A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Experimental Study on Muscone Reducing NF-κB Pathway Activity by Targeting IL-1R1 to Attenuate Oxidative Stress Injury in Schwann Cells

453 views

DOI:

10.3791/69009

October 10th, 2025

In This Article

Summary

This paper studies the effect of muscone, the main component in musk, on the proliferation and apoptosis of Schwann cells. The results preliminarily illustrate the potential mechanism of musk reducing NF-κB pathway activity by inhibiting IL-1R1 to attenuate oxidative stress injury in Bell's palsy.

Abstract

The underlying mechanism of how natural musk treats Bell's palsy is not clear. This study aims to reveal the potential mechanism of musk in treating peripheral nerve injury in vitro. To achieve this, an oxidative stress injury model was established in Schwann cells (SCs) using cobalt chloride (CoCl2). To assess the protective effects of Muscone (Mus) on this injury and explore its mechanism, cell viability assays, siRNA transfection, enzyme-linked immunosorbent assays (ELISA), quantitative reverse transcription polymerase chain reaction (qRT-PCR), western blotting, immunofluorescence staining, and ultrastructural analysis of cells were employed. As a result, it is indicated that Mus intervention enhanced SC proliferation and S-100b mRNA under hypoxia, while also reducing reactive oxygen species (ROS) and elevating superoxide dismutase (SOD) levels. Mus ameliorated oxidative stress and inflammation in hypoxic SCs by reducing IL-1β and TNF-α. Furthermore, Mus modulated key indicators involved in oxygen metabolism, cell repair, and neurometabolism, including C-JUN and GDNF. IL-1R1, localized to the SC membrane, was upregulated by hypoxia but significantly downregulated following Mus intervention. Mus also inhibited the expression of NF-κB pathway components (IRAK1, IKK, p65, p50) and increased IκB-α. Critically, abolishing IL-1R1 expression via siRNA knockdown showed a consistent effect with Mus. It is concluded that by suppressing IL-1R1, Mus attenuated inflammation in hypoxic SCs through inhibition of the NF-κB pathway. This study indicated IL-1R1's role in hypoxia-induced SC dysfunction. Furthermore, Mus might be a potentially effective medicinal for treating Bell's palsy.

Introduction

Muscone (Mus), 3-methylcyclopentadecanone, was isolated from the natural extract of deer musk as early as 19061. Musk, a valuable and effective traditional Chinese medicine (TCM), has extensive curative effects such as detumescence, anti-inflammation, resuscitation, and blood circulation-promotion2. Musk-containing TCM has been utilized for a variety of common diseases, including central nervous system disease3, detoxification4, gastrointestinal tumors5, viral hepatitis6, and coronary heart disease7, etc. As the active pharmaceutical ingredient of Musk, Mus has shown excellent biological effects involving anti-inflammation8, anti-oxidation8,9, neuronal damage repair, and myocardial infarction-relieving10, etc. Mechanistically, studies have exhibited that Mus can reduce the release of inflammation cytokines such as Interleukin (IL)-1β, IL-6, tumor necrosis factor (TNF)-α, reactive oxygen species (ROS)1,8, and regulate the mitogen-activated protein kinase (MAPK), Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), AKT/mechanistic target of rapamycin (mTOR), and CaN/Erk1/2 pathway1,8,11, etc.

In China, it has been reported that some doctors have successfully treated Bell's palsy with natural musk according to earlier literature records and clinical experience12,13,14,15. Mus is not a recommended drug in the diagnosis and treatment guidelines, but in underdeveloped medical areas or for some people who cannot use steroids or antiviral drugs, Mus can be another preferred option. Literature analysis in recent years also shows that musk is the most frequently used Chinese medicine in the published Chinese medicine patch prescriptions and acupuncture point studies for the treatment of peripheral facial palsy16. Although there are many pharmacological and medical studies on Mus, how musk cured Bell's palsy exactly, and what the underlying neurochemical and cellular biological mechanisms are, is still unknown.

Bell's palsy, an acute idiopathic facial paralysis, results from dysfunction of the peripheral facial nerve, which innervates all facial muscles. The most noticeable sign of Bell's palsy symptoms is the weakness and drooping of facial muscles on one side. Although Bell's facial paralysis is not life-threatening, it can affect the patient's quality of life and even cause anxiety and depression. What is particularly worrying is that up to 30% of the patients suffer long-term sequelae, including synkinesis, contracture, permanent facial paresis, and facial asymmetry, even with appropriate treatment. Therefore, finding the resolution of Bell's palsy and decreasing the risk of paralysis are our major aims. Current knowledge on the pathogenic mechanism of Bell's palsy remains unclear. Recent research has demonstrated that the reactivation of viruses may be the major cause of Bell's palsy, and these viruses can cause a neuronal edema and inflammation to trigger the attack of Bell's palsy.

Building on recent evidence, we hypothesized that Mus alleviates the symptoms of Bell's palsy by improving oxidative stress damage to the facial nerve. This study experimentally indicated Mus's therapeutic effects, revealing that upregulated IL-1R1 in SCs activates the NF-κB pathway, causing cellular damage. Crucially, we demonstrated that Mus inhibits NF-κB signaling by downregulating IL-1R1. Our findings identified the role of IL-1R1 upregulation in SCs exposed to oxidative stress in vitro and positioned Mus administration as a novel therapeutic strategy.

Access restricted. Please log in or start a trial to view this content.

Protocol

This experimental research was conducted with the approval of the Institutional Animal Care and Use Committee (Approval Number: LL-240077).

Cell culturing and drug intervention
Rat Schwann cells (SCs) were cultured in Schwann Cell Medium, consisting of basal medium, 5% fetal bovine serum, 1% Schwann cell growth supplement, 1% penicillin, and 1% streptomycin. All cells were kept in a 5% CO2 atmosphere at 37 °C. When allowed to grow up to a density of 70-80%, SCs were divided into four groups (n = 5 per group): (1) NC group; (2) NC+CoCl2 group; (3) NC+CoCl2+Mus group; (4) NC+CoCl2+siIL-1R1+Mus group.

Cobalt chloride (CoCl2), a frequently employed agent to mimic hypoxia, is known to trigger responses similar to those of hypoxia, such as the impeding degradation and stabilization of hypoxia-inducible factors and accumulation of HIF-1α protein15. According to the modified method based on Osuru et al.17, in the NC+CoCl2 group and NC+CoCl2+Mus group, SCs were cultured in Schwann Cell Medium supplemented with 240 µM CoCl2 for 8 h, at atmospheric conditions of 95% air and 5% CO2 at 37 °C in a humidified incubator (21% O2). Then, in the Mus groups, the intervention of 1.25 µg/mL Mus for an additional 24 h was applied. Meanwhile, in the NC+CoCl2+siIL-1R1+Mus group, the SCs were firstly treated with 24 h of siRNA infection, then continually cultured with 240 µM CoCl2 for 8 h, followed by the intervention of 1.25 µg/mL Mus for an additional 24 h, as in the former groups. The flowchart of the experimental process is shown in Figure 1.

Cell viability assay
The viability of SCs was determined using the cell counting kit-8 (CCK-8) assay reagent according to the manufacturer's instructions. Cultured SCs at a density of 5 × 105 cells/well were seeded in a 96-well cell culture plate with 100 µL of complete growth medium at 37 °C in a 5% CO2 humidified atmosphere. When the confluency reached 70-80%, 10 µL of CCK-8 solution was added to each well, and the plates were incubated for 1 h at 37 °C. The optical density (OD) of the 96-well plates was measured at 450 nm using a microplate reader, and the cell viability was calculated. The cells were divided into four groups: NC group, NC+CoCl2 group, NC+CoCl2+Mus group, and NC+CoCl2+siIL-1R1+Mus group. The experimental results were corrected using a blank well (medium+CCK8 solution). Cell survival rate = [(experimental group - blank well)/(NC group - blank well)] × 100%.

siRNA transfection
Transfection was conducted according to the manufacturer's instructions of a commercial in vitro siRNA/miRNA transfection reagent using synthetic siRNA duplexes of siIL-1R1 (AUAGUCUUGGAUUUUCUCCAA, GGAGAAAAUCCAAGACUAUGA) with a concentration of 100 ng/µL for 24 h. After siIL-1R1 transfection, the siIL-1R1 expressions were assessed by performing RT-qPCR analysis after 24 h of transfection18, and the efficiency must be ensured to be higher than 80%

Enzyme-linked immunosorbent assay (ELISA)
Post-culture supernatants were collected and centrifuged under group-specific conditions (2950 g, 20 min, 25 °C). Extracellular levels of IL-1β, TNF-α, ROS, and SOD were assayed via ELISA following kit instructions. Final absorbance readings at 450 nm were obtained using a microplate reader.

RNA isolation and quantitative real-time PCR (RT-qPCR)
Following manufacturer instructions, total RNA was extracted from cultured cells using TRizol reagent. Target genes (IL-1β, TNF-α, S-100b, IL-1R1) were amplified in 20 µL of SYBR qPCR mix reactions for 40 cycles on a PCR instrument. Data normalization used β-actin, with PCR specificity verified by melting curve analysis. The 2−ΔΔCt method quantified relative expression from five independent samples assayed in triplicate. Primers are listed in Table 1.

Western blot
Following treatment, SCs from all experimental groups were incubated for 24 h and harvested. Total protein was extracted using a total protein extraction kit. Protein lysates were combined with sodium dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE) loading buffer denatured at 98 °C for 5 min, and separated (20 µg per lane) on 10-12% SDS-polyacrylamide gels. Resolved proteins were electrophoretically transferred to polyvinylidene fluoride (PVDF) membranes. Membranes were blocked with 5% non-fat dry milk for 60 min at room temperature, then incubated overnight at 4 °C in a volume of 6 mL with the following primary antibodies: anti-HIF-1α antibody (1:1000), anti-GAPDH antibody (1:1000), anti-IL-1R1 antibody (1:1000), anti-C-JUN antibody (1:1000), anti-GDNF antibody (1:1000), anti-IRAK1 antibody (1:1000), anti-IKK antibody (1:1000), anti-p65 antibody (1:800), anti-p50 antibody (1:900), anti-IκB-α antibody (1:900) and anti-β-actin antibody (1:1000). After washing, membranes were probed with horseradish peroxidase (HRP)-conjugated secondary antibodies for 60 min at 25 °C. Protein signals were detected using Image Studio Digits Ver 4.0. Band intensities were quantified with ImageJ software and normalized to β-actin and GAPDH expression. Three independent experiments were performed.

Immunofluorescence
IL-1R1 localization in SCs was assessed following Zhao et al.19. Harvest cells during the logarithmic growth phase by trypsinization, resuspend them in fresh complete medium, and triturate thoroughly to obtain a uniform single-cell suspension. Seed the cells onto culture plates containing sterile cover slips. Once the cells have reached full confluence, rinse them 1-2 times with phosphate-buffered saline (PBS), carefully remove the cover slips, and fix the adherent cells with 4% paraformaldehyde in PBS for 10 min, permeabilize with 0.05% Triton X-100 (10 min), and block with 5% goat serum (1 h). Primary incubation used rabbit anti-rat IL-1R1 mAb. After PBS washes, samples were incubated with FITC-conjugated goat anti-rabbit IgG for 2 h at room temperature. Add water-soluble mounting agents to the cover slip for mounting. Immunolabeled cells were visualized and quantified using a fluorescence microscope with the excitation wavelength 492 nm and the emission wavelength 520 nm.

Ultrastructure analysis
Following Zhao et al.'s protocol19, SCs were fixed in 2.5% glutaraldehyde and post-fixed overnight at 4°C in 1% osmium tetroxide. Samples underwent an ethanol/acetone dehydration series. Ultrathin sections (80 nm) were stained with uranyl acetate and lead citrate prior to ultrastructural examination using a transmission electron microscope.

Disposal of hazardous chemical reagents
The medium and solutions containing CoCl2 are collected into a designated heavy metal waste container. All disposable materials that have come into contact with the aforementioned liquids, including pipette tips, centrifuge tubes, and gloves are classified as heavy metal hazardous waste and are transferred to a licensed hazardous waste management company approved by the relevant authorities for proper disposal. Discard waste paraformaldehyde solution into a dedicated aldehyde waste container. Used consumables should be collected as aldehyde waste and processed by the same licensed hazardous waste management company.

Statistical analysis
Multi-group comparisons were analyzed by one-way ANOVA with Tukey's post-hoc test in GraphPad Prism 8.0. Statistical significance was defined as P < 0.05. Data are presented as mean ±± standard deviation (SD).

Access restricted. Please log in or start a trial to view this content.

Results

Protective effects of Mus on oxidative stress injury of Schwann cells in vitro
The expression of HIF-1α exhibited changes in response to variations in hypoxic circumstances20. To model hypoxia, SCs were exposed to CoCl2, which successfully induced hypoxia as confirmed by elevated HIF-1α protein levels, a canonical hypoxia marker, via western blotting (Figure 2A). Subsequent Mus intervention of hypoxic SCs asses...

Access restricted. Please log in or start a trial to view this content.

Discussion

Bell's palsy is an idiopathic peripheral facial nerve palsy characterized by unilateral facial weakness. The myelin sheath performs various crucial functions in the effective functioning of neurons23. It ensures the smooth conduction of nerve impulses, supports neurons by supplying nourishing factors, and aids in the process of regeneration24 . Hence, loss of myelin in the peripheral nervous system can result in demyelinating neuropathies, which can cause Muscular atrophy, ...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors declare that they hold no competing interests.

Acknowledgements

All the authors would like to deliver their acknowledgments to the funding bodies which are Baoshan District Health Commission Talents (Excellent Academic Leaders) Program(BSWSYX-2024-02), Expenditure Budget Program of Shanghai University of Traditional Chinese Medicine (2021LK003), Baoshan District Health Commission Excellent Youth (Yucai) Program (BSWSYC-2024-02) and Cultivation Project Class B in Keynote Medical Disciplines and Characteristic Brands, Health Commission of Baoshan District, Shanghai (BSZK-2023-BP07). These funding bodies did not have any role in the study design or decision to submit the manuscript for publication.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
0.25% trypsin digestion solution (without EDTA)ServicebioG4002
10x TBSEubiotechBF0153
10-180 KDPrestained Color Protein MarkerEubiotechP0069
5% non-fat dry milkBeyotime Biotechnology, ChinaP0216-300g
anti-C-JUN antibodyCell Signaling, USA#9165T
anti-GAPDH antibodyabcam, UKab245355
anti-GDNF antibodyCell Signaling, USA#47808
anti-HIF-1α antibodyCell Signaling, USA#14179
anti-IKK antibodyCell Signaling, USA#2682
anti-IL-1R1 antibodyCell Signaling, USA#6775for WB
anti-IL-1R1 antibodyproteintech84094-6-RRfor immunofluorescence
anti-IRAK1 antibodyCell Signaling, USA#4395
anti-IκB-α antibodyCell Signaling, USA#8943
anti-p50 antibodyabcam, UKab305263
anti-p65 antibody abcam, UKab16502
anti-rat IL-1R1 mAb Beyotime Biotechnology, ChinaAF7212
anti-β-actin antibodyabcamab179467
BCA Protein Quantification KitEubiotechWB2123
Cell counting kit-8 (CCK-8) assay reagentBeyotime Biotechnology, ChinaC0048M
Cobalt chloride (CoCl2)Macklin, ChinaC804815
EuECL StarEubiotechWB2131
Fetal bovine serum (FBS)Bergolin,ChinaPWL001
Fitc-labeled goat anti-rabbit IgGServicebioGB22303
Fluorescence microscope Nikon 
Hieff Trans in vitro siRNA/miRNA transfection reagentYEASEN, China40806ES01
Horseradish peroxidase (HRP)-conjugated secondary antibodies
Hrp-labeled goat anti-mouse IgG
Servicebio, ChinaGB23301
IL-1β, TNF-α, ROS, and SOD ELISA KitBOSTER, ChinaBES1762K, BES0481K, BES5018K, BES2920K
Muscone (Mus)Aladdin, ChinaM141496
PBS bufferServicebioG4202
Penicillin-Streptomycin Solution, 100xProcellPB180120
Polyvinylidene fluoride (PVDF) membranesMillipore, USAIPFL00010
Rat Schwann cells (SCs)Procell Life Science & Technology ChinaCM-M111
RIPA Lysis BufferEubiotechWB2116
Schwann Cell MediumScienCell, USA1701
SDS-PAGE loading bufferBeyotime Biotechnology, ChinaP0015
SDS-PAGE Protein l Loading Buffer, 5xEubiotechWB2122
si-IL-1R1Gene UniversalRX0114371
Sodium dodecyl sulfate polyacrylamide gelelectrophoresis(SDS-PAGE) Preparation kitEubiotechWB2118
SYBR qPCR MixBeyotime Biotechnology, ChinaD7260
Total Protein Extraction KitBeyotime Biotechnology, ChinaPP123-01
Transmission electron microscopeHitachi HT7800 
TrizolBeyotime Biotechnology, ChinaR0011
Tween-20EubiotechWB2114
Water-soluble mounting agentsAbsin, Chinaabs9240
Western Transfer BufferEubiotechWB2129

References

  1. Zhai, X., et al. Muscone ameliorates ovariectomy-induced bone loss and receptor activator of nuclear factor-κb ligand-induced osteoclastogenesis by suppressing TNF receptor-associated factor 6-mediated signaling pathways. Front. Pharmacol. 11, 348(2020).
  2. Lv, S., et al. Chemical compositions and pharmacological activities of natural musk (Moschus) and artificial musk: A review. J Ethnopharmacol. 284, 114799(2022).
  3. Dong, X., et al. Xingnaojing injection alleviates cerebral ischemia/reperfusion injury through regulating endoplasmic reticulum stress in vivo and in vitro. Heliyon. 10 (3), e25267(2024).
  4. Lu, L., et al. The atheroprotective roles of heart-protecting musk pills against atherosclerosis development in apolipoprotein E-deficient mice. Ann Transl Med. 7 (23), 714(2019).
  5. Zhuang, Q., et al. Pien Tze Huang inhibits tumor cell proliferation and promotes apoptosis via suppressing the STAT3 pathway in a colorectal cancer mouse model. Int J Oncol. 40 (5), 1569-1574 (2012).
  6. Yang, H. X., et al. Babaodan capsules for viral hepatitis: Systematic review of clinical efficacy and safety and Meta-analysis of randomized clinical trials. Zhongguo Zhong Yao Za Zhi. 44 (22), 4953-4961 (2019).
  7. Li, J., et al. Chinese medicine She-Xiang-Xin-Tong-Ning, Containing Moschus, Corydalis and Ginseng, protects from myocardial ischemia injury via angiogenesis. Am J Chin Med. 48 (1), 107-126 (2020).
  8. Li, Y. C., et al. Muscone and (+)-borneol cooperatively strengthen CREB induction of claudin 5 in IL-1β-induced endothelium injury. Antioxidants (Basel). 11 (8), 1455(2022).
  9. Yu, S., et al. Muscone relieves inflammatory pain by inhibiting microglial activation-mediated inflammatory response via abrogation of the NOX4/JAK2-STAT3 pathway and NLRP3 inflammasome. Int Immunopharmacol. 82, 106355(2020).
  10. Du, Y., et al. Hypoxia-inducible factor 1 alpha (HIF-1alpha)/vascular endothelial growth factor (VEGF) pathway participates in angiogenesis of myocardial infarction in muscone-treated mice: Preliminary study. Med Sci Monit. 24, 8870-8877 (2018).
  11. Dong, J., Li, H., Bai, Y., Wu, C. Muscone ameliorates diabetic peripheral neuropathy through activating AKT/mTOR signalling pathway. J Pharm Pharmacol. 71 (11), 1706-1713 (2019).
  12. Zhao, M. Acupoint application for facial neuritis: 32 cases. Sichuan Tradit Chinese Med. 2, 54(1996).
  13. Wang, L., Chen, X. Clinical observation and analysis of 96 cases of facial neuritis treated by integrated Chinese and Western medicine. J Mod Integr Chinese West Med. 4, 617-618 (1997).
  14. Meng, S., Hu, C., Zhang, H., Shang, C. Observation of curative effect of acupuncture with musk combined with physical factors on facial neuritis. New Chinese Med. 45, 134-136 (2013).
  15. Chen, N., Qin, Y. Effect of artificial musk acupoint application combined with acupuncture on peripheral facial paralysis. People's Mil Med. 60, 1197-1198 (2017).
  16. Qi, Q., Ni, S., Li, C., Wang, X. Literature analysis of acupoint application of Chinese medicine in treatment of peripheral facial palsy. J Extern Treat Chinese Med. 23, 59-60 (2014).
  17. Osuru, H. P., Lavallee, M., Thiele, R. H. Molecular and cellular response of the myocardium (H9C2 cells) towards hypoxia and HIF-1alpha inhibition. Front Cardiovasc Med. 9, 711421(2022).
  18. Lai, W., Yu, L. Insulin-like growth factor 1 ameliorates pre-eclampsia by inhibiting zinc finger E-box binding homeobox 1 by up-regulation of microRNA-183. J Cell Mol Med. 27 (9), 1179-1191 (2023).
  19. Zhao, L., Qu, W., Wu, Y., Ma, H., Jiang, H. Dorsal root ganglion-derived Schwann cells combined with poly(lactic-co-glycolic acid)/chitosan conduits for the repair of sciatic nerve defects in rats. Neural Regen Res. 9 (22), 1961-1967 (2014).
  20. Tong, Y., et al. Effect of a hypoxic microenvironment after radiofrequency ablation on residual hepatocellular cell migration and invasion. Cancer Sci. 108 (4), 753-762 (2017).
  21. Zeng, H. T., et al. Modulating oxidative stress in B cells promotes immunotherapy in food allergy. Oxid Med Cell Longev. 2022, 3605977(2022).
  22. Wang, D., et al. Circulating brain-derived neurotrophic factor, antioxidant enzymes activities, and mitochondrial DNA in bipolar disorder: An exploratory report. Front Psychiatry. 11, 514658(2020).
  23. Stadelmann, C., Timmler, S., Barrantes-Freer, A., Simons, M. Myelin in the central nervous system: Structure, function, and pathology. Physiol Rev. 99 (3), 1381-1431 (2019).
  24. Intisar, A., et al. An electroceutical approach enhances myelination via upregulation of lipid biosynthesis in the dorsal root ganglion. Biofabrication. 14 (1), ac457c(2022).
  25. Kamil, K., Yazid, M. D., Idrus, R. B. H., Das, S., Kumar, J. Peripheral demyelinating diseases: From biology to translational medicine. Front Neurol. 10, 87(2019).
  26. Ma, Y., et al. Human umbilical cord mesenchymal stem cell-derived extracellular vesicles promote the proliferation of Schwann cells by regulating the PI3K/AKT signaling pathway via transferring miR-21. Stem Cells Int. 2021, 1496101(2021).
  27. Su, Y., et al. Aptamer engineering exosomes loaded on biomimetic periosteum to promote angiogenesis and bone regeneration by targeting injured nerves via JNK3 MAPK pathway. Mater Today Bio. 16, 100434(2022).
  28. Tian, T., et al. IL1alpha antagonizes IL1beta and promotes adaptive immune rejection of malignant tumors. Cancer Immunol Res. 8 (5), 660-671 (2020).
  29. Mosley, B., et al. The interleukin-1 receptor binds the human interleukin-1 alpha precursor but not the interleukin-1 beta precursor. J Biol Chem. 262 (7), 2941-2944 (1987).
  30. Krumm, B., Xiang, Y., Deng, J. Structural biology of the IL-1 superfamily: Key cytokines in the regulation of immune and inflammatory responses. Protein Sci. 23 (5), 526-538 (2014).
  31. De Benedetti, F., et al. Canakinumab for the treatment of autoinflammatory recurrent fever syndromes. N Engl J Med. 378 (20), 1908-1919 (2018).
  32. Liskiewicz, A., et al. Methamphetamine-associated cognitive decline is attenuated by neutralizing IL-1 signaling. Brain Behav Immun. 80, 247-254 (2019).
  33. Zhang, H., et al. Activated Schwann cells and increased inflammatory cytokines IL-1beta, IL-6, and TNF-alpha in patients' sural nerve are lack of tight relationship with specific sensory disturbances in Parkinson's disease. CNS Neurosci Ther. 26 (5), 518-526 (2020).
  34. Su, D., et al. Tumor-neuroglia interaction promotes pancreatic cancer metastasis. Theranostics. 10 (11), 5029-5047 (2020).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

NF KappaB PathwayPeripheral Nerve InjurysiRNA TransfectionCell Viability AssayWestern BlottingImmunofluorescence Staining