Potential Role of the PGE2-EP4-Ca2+ Signaling Axis in Post-Traumatic Osteoarthritis

Summary

Here, we present a protocol to systematically outline the establishment and evaluation methods of osteoarthritis rat models, through comparison, providing scientific evidence for the differing pathogenesis between acute mechanical injury-induced and chronic metabolic/environmental factor-induced osteoarthritis. The ACLT model is the main focus, emphasizing changes in the EP4-Ca²⁺-mitochondrial dysfunction signaling pathway.

Abstract

Post-traumatic osteoarthritis (PTOA) is a degenerative joint disease triggered by trauma or intense mechanical stress, leading to joint cartilage degeneration and functional impairment. Prostaglandin E2 (PGE₂) contributes significantly to cartilage degradation following mechanical injury by activating its receptor, Prostaglandin E receptor 4 (EP4), on chondrocyte membranes. The homeostasis of articular cartilage primarily relies on the dynamic balance between cartilage degradation and repair, a process finely regulated by chondrocytes. The Ca²⁺/Calmodulin-dependent Protein Kinase II (CAMKII) signaling pathway has been shown to play a critical role in mediating chondrocyte function restoration. In this study, we observed increased expression of EP4, Inositol 1,4,5-trisphosphate receptor (IP3R), and phosphorylated CaMKII in interleukin-1 beta (IL-1β) stimulated chondrocytes, suggesting a possible link between EP4 signaling and calcium dysregulation. However, direct evidence confirming the involvement of the EP4-Ca²⁺/CaMKII axis in PTOA is still lacking. Further investigations using genetic or pharmacological interventions are needed to clarify this potential mechanism. These findings provide a preliminary basis for exploring calcium homeostasis and EP4 signaling as targets for PTOA treatment.

Introduction

Although physical activity is widely promoted for its health benefits, it remains a major cause of lower limb musculoskeletal injuries, which can lead to various adverse outcomes¹. Among these, PTOA has become an increasing burden for adolescents and young adults who experience joint injuries at a young age². Alarmingly, approximately 48-52% of individuals who sustain sports-related joint injuries develop PTOA within 11-17 years^3,4. The knee joint, one of the most frequently injured joints in youth sports and recreational activities, is particularly vulnerable in the progression from joint injury to PTOA. A prospective study reported that individuals with knee injuries have a 10-fold higher risk of developing radiographically confirmed knee osteoarthritis 12-20 years post-injury compared to uninjured individuals⁵. Moreover, in young adults, radiographic evaluations have shown that female soccer players with anterior cruciate ligament transection (ACLT) injuries have a 51% risk of developing PTOA within 12 years, while male players have a 41% risk within 14 years⁵. These findings highlight the long-term negative impact of sports-related joint injuries on musculoskeletal health. Therefore, understanding the irreversible pathological mechanisms underlying PTOA development is crucial for identifying appropriate intervention strategies aimed at mitigating disease progression.

Early dysregulation of Ca²⁺ homeostasis is one of the key indicators for PTOA initiation⁶. Ca²⁺ binds to calmodulin (CaM) to form a Ca²⁺/CaM complex that can interact with CaMKII, relieving its autoinhibitory conformation and regulating kinase activity⁷. In both human and murine OA, the expression of phosphorylated CaMKII (the activated form of CaMKII) is increased, while the use of CaMKII inhibitors blocks this elevation in phosphorylation levels, leading to articular cartilage destruction⁸, demonstrating the important regulatory role of Ca²⁺/CaMKII in mediating OA cartilage homeostasis. Normally, these changes are crucially influenced by the activation of inflammatory mechanisms in PTOA development. High levels of PGE₂, as a key pro-inflammatory pain mediator, influence the progression of OA by activating the EP4 receptor. Specifically, conditional knockout of EP4 in articular cartilage enhances cartilage formation and anabolic metabolism, while inhibiting chondrocyte hypertrophy and catabolism, thereby promoting the regeneration of stable, mature articular cartilage instead of fibrocartilage and alleviating joint pain⁹. Given the crucial role of the Ca²⁺/CaMKII signaling pathway in chondrocyte physiology and the recognized involvement of the EP4 receptor in osteoarthritis progression, this study aimed to explore whether EP4 activation is associated with changes in calcium signaling and mitochondrial dysfunction during PTOA development. Although the causal relationship between EP4 and Ca²⁺ dysregulation remains to be determined, the data here suggest a possible mechanistic link that warrants further investigation.

This study focuses on the potential mechanisms linking EP4 receptor activation with Ca²⁺ signaling and mitochondrial dysfunction during PTOA development. Compared with traditional diagnostic methods, such as imaging techniques that detect PTOA progression, and current therapeutic approaches, such as nonsteroidal anti-inflammatory drugs (NSAIDs) for symptom relief, our approach aims to reveal early intracellular signaling disturbances in PTOA pathogenesis. This mechanistic insight provides a more precise understanding of disease onset and progression, offering novel avenues for early diagnosis and targeted interventions. Therefore, this study established a PTOA rat model induced by anterior cruciate ligament transection (ACLT) to mimic mechanical injuries commonly seen in athletes with impaired motor control during acute or chronic physical activity. This model serves as an optimal representation of posttraumatic mechanical joint damage, offering a reproducible platform to investigate both histopathological changes and underlying molecular mechanisms. A high-fat diet plus damp environment exposure (FD) group serves as a positive control, aiming to simulate metabolic and environmental risk factors associated with chronic osteoarthritis. The former models acute injury caused by mechanical trauma, while the latter represents a naturally occurring disease model induced by metabolic disorder and environmental factors, although the final pathogenesis in this group might not follow the EP4-Ca²-mitochondrial axis.

Protocol

All experimental procedures involving animals were reviewed and approved by the Animal Ethics Committee of Guangdong Provincial Hospital of Chinese Medicine (ethical approval number: 2024014-2). The study was conducted in accordance with the regulations on the ethical use of laboratory animals stipulated by the State Council of the People's Republic of China.

1. Animals

1. Use Sprague-Dawley (SD) outbred SPF rats to reduce potential confounding effects associated with the estrous cycle. Select a total of nine male SD rats, aged 4 weeks and weighing between 90 g and 100 g, for this experiment.
   NOTE: These rats were sourced from a licensed laboratory animal supplier in China (certificate number: 20240410Aazz0619000774).
2. Maintain all animals in a specific pathogen-free (SPF) environment. Maintain a controlled environment at a temperature of 24 ± 2 °C with an average humidity of 60 ± 1% and a 12-h light/dark cycle.
3. Ensure the rats have free access to acidified water and a standard rodent chow diet.

2. Animal model construction and intervention

1. Acclimatize the rats for a 2-week period at the feeding center. Randomly assign the rats into three groups at 6 weeks of age: Control group, PTOA group, and FD group, with three rats in each group.
2. Maintain the Control group under standard conditions.
3. Anesthetize the PTOA group with isoflurane (4% for induction and 1%-2% for maintenance).
4. Surgically expose the bilateral knee joints via a longitudinal skin incision using a medial parapatellar approach.
5. Perform ACLT using a scalpel, and confirm complete transection by performing a positive anterior drawer test.
   NOTE: Bilateral ACL transection was performed to ensure model consistency and reduce individual variability. Data from both knees were averaged to obtain one value per animal for analysis.
6. Periodically transfer rats in the FD groups to a climate-controlled chamber, situated in the same facility. Subject these rats to a high-fat diet.
   NOTE: The high-fat diet contained 20% sucrose, 15% lard, 1.2% cholesterol, 0.2% sodium cholate, 10% casein, 0.6% calcium hydrogen phosphate, 0.4% limestone powder, 0.4% premix, and 52.2% basal feed. The nutrient profile of the control feed was as follows: 19% protein, 31% fat, and 50% carbohydrates, with a caloric ratio of 17% protein, 37% fat, and 46% carbohydrates.
7. Maintain the environmental conditions within the climate chamber at a temperature of 24 ± 2 °C, a humidity level of 90 ± 4%, and a 12-h daily light cycle.
   NOTE: Due to the increased risk of bacterial growth in such a high-temperature and high-humidity setting, sterilize drinking water and food and replenish them daily to minimize contamination. The total duration of the experimental intervention was 12 weeks.

3. Gait analysis (Footprints)

1. Conduct footprint analysis 12 weeks after the initiation of treatment in the model rats, using a method previously outlined¹⁰.
2. Coat the ventral surfaces of the rats' hind paws with red ink, and they were allowed to walk along a 100 cm long and 8 cm wide path, which was covered with white paper.
3. To encourage the rats to move, place a dark chamber at the end of the path to encourage forward movement.
4. Take three sequential measurements to obtain average values for each parameter, including stride length and step length, which were used to assess irregularity.
5. Determine the stride length (cm) by measuring the distance traveled by the same hind paw between two successive steps.
6. Define the step length (cm) as the horizontal distance between the left and right hind paws.
7. Measure the paw angle (°) as the angle between the second toe and the calcaneus, relative to a horizontal line¹¹.
8. Measure the stride length, step length, and paw angle directly on the scanned footprint images using Image-Pro Plus software (version 6.0), utilizing its built-in distance and angle measurement tools.
   NOTE: These gait parameters are crucial for identifying subtle functional impairments in the early stages of osteoarthritis. Patients may exhibit reduced stride and step length to protect painful joints, while increased toe-out angle and gait asymmetry often occur as compensatory responses to joint instability induced by pain.

4. Joint diameter measurement

1. Measure the joint diameter using a calibrated spiral micrometer (mm) after modeling in each group.
   NOTE: As osteoarthritis progresses, patients typically exhibit joint swelling and pain. A higher degree of swelling may indicate a more severe stage of the disease.

5. Grip strength measurement

1. Measure hindlimb grip strength using a digital grip strength meter equipped with a traction grid, strength meter equipped with a traction grid (90 mm × 90 mm).
   1. Gently hold the rat by the tail and the skin on the back of the neck.
   2. Lower the animal until its hindlimbs firmly grasp the grid, then steadily pull the animal horizontally along the axis of the force sensor until it releases its grip.
   3. Repeat the test three times per animal. Record the highest value as the maximal grip strength.
      NOTE: During hindlimb grip strength testing, immobilize the forelimbs by taping them to a cardboard surface to prevent accidental engagement of the forelimbs with the traction grid. Decreased grip strength is indicative of decreased muscular function and potential pain-related motor deficits associated with osteoarthritic progression.

6. Primary chondrocyte isolation and culture

1. Isolate primary chondrocytes from 6-week-old male Sprague-Dawley rats.
2. Dissect the femoral heads and tibial plateaus to collect approximately 100-150 mg of cartilage tissue.
3. Wash the tissue twice with PBS containing 1% penicillin-streptomycin.
4. Digest the cartilage in 5 mL of 0.25% trypsin-EDTA at 3 °C for 30 min.
5. Cut the cartilage into 1-2 mm³ pieces and further digest in 10 mL of 0.2% collagenase II at 37 °C for 4 h on a constant-temperature shaker.
6. Filter the cell suspension through a 70 µm cell strainer, centrifuge at 300 × g for 5 min, and discard the supernatant.
7. Resuspend the cell pellet in DMEM/F12 medium supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin.
8. Incubate the cells at 3 °C in a humidified atmosphere with 5% CO₂.

7. Cell treatment

1. Count the isolated chondrocytes using a hemocytometer.
2. Seed the chondrocytes into 6-well plates at a density of 2 × 10⁵ cells per well in 0.1 mL of complete culture medium (DMEM/F12 supplemented with 10% fetal bovine serum(FBS) and 1% penicillin-streptomycin).
3. Incubate the cells at 37 °C in a 5% CO₂ incubator for 24 h to allow adhesion.
4. To establish an in vitro inflammatory PTOA model, treat adherent chondrocytes with IL-1β (10 ng/mL) for 48 h once cell confluence reaches approximately 80%.
5. For the FD positive control, dissolve palmitic acid (PA, CAS No. 57-11-4) in chloroform at a 1:1000 dilution to prepare a 500 µM stock solution.
   1. When cell confluence reached approximately 80%, add 1 µL of the PA stock solution per 1 mL of culture medium to reach a final PA concentration of 500 nM. Treat chondrocytes with this solution for 48 h.
6. Add 1 µL of chloroform (vehicle control) per 1 mL of culture medium to control cells without PA.

8. Sample collection, decalcification, and embedding preparation

1. Euthanize animals at 12 weeks post-intervention by inhalation of an overdose of isoflurane (≥5%) in a sealed chamber for at least 5 min, and confirm complete cessation of respiration and heartbeat.
   NOTE: This method was approved by the Animal Ethics Committee and complied with national guidelines for the humane euthanasia of laboratory animals.
2. Collect both knee joints from three rats per group (n = 3, total = 6 knees) for histological evaluation.
3. Fix samples in 4% paraformaldehyde (PFA) at a tissue-to-fixative volume ratio greater than 1:20 for over 48 h on a shaker at °C.
4. Rinse tissues under running tap water for 1-2 h to remove residual fixative.
5. Decalcify tissues in 0.5 M EDTA solution (pH 7.4, ~15%) at a tissue-to-solution ratio of 1:20 for 21 days at 3 °C, and replace with fresh solution every 3 days.
6. Assess completion of decalcification by probing the bone with a needle for softening.
7. Wash decalcified tissues under running tap water for 2 h and place them into embedding cassettes.
8. Dehydrate samples through a graded ethanol series: 75% ethanol for 2 h (or overnight), 80% ethanol for 2 h, 95% ethanol for 0.5 h, and absolute ethanol twice for 60 min. Then immerse in 1:1 xylene:ethanol for 20 min.
9. Clear tissues in xylene twice (10 min and 60 min).
10. Infiltrate tissues with paraffin in the following order: xylene:paraffin (1:1) for 15 min, soft paraffin at 52-5 °C for 1 h (twice), then hard paraffin at 56-5 °C for 30 min.
11. Embed tissues using a paraffin embedding system (e.g., Leica, set at 6 °C), and transfer blocks to a -2 °C cold plate for 2 h.
12. Section paraffin blocks sagittally at µm thickness using a microtome.
13. Float ribbons in a 4 °C water bath and mount onto clean glass slides.
14. Air-dry mounted sections and bake them in a 60 °C oven for 2 h to remove residual paraffin.
15. Deparaffinize sections by immersing sequentially in xylene (10 min), fresh xylene (10 min), absolute ethanol (5 min), fresh absolute ethanol (5 min), 90% ethanol (5 min), and 75% ethanol (5 min), then rinse with tap water prior to staining.

9. Hematoxylin and eosin (HE) staining

1. Immerse deparaffinized and rehydrated tissue sections were immersed in 0.5% hematoxylin staining solution for 3-5 min at room temperature (RT; ~2 °C), followed by thorough rinsing under running tap water.
2. Briefly treat sections with hematoxylin differentiation solution for 2-5 s, and rinse under running tap water.
3. Perform bluing by immersing sections in hematoxylin bluing solution for 2-5 s, followed by rinsing.
4. Dehydrate sections in 85% and 95% ethanol for 5 min each, then stain in 0.05% eosin Y (alcoholic) for 5 min.
5. Dehydrate twice in absolute ethanol (5 min each), then clear in xylene (5 min), followed by fresh xylene (5 min).
6. Mount sections with neutral balsam and cover with a coverslip.
   NOTE: In well-preserved cartilage, hematoxylin stains nuclei blue and eosin stains matrix pink. Damaged cartilage shows chondrocyte loss, fibrillation, and disorganized matrix.

10. Safranin O - fast green (SOFG) staining

1. Stain sections with 2% Fast Green solution for 1-5 min at RT. Wash under running tap water until cartilage becomes colorless.
2. Briefly differentiate sections in 1% hydrochloric acid for 10-15 s, then rinse thoroughly with running water.
3. Stain sections with 0.2% Safranin O solution for 5-10 s, then dehydrate rapidly through four changes of absolute ethanol (3-5 s each).
4. Clear sections in xylene (5 min), followed by fresh xylene (5 min).
5. Mount slides with neutral balsam and cover with a coverslip.
   NOTE: Safranin O stains cartilage proteoglycans red, while Fast Green stains bone/fibrous tissues green. Loss of red indicates proteoglycan depletion and degeneration.
6. Evaluate histological changes using the Osteoarthritis Research Society International (OARSI) scoring system. Measure joint space width and cartilage thickness to assess structural degeneration. Capture images under a light microscope (e.g., ECLIPSE Ti2-E) at 4× (scale bar = 50 µm) and 20x (scale bar = 10 µm).
   NOTE: Use the system's imaging software for image capture and ImageJ (v1.48v) for analysis. Calibrate images via Analyze > Set Scale with a micrometer. For each joint, quantify five random fields from three sagittal sections using blinded analysis by three independent observers.

11. Micro-µ CT

1. Dissect rat knee joints 12 weeks post-intervention and immediately fix them in 4% paraformaldehyde at RT for 24 h to preserve tissue morphology.
2. Rinse the fixed samples with PBS and store them in 70% ethanol until scanning.
3. Mount each knee joint specimen on a dedicated sample holder prior to scanning. Align the joint along its long axis to minimize motion artifacts.
4. Perform micro-µCT scanning using a micro-µCT system with the following scanning parameters: X-ray voltage 70 kV, current 100 µA, and power 7 W.
5. Acquire four frames per projection and stack them to enhance image quality, with a rotational step size of 0.72°, completing a full 360° rotation.
6. Set the resulting voxel size (slice thickness) at 15 µm, providing high-resolution images suitable for trabecular bone analysis.
7. Define the region of interest (ROI) between the proximal tibial growth plate and the tibial plateau, focusing on the subchondral bone of both the femur and tibia.
8. Reconstruct the raw scan data into cross-sectional images using reconstruction software.
9. Import the reconstructed image stacks into an appropriate software for quantitative morphometric analysis.
10. Assess key parameters including bone volume fraction (BV/TV, %), bone mineral density (BMD, g/cm³), and trabecular separation (Tb.Sp, mm).
11. For qualitative and three-dimensional visualization, use a 3D visualization software to generate volumetric renderings of bone microarchitecture.
12. Perform a visual evaluation to confirm structural integrity and morphological changes observed in the quantitative data.
    NOTE: All image processing and analysis were conducted by blinded operators to ensure unbiased results.

12. Elisa

1. Anesthetize the rats 12 weeks after intervention. Carefully expose and dissect the abdominal aorta to collect blood samples.
2. Allow the collected blood to clot at RT for 30 min and then centrifuge it at 755 × g (equivalent to 3000 rpm, using a centrifuge with a 7.5 cm rotor radius) at °C for 15 min.
3. Separate and store the serum for subsequent measurement of PGE₂ levels using a commercially available ELISA kit.
4. In parallel, seed primary chondrocytes and culture them for 24 h, followed by treatment with IL-1β and PA for 48 h, according to the established cell treatment protocol. After the intervention, collect and analyze the culture supernatants for PGE₂ concentration using the same ELISA kit.

13. Quantitative RT-PCR

1. Extract total RNA from cell samples using commercial RNA extraction reagent (TRIzol).
2. Synthesize cDNA using a Reverse Transcription Kit (with gDNA Remover), and store the resulting cDNA at -8 °C for subsequent analysis.
3. Carry out quantitative PCR using SYBR Green, and calculate the relative expression levels using the 2−ΔΔCt method.
   NOTE: The primer sequences used were as follows: β-actin forward: ACAACCTTCTTGCAGCTCCTC; β-actin reverse: CTGACCCATACCCACCATCAC; EP4 forward: GGCACATTGTTGGTAAGCCC; EP4 forward: GGCTGTAGAAGTAGGCGTGG; COX-2 forward: GATGACGAGCGACTGTTCCA; COX-2 reverse: TGGTAACCGCTCAGGTGTTG.

14. Western blotting analysis

1. Lyse the cells with RIPA buffer on ice for 30 min.
2. Separate the protein samples by SDS-PAGE for 90 min, then transfer them to nitrocellulose membranes for 2 h.
3. Block the membranes with 5% BSA and wash them with phosphate-buffered solution.
4. Perform immunoblotting using specific antibodies.
   NOTE: The antibodies and their respective dilutions were as follows: anti-MMP9 (1:1000), anti-collagen II (1:1000), anti-COX2 (1:1000), anti-CaMKII (1:1000), anti-p-CaMKII (1:1000), anti-IP3R (1:1000), anti-Cyt-C (1:1000), and anti-β-actin (1:2000).
5. After overnight incubation with primary antibodies, wash the membranes with TBST and incubate for 1 h with secondary antibodies: mouse-HRP (1:2000) or rabbit-HRP (1:2000) in the dark.
6. Following another wash with TBST, perform protein detection using an enhanced chemiluminescence kit.
7. Analyze the data with ImageJ software (version 1.48v).

15. Immunofluorescence staining

1. Culture chondrocytes on coverslips in 12-well plates until they reached 80% confluence.
2. After treatment with IL-1β and PA for 48 h, or no treatment as a control, fix the cells with 4% paraformaldehyde in PBS for 15 min at RT.
3. Permeabilize the cells with PBS containing 0.2% Triton X-100 for 15 min.
4. Wash the cells three times with PBS (5 min each), then incubate them with primary antibody (anti-IP3R, 1:200 dilution) in antibody dilution buffer at °C overnight.
5. Expose the cells to a 1:500 dilution of fluorescein isothiocyanate-labeled goat anti-rabbit IgG secondary antibody for 1 h.
6. Counterstain the cells with 5 µg/mL DAPI solution for 10 min.
   NOTE: Fluorescence images were acquired using a 40x objective lens (scale bar = 2 µm). All images were processed with ZEN software and quantified with ImageJ (version 1.48v), following consistent calibration procedures.

16. Statistical analysis

1. Conduct statistical analyses using GraphPad Prism (version 8.0.2).
2. Prior to applying parametric tests, evaluate the data for normal distribution using the Shapiro-Wilk test and for homogeneity of variance using the Brown-Forsythe and Bartlett's tests.
3. Use one-way ANOVA followed by Tukey's post hoc test for comparisons among multiple groups, and apply a two-tailed unpaired Student's t-test for two-group comparisons.
4. Consider P-value less than 0.05 as statistically significant.
5. Present all data as Mean ± standard deviation (SD) from at least three independent experiments.

Results

ACLT-induced PTOA exhibits premature cartilage destruction and behavioral deficits relative to FD-induced chronic KOA (Figure 2 and Figure 3)
Joint space narrowing and cartilage degeneration are the primary outcomes of OA. Previous studies have identified overweight and environmental factors (e.g., humid climate) as potential contributors to OA onset^12,13<...

Discussion

Compared to chronic OA induced by environmental and dietary factors, ACLT-induced joint trauma leads to a more rapid progression of the disease. Our results, based on behavioral assessments including joint swelling, hindlimb grip strength, and gait analysis, revealed significant differences between the control group, the PTOA group, and the positive control group induced by environmental and dietary factors. After 12 weeks of intervention, excessive joint swelling, accompanied by a significant reduction in hindlimb grip ...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
0.2% Collagenase II	Sigma-Aldrich, USA	CAS No.: 9001-12-1	Primary chondrocyte isolation and culture
0.2% Triton X-100	Beyotime, China	ST795	Immunofluorescence
0.25% trypsin-EDTA	Wuhan Boster Biological Technology Co., Ltd.	AR1071	Decalcification
0.25% Trypsin-EDTA	Gibco, USA	25200072	Primary chondrocyte isolation and culture
4% Paraformaldehyde Fixative Solution	Biyuntian, China	P0099-3L	Tissue fixation
Anti-CaMKII Antibody	Huabio, China	ET1608-47	Western blot (1:1000)
Anti-Collagen II Antibody	Abcam, UK	ab34712	Western blot (1:1000)
Anti-COX2 Antibody	Abcam, UK	ab179800	Western blot (1:1000)
Anti-Cyt-C Antibody	Selleck, China	F2534	Western blot (1:1000)
Anti-IP3R Antibody (B-2)	Santa Cruz, USA	sc-377518	Western blot (1:1000)
Anti-MMP9 Antibody	Abcam, UK	ab76003	Western blot (1:1000)
Anti-p-CaMKII Antibody	Selleck, China	F0342	Western blot (1:1000)
Anti-β-actin Antibody	Cell Signaling Technology (CST), USA	8H10D10	Western blot (1:2000)
BSA Blocking Solution	Sigma Aldrich, USA	N/A	5% BSA for Western blot blocking
Centrifuge (5424 R)	Eppendorf, Germany	N/A	755 × g centrifugation speed
Chloroform	Sigma Aldrich, USA	N/A	Solvent for PA
Climate-controlled chamber (RXZ-158A)	Domestic manufacturer, China	N/A	Humid environment model
Color Reverse Transcription Kit	Invitrogen, Suzhou, China	N/A	cDNA synthesis
CTAn software	Bruker	versions 1.9 and 4.1	For quantitative morphometric analysis
CTVol software	Bruker	version 2.0	For qualitative and three-dimensional visualization
DAPI Staining Solution	Beyotime, China	N/A	Nuclear staining (5 µg/mL)
Digital Grip Strength Meter	Puxin Instrument	N/A	Measuring hindlimb grip strength
DMEM/F12 Medium	Corning, USA	N/A	Cell culture medium
EDTA (Ethylenediaminetetraacetic acid)	Aladdin	N/A	Decalcification of bone tissues
ELISA Kit for PGE2	Elabscience, Wuhan, China	PGE2E-EL-0034	ELISA detection
Enhanced Chemiluminescence Kit	Millipore, USA	WBKLS0500	Western blot detection
Ethanol	Guangdong Guangshi Reagent Technology Co., Ltd.	CAS: 64-17-5	Tissue dehydration
Fetal Bovine Serum (FBS)	Corning, USA	N/A	10% concentration for culture
FITC-labeled Goat Anti-Rabbit IgG	Beyotime, China	P0179 kit	Immunofluorescence (1:500)
GraphPad Prism	GraphPad Software, USA	Version 8.0.2	Data analysis
Hematoxylin and Eosin (H&E) Staining Kit	Servicebio, Wuhan	G1005	Histology
IL-1β	PeproTech, USA	400-01B	10 ng/mL for PTOA cell model
ImageJ	NIH, USA	Version 1.48v	Image analysis
Image-Pro Plus software	Media Cybernetics	Version 6.0	Quantitative gait analysis from scanned footprints
Isoflurane	Shanghai Yaji Biological	YS1412C	Anesthesia for animal surgery
Leica Embedding Center	Leica Microsystems	EG1160	Paraffin embedding
Leica Microtome	Leica Microsystems	RM2235	Sectioning paraffin-embedded tissues
Leica Water Bath	Leica Microsystems	HI1210	Floating paraffin sections
Light microscope (ECLIPSE Ti2-E)	Nikon, Japan	N/A	Histological observation
Micro-CT Scanner (ZKKS-MCT-Sharp)	Domestic manufacturer, China	N/A	Bone imaging
Mouse-HRP Secondary Antibody	Cell Signaling Technology (CST), USA	7076	1:2000 dilution
NIS-Elements Imaging Software	Nikon	N/A	Capturing and analyzing microscope images
NRecon software	Bruker, Germany	Version 1.6	CT reconstruction
Palmitic Acid (PA)	Sigma Aldrich, USA	P0500	500 µM stock for FD cell model
Paraffin Wax for Sectioning, Pathology Grade, Melting Point 52-54 °C	Guangdong Guangshi Reagent Technology Co., Ltd.	Y258797-500g	Used for paraffin embedding during tissue processing
Paraffin Wax for Sectioning, Pathology Grade, Melting Point 56-58 °C	Guangdong Guangshi Reagent Technology Co., Ltd.	Y258799-500g	Used for final hard wax embedding in tissue sectioning
PBS (Phosphate Buffered Saline)	Gibco / Thermo Fisher	C10010500BT	Cell washing and tissue rinsing
Penicillin-Streptomycin	Corning, USA	N/A	1% for cell culture
PVDF Membrane (0.45 µm)	Millipore, USA	IPVH00010	Western blot membrane
Rabbit-HRP Secondary Antibody	Cell Signaling Technology (CST), USA	7074	1:2000 dilution
Red Ink	HERO	HERO 204	Footprint tracking in gait analysis
RIPA Lysis Buffer	Keygen, China	N/A	Protein extraction
Safranin O–Fast Green Staining Kit	Servicebio, Wuhan	G1053	Histological staining
Spiral Micrometer (Vernier Caliper)	Huangshan, China	N/A	Joint width measurement
Subchondral Bone Analysis Software (CTAn)	Bruker, Germany	Versions 1.9 and 4.1	Morphometric analysis
SYBR Green PCR Master Mix	AG Scientific, China	N/A	qPCR analysis
Western blot reagents (RIPA buffer, SDS-PAGE gel components, loading buffer, TBST, etc.)	Beyotime Biotechnology (China)	N/A (used as a group entry)	All routine reagents used for Western blotting procedures
Xylene	Guangdong Guangshi Reagent Technology Co., Ltd.	CAS: 1330-20-7	Tissue clearing