM, 24 h) and/or Locostatin (5 µM, 24 h) and/or ML385 (5 µM, 24 h). (G-J) Immunofluorescence analysis of NRF2 and HO-1 expression and quantification of mean fluorescence intensity in PC12 cells treated with hemin (80 µM, 24 h) and/or Locostatin (5 µM, 24 h) and/or ML385 (5 µM, 24 h). Scale bars= 50 µm. All data are presented as mean ± SD (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001. Abbreviations: WB = western blot; RT-qPCR = Quantitative Reverse Transcription-Polymerase Chain Reaction; IF staining = Immunofluorescence staining; NRF2 = Nuclear factor E2-related factor 2; HO-1 = Heme oxygenase-1. Please click here to view a larger version of this figure.

Figure 6: The role of NRF2 in suppression of oxidative stress mediated by RKIP inhibition. (A,C) Flow cytometry analysis of reactive oxygen species production in PC12 cells with hemin (80 µM, 24 h) and/or Locostatin (5 µM, 24 h) and/or ML385 (5 µM, 24 h). (B,D) Flow cytometry analysis of lipid peroxidation in PC12 cells treated with hemin (80 µM,24 h) and/or Locostatin (5 µM, 24 h) and/or ML385 (5 µM, 24 h). All data are presented as mean ± SD (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001. Abbreviations: ROS = Reactive oxygen species; LPO = lipid peroxidation. Please click here to view a larger version of this figure.

Figure 7: Schematic representation of RKIP inhibition attenuating neuronal ferroptosis following spontaneous ICH by activating the NRF2/HO-1 pathway. Our findings demonstrate that RKIP inhibition effectively promotes NRF2 nuclear translocation, suppresses lipid ROS accumulation, and consequently protects against hemin-induced ferroptosis and oxidative stress. Please click here to view a larger version of this figure.
| Gene | Forward primer (5′-3′) | Reverse primer (5′-3′) |
| RKIP | AGCAGTGGCACAGTCCTC | TGGTCTCCAGATCGGTTG |
| ACSL4 | CCCTTGGCAAAGAAGCTG | CTCGGGGTACTCCGCTCTAT |
| GPX4 | AGATCCACGAATGTCCCAAG | CCTCCTCCTTAAACGCACAC |
| NRF2 | CAACTCCAGAAGGAACAGG | TTGGGAATGTGGGCAACC |
| HO-1 | GCACTGCTGACAGAGGAACA | GTCGCCAACAGGAAACTGAG |
| FTH1 | TAAAGAAACCAGACCGTGATGACT | TGCAGTTCCAGTAGTGACTGATTC |
| β-actin | GCTTCTAGGCGGACTGTTAC | CCATGCCAATGTTGTCTCTCTT |
Table 1: Primers for quantitative reverse transcription-PCR.
Supplemental File 1: Raw and processed quantitative data supporting the first six figures, including CCK-8 assays, Western blot, RT-qPCR, and flow cytometry analyses. Data are organized by figure subpanels and include all replicate values used for statistical analyses. Please click here to download this file.
This study investigated the effects and underlying mechanisms of RKIP knockdown on ferroptosis induced by ICH in an in vitro setting. Stimulation of cells with hemin triggers oxidative stress, accompanied by excessive generation of ROS and LPO, thereby promoting ferroptosis. Inhibition of endogenous RKIP expression accelerates the liberated NRF2 to translocate into the nucleus and bind to the Antioxidant Response Element (ARE), initiating the transcription of downstream antioxidant genes. HO-1, a key enzyme in heme metabolism and one of the downstream targets of NRF2, exerts potent antioxidative effects. This pathway mitigates ferroptosis and oxidative damage while maintaining tissue homeostasis (Figure 7). These findings indicate that RKIP could serve as a potential therapeutic target in the treatment of ICH.
Following ICH injury, lysed red blood cells release hemoglobin, which degrades into hemin. Hemin is subsequently broken down by HO-1 into iron ions, promoting the Fenton reaction that generates free radicals capable of damaging lipids, proteins, and DNA through oxidative stress7,8,9,10. The hemin-treated PC12 cell model is widely regarded as a classical experimental model for simulating the neuronal damage observed in human ICH11. In this study, hemin treatment significantly decreased PC12 cell viability. Additionally, ferroptosis markers were detected in hemin-treated PC12 cells. These findings underscore the therapeutic potential of targeting ferroptosis in ICH treatment.
Ferroptosis is a distinct form of programmed cell death dependent on iron and lipid peroxidation. First described in 2012 in cancer cells with RAS mutations, ferroptosis is characterized morphologically by necrotic features, including small, dysmorphic mitochondria with reduced cristae, condensed membranes, and outer mitochondrial membrane rupture12. NRF2, a master regulator of intracellular antioxidant responses, confers cellular protection against oxidative stress by orchestrating the expression of antioxidant genes, crucially mitigating lipid peroxidation and ferroptosis13,14,15. Kelch Like ECH Associated Protein 1 (KEAP1), the primary negative regulator of NRF2, binds and sequesters NRF2 in the cytoplasm under homeostatic conditions, thereby suppressing its nuclear translocation. Under oxidative stress, KEAP1-NRF2 dissociation facilitates NRF2 nuclear import, where it binds to the ARE to transcriptionally activate downstream effectors such as HO-1, thereby counteracting oxidative damage16,17,18,19. Notably, numerous proteins and enzymes that inhibit lipid peroxidation and prevent ferroptosis are NRF2 target genes. These proteins and enzymes can be classified into three major functional categories: iron metabolism, intermediate metabolism, and glutathione biosynthesis and metabolism13. They catalyze the catabolism of heme into biliverdin, carbon monoxide, and iron, thereby exerting antioxidant effects20. Among these targets, HO-1 has been shown to directly suppress cystine uptake, block glutathione (GSH) synthesis, and promote the accumulation of Phospholipid hydroperoxides (PLOOHs). This cascade leads to rapid and irreversible damage to cellular membranes and ultimately triggers ferroptosis21. Pharmacological modulation of NRF2 to regulate lipid peroxidation and ferroptosis has emerged as a promising therapeutic strategy. For instance, Jiang et al. demonstrated that gastrodin attenuates glutamate-induced ferroptosis in hippocampal neurons through NRF2/HO-1 pathway activation22. Similarly, Gong et al. revealed that trehalose inhibits ferroptosis and enhances functional recovery in murine spinal cord injury models via NRF2/HO-1 signaling23. Furthermore, Luo et al. identified astaxanthin as a potent suppressor of ferroptosis in LPS-induced acute lung injury, mediated by the KEAP1-NRF2/HO-1 axis24. These collective findings unequivocally establish the NRF2/HO-1 signaling pathway as a central mechanistic node in ferroptosis regulation.
Current research on RKIP in the nervous system has primarily focused on its role in modulating the expression of Extracellular regulated protein kinases (ERK), nuclear factor kappa-B (NF-κB), and the NOD-like receptor thermal protein domain-associated protein 3 (NLRP3) inflammasome to suppress neuroinflammation, pyroptosis, and apoptosis, thereby protecting damaged neural cells. However, its involvement in ferroptosis remains poorly explored. Emerging evidence suggests that RKIP is highly expressed in the brain25 and that its overexpression in neurological disorders such as traumatic brain injury4 and sepsis-associated encephalopathy26 may induce ferroptosis. This mechanism is predominantly linked to the formation of the PEBP1/15LOX complex, wherein PEBP1 binds to 15LOX to form the 15LOX/PEBP1 complex. It catalyzes lipid peroxidation, thereby exacerbating ferroptosis27. Our findings demonstrate that RKIP promotes oxidative stress, and its inhibition suppresses ferroptosis, which aligns with previous studies25,26. Prior research has primarily focused on the impact of the PEBP1-15LOX interaction on ferroptosis, whereas this study investigates the regulatory network of RKIP in ferroptosis-related pathways. We provide evidence that RKIP inhibition suppresses neuronal ferroptosis after ICH by activating NRF2. Notably, studies have reported that RKIP inhibition activates NRF2 and NAD(P)H quinone dehydrogenase 1 (NQO1) to promote radioresistance in nasopharyngeal carcinoma28. Furthermore, RKIP knockdown in colon cancer cell lines is significantly associated with KEAP1 protein degradation and subsequent NRF2 activation29. These findings collectively highlight the functional correlation between RKIP and NRF2 signaling.
This study, however, presents some limitations. First, the analysis was restricted to in vitro assays, focusing solely on the effects of RKIP inhibition on ferroptosis. To gain a comprehensive understanding, in vivo experiments are needed to validate these findings. Notably, this study demonstrates that hemin treatment increases RKIP expression while activating the NRF2/HO-1 pathway. Paradoxically, inhibition of RKIP through Locostatin further enhances NRF2/HO-1 activation. We speculate that hemin may simultaneously trigger oxidative stress to activate the NRF2/HO-1 pathway and induce RKIP expression, which exerts an inhibitory effect on NRF2/HO-1 activity, with the former effect outweighing the latter. The Locostatin-mediated RKIP inhibition potentially alleviates this suppressive effect, thereby amplifying pathway activation. However, further investigations are necessary to validate this hypothesis and elucidate the precise regulatory mechanisms involved. Second, although this study clearly demonstrates that RKIP inhibition suppresses neuronal ferroptosis by upregulating NRF2, the intricate regulatory network involving RKIP and other closely associated factors remains incompletely understood. For instance, while the inhibition of RKIP and NRF2 in our experiments utilized specific inhibitors (Locostatin and ML385), future studies should incorporate genetic knockout models of RKIP and NRF2 to strengthen mechanistic validation, complemented by rescue experiments with molecule overexpression. Furthermore, this study did not employ canonical ferroptosis inhibitors. Subsequent investigations should incorporate agents such as ferrostatin-1 or deferoxamine to provide more critical confirmation of ferroptosis involvement. Additionally, evaluating whether RKIP modulation influences the efficacy of these inhibitors would help clarify its mechanistic role in the regulation of ferroptosis. Moreover, the precise regulatory mechanism between RKIP and NRF2 remains ambiguous. Co-Immunoprecipitation (Co-IP) experiments could clarify whether RKIP directly interacts with NRF2. Specifically, it remains unclear whether RKIP directly modifies key NRF2 residues to alter its activity and downstream antioxidant gene expression, thereby suppressing ferroptosis, or indirectly regulates NRF2 via intermediaries. For example, RKIP inhibition may reduce miR-450b-5p levels, subsequently upregulating and activating NRF228. Similarly, KEAP1, the primary negative regulator of NRF2, suppresses its transcriptional activity under physiological conditions. However, whether RKIP directly modulates KEAP1 structure or functions to alter KEAP1-NRF2 binding and indirectly regulate NRF2 activity remains unresolved. Notably, the RKIP/15LOX complex has been widely implicated in ferroptosis regulation. Whether RKIP influences NRF2 expression through this complex warrants further investigation. Additionally, RKIP-mediated inhibition of NF-κB signaling has been reported. For example, Zuo et al. demonstrated that RKIP-dependent NF-κB regulation contributes to the amelioration of AD in rats exposed to Extremely Low-Frequency Magnetic Field (ELF-MF)30. Similarly, RKIP overexpression enhances cisplatin sensitivity in gastric cancer cells, likely via NF-κB suppression31. Intriguingly, crosstalk exists between NF-κB and NRF2 pathways: NRF2 activation stabilizes Inhibitor of κB-α (IκB-α) to inhibit NF-κB-mediated transcription, while NF-κB suppresses NRF2 by reducing ARE-driven transcription32,33. This raises the possibility that RKIP may enhance NRF2 activation by suppressing NF-κB signaling, thereby increasing ARE transcription. Collectively, these unresolved questions highlight the need for further studies to elucidate RKIP's multifaceted regulatory roles in ferroptosis and oxidative stress pathways.
RKIP, initially investigated as an endogenous tumor suppressor, has since been implicated in pyroptosis, inflammation, and ferroptosis. Within the context of ferroptosis, most RKIP-related studies have concentrated on its interaction within the 15LOX/PEBP1 complex, while other potential mechanisms remain to be examined. In this study, hemin was used to induce ferroptosis in PC12 cells, creating an in vitro model of spontaneous ICH. Results confirmed the occurrence of neuronal ferroptosis under these conditions. Pretreatment with Locostatin, a specific RKIP inhibitor, resulted in decreased expression of RKIP, ACSL4, LPO, and lipid ROS, while upregulating NRF2, HO-1, and GPX4 levels. Following NRF2 inhibition through the NRF2-specific inhibitor ML385, the effects were reversed. These findings support the hypothesis that RKIP knockdown may inhibit neuronal ferroptosis post-spontaneous ICH by activating the NRF2/HO-1 pathway.
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
This study was supported by grants from the Nantong Municipal Health Commission Project (MS2022015) and the Nantong Science and Technology Bureau Project (JCZ2023022).
| Alexa Fluor 488-labeled Goat Anti-Rabbit IgG | Beyotime Biotech | A0423 | |
| Anti-ACSL4 antibody | Cell signaling | 38493T | |
| Anti-GPX4 antibody | Cell signaling | 59735S | |
| Anti-HO-1 antibody | MedChemExpress | HY-P80499 | |
| Anti-NRF2 antibody | Cell signaling | 12721T | |
| Anti-RKIP antibody | Abcam | ab76582 | |
| Anti-β-actin antibody | Abcam | ab179467 | |
| BeyoECL Plus | Beyotime Biotech | P0018M | |
| BSA | NCM Biotech | WB6504-100g | |
| Cell Counting Kit-8 | Beyotime Biotech | C0037 | |
| CELLSAVING | NCM Biotech | C40050 | |
| ChamQ SYBR Color qPCR Master Mix | Vazyme | Q411-02 | |
| DMSO | Beyotime Biotech | ST038 | |
| Fetal Bovine Serum | Gibco | A5670801 | |
| GraphPad Prism | |||
| Hemin | MedChemExpress | HY-19424 | |
| HiScript Q RT SuperMix for qPCR (+gDNA wiper) | Vazyme | R123-01 | |
| HRP-labeled Goat Anti-Mouse IgG | Thermo | C31430100 | |
| HRP-labeled Goat Anti-Rabbit IgG | Thermo | C31460100 | |
| Lipid Peroxide (LPO) Content Assay Kit | Solarbio | BC5245 | |
| Locostatin | MedChemExpress | HY-W013411A | |
| ML385 | MedChemExpress | HY-100523 | |
| Mounting Medium?antifading (with DAPI) | Solarbio | S2110 | |
| NON-FatPowderedMilk | Solarbio | D8340 | |
| PBS (powder?pH7.2-7.4) | Solarbio | P1010 | |
| PC-12Adh | Nanjing BioChannel Biotechnology | BC-C-RA-005 | |
| Penicillin-Streptomycin Liquid | Solarbio | P1400 | |
| PRMI-1640 | Gibco | A1049101 | |
| Protease and phosphatase inhibitor cocktail for general use, 50x | Beyotime Biotech | P1045 | |
| Protein Marker | Thermo | 26617 | |
| PVDF | Millipore | RIKB43638 | |
| Reactive Oxygen Species Assay Kit | Solarbio | CA1410 | |
| RIPA buffer (high) | Solarbio | R0010 | |
| SDS-PAGE Gel Quick Preparation Kit | Epizyme | PG110 | |
| SDS-PAGE Sample Loading Buffer, 5x | Beyotime Biotech | P0015 | |
| TritonX-100 | Solarbio | IT9100 | |
| TRIzol | Thermo | 15596018CN | |
| Trypsin-EDTA solution?0.25% (without phenol red) | Solarbio | T1300 |