Laser Capture Microdissection of Paraformaldehyde-Fixed Mouse Liver Tissue for RNA Analysis

Summary

This protocol describes a method to isolate RNA from defined histological regions of paraformaldehyde-fixed, Optimal Cutting Temperature compound-embedded mouse liver tissue using laser capture microdissection, enabling targeted downstream gene expression analysis.

Abstract

Laser capture microdissection (LCM) provides spatial access to specific cell populations within complex tissues through in situ visualization and isolation. To enable transcriptomic analysis of histologically defined regions in fixed tissue, a detailed LCM protocol is presented for RNA extraction from paraformaldehyde (PFA)-fixed, Optimal Cutting Temperature (OCT) compound-embedded mouse liver sections. The protocol details the identification and collection of microscale samples (approximately 1,000 cells) through a workflow encompassing tissue fixation, sucrose dehydration, OCT embedding, cryosectioning, hematoxylin staining, and laser-capture of targeted histological areas. Using this method, a high-purity RNA (A₂₆₀/A₂₈₀: 1.9-2.1) was obtained. The RNA integrity number (RIN) was 6.7 ± 0.9, reflecting the expected fragmentation associated with PFA fixation. However, quantitative PCR for β-actin yielded Ct values of 17-19, and RNA sequencing performed using fragmentation-optimized library preparation generated high-quality reads, with >90% of bases meeting Q20 and Q30 thresholds, confirming that the RNA is suitable for sensitive downstream analyses. Therefore, this protocol enables spatially resolved, targeted gene expression analysis by providing RNA of defined purity and integrity from specific histological regions of PFA-fixed liver tissue.

Introduction

Accurate acquisition of spatially resolved gene expression profiles is crucial for understanding tissue heterogeneity in health and disease. Single-cell RNA sequencing (scRNA-seq) offers high cellular resolution^1,2, but it loses native spatial context and may alter transcriptional profiles during tissue dissociation^3,4. For cell types lacking publicly identified specific markers, obtaining pure populations using immunofluorescence-based sorting or immunomagnetic isolation remains difficult^5,6. Spatial transcriptomics technologies such as Visium and GeoMx allow in situ capture of high-throughput gene expression data, but their spatial resolution is limited at the single-cell or subcellular level^7,8. Conversely, imaging-based spatial transcriptomics can achieve nanometer-level resolution but has limited gene detection throughput⁹. This highlights a persistent gap for hypothesis-driven analysis of specific morphological regions.

Laser capture microdissection (LCM) allows microscope-guided selection and isolation of specific cells from tissue sections or live cell cultures based on observable phenotype. This approach preserves cellular structure and spatial information¹⁰. This technique has been extensively applied in liver disease research for downstream analyses. For instance, LCM has been used to collect biliary epithelial cells from liver biopsies to elucidate their immunoregulatory role in primary biliary cholangitis¹¹. In addition, it has been used to isolate γ-glutamyl transferase (GGT)-positive tissue from experimental models to confirm site-specific Ggt1 gene expression¹². But these studies have largely focused on fresh frozen tissues, which often lack clinical annotations or long-term follow-up¹³. In contrast, chemically fixed tissues offer advantages for histopathological diagnosis¹⁴. Although LCM-based RNA sequencing (RNA-Seq) has been successfully applied to archived, large-scale formalin-fixed and paraffin-embedded (FFPE) liver specimens¹⁵. However, a robust LCM-based gene expression profiling protocol specifically for microscale samples from paraformaldehyde (PFA)-fixed and Optimal Cutting Temperature (OCT) compound-embedded liver tissues is lacking.

To address this unmet need, a comprehensive protocol was optimized using PFA-fixed, OCT-embedded cryosections. This protocol addresses the limitations of FFPE workflows (e.g., prolonged processing and harsh chemicals) for sensitive LCM-RNA applications¹⁶. In contrast, the fixation and embedding process for PFA-fixed, OCT-embedded samples is relatively simpler and more flexible, enabling rapid preparation of high-quality sections that preserve both RNA integrity and tissue morphology. Furthermore, this protocol is performed using an ultraviolet (UV) laser-based LCM system. Compared to infrared systems, UV-LCM provides finer cutting resolution and enables direct, non-contact sample collection, minimizing contamination and making it suited for the precise isolation of microscale regions from complex tissue architectures^17,18. Therefore, the operational value of this protocol lies in its ability to perform morphology-preserving capture of microscale regions (~1,000 cells) from PFA-fixed liver sections. It yields RNA suitable for targeted gene expression analysis, allowing direct correlation between histopathological features and local transcriptomic profiles.

Here, we describe a protocol for laser capture microdissection of microscale tissue (~1,000 cells) from PFA-fixed, OCT-embedded mouse liver sections, followed by RNA extraction and downstream analysis by quantitative reverse transcription PCR and RNA sequencing. These procedures can be completed within five days.

To guide readers in assessing the applicability of this protocol, the key scope and limitations are summarized below. This protocol is specifically optimized for hypothesis-driven, morphology-guided sampling of specific histological regions from PFA-fixed, OCT-embedded tissues, with a primary application in mouse liver. It is suited for researchers who need to correlate spatially resolved transcriptomic data with precise histopathological features preserved in fixed specimens. The workflow is particularly valuable when working with archived or clinically annotated fixed tissues where fresh-frozen samples are unavailable. However, this protocol is not ideal for studies requiring high-integrity, non-fragmented RNA (e.g., RNA integrity number (RIN) > 8), as the inherent fragmentation from chemical fixation limits its use in applications that depend on full-length transcripts.

Protocol

All procedures for animal handling and care were performed in accordance with ethical guidelines and approved by the Animal Ethics Committee at Southern Medical University. The described method used adult male C57BL/6J mice and was maintained on a high-fat, high-sugar, choline-deficient diet to model metabolic-associated steatohepatitis (MASH). Before harvesting liver tissue, the animals were euthanized by decapitation.

1. Preparation of PFA-fixed specimen

1. Fix fresh liver tissue samples (individual lobes, 5 mm thickness or less) in 30 mL of cold 4% PFA (freshly prepared) at 4 °C for 24 h.
   NOTE: It is recommended to perfuse the liver with phosphate-buffered saline (PBS, 1×, typically composed of 137 mM NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄, and 1.8 mM KH₂PO₄, pH 7.4) solution at 1× concentration for 5 min, followed by perfusion fixation with 4% PFA for 5 min. Alternatively, the tissue may also be fixed in 10% formalin solution.
   CAUTION: PFA fixative is toxic. All PFA waste must be collected in a designated, properly labeled chemical waste container in compliance with institutional and local regulations.
2. Wash the fixed tissue samples 3× times for 5 min with RNase-free 1× PBS solution.
3. Place the fixed liver tissue into a 50 mL tube filled with 50 mL of 30% sucrose (freshly prepared in sterile 1× PBS). Maintain the samples at 4 °C for 10-12 h.
4. Remove the tissue samples from the sucrose solution. Trim the samples to obtain easy-to-handle blocks (approximately 5 mm × 3 mm × 5 mm), then embed the samples into a cryomold (7 mm × 7 mm × 5 mm) containing OCT compound.
   NOTE: Adjust the tissue orientation with forceps if necessary.
5. Add OCT compound on top to fully cover the tissue samples, then immediately place the OCT-embedded tissue block on liquid nitrogen or dry ice to rapidly freeze the OCT compound and form a solid block. This rapid freezing is essential for obtaining high-quality cryosections.
   CAUTION: Wear cryogenic-resistant gloves to protect hands when handling cryogenic materials.
6. Place the OCT-embedded blocks at -80 °C until cryosectioning.

2. Cryosectioning for laser capture microdissection

1. Expose the polyethylene naphthalate (PEN) membrane slides to UV light for 30 min, then coat the slides with 0.1 mg/mL of poly-L-lysine, followed by air-drying. Then, seal the edges of the PEN membrane slide with a neutral mounting medium.
   NOTE: UV irradiation and poly-L-lysine treatment of PEN membrane slides can improve the adherence of tissue samples to the PEN membrane slides. Sealing the perimeter with a neutral mounting medium prevents water infiltration or bubble formation beneath the membrane, which is critical for maintaining LCM efficiency.
   CAUTION: Protect the skin and eyes from the UV light. Wear UV-blocking safety goggles or a face shield (rated for UV protection), as well as a lab coat, nitrile gloves, and long sleeves to cover exposed skin.
2. Wipe all accessible surfaces of the cryostat and all tools with an RNase decontamination agent, and clean the brush with 75% ethanol.
   CAUTION: Dispose of used ethanol wipes and solutions in accordance with local institutional environmental health and safety protocols.
3. Allow the instrument to reach and stabilize at −20 °C.
4. Retrieve the liver samples from -80 °C and place them into the cryostat for a minimum of 15 min.
5. Apply a thin layer (2-3 mm) of OCT compound onto the surface of the specimen stage. Place the specimen stage on a quick freeze shelf (or in the cryostat chamber) to pre-solidify the OCT layer.
6. Apply a small amount of OCT onto the pre-solidified OCT layer on the specimen stage. Retrieve the equilibrated tissue block (from step 2.4) and immediately place the block horizontally onto this OCT, hold it in place for 10-15 s to allow partial freezing and adhesion. Once secured, mount the specimen stage (with the attached tissue block) onto the cryostat specimen head.
7. Carefully insert the blade between the clamping plates and the back plates from one side of the cryostat, and then clamp the clamping lever.
8. Adjust the cryostat's thickness setting to 10 µm.
   NOTE: Adjust slice thickness as needed for the tissue, but maintain the thickness between 5-15 µm¹⁹.
9. Cut and mount the sections directly onto the pretreated PEN membrane slides inside the cryostat chamber maintained at -20 °C.
   NOTE: Each PEN membrane slide can accommodate 6-8 tissue sections. It is recommended that the entire sectioning process be completed within 1 h. Limiting sectioning time minimizes tissue exposure to ambient conditions, thereby reducing the risks of RNA degradation, tissue dehydration, and morphological artifacts, which are critical for preserving RNA quality and histological integrity for LCM and downstream analysis.

3. Hematoxylin staining for laser capture microdissection

1. Thaw the slides at room temperature (RT) for 20 min before use.
2. Wash the slides with RNase-free 1× PBS (3 times, 10 s each).
3. Immerse the tissue slides in filtered Mayer's hematoxylin solution (composed of 1.0 g/L hematoxylin, 0.2 g/L sodium iodate, 50 g/L aluminum ammonium sulfate dodecahydrate, 50 g/L chloral hydrate, and 1.0 g/L citric acid) for 5-10 s.
   NOTE: Pass the hematoxylin working solution through a 0.22 µm syringe filter membrane before staining.
4. Wash the slides with RNase-free water (3 times, 10 s each) to remove residual hematoxylin solution.
5. Assess staining quality under a microscope.
   NOTE: Optimally stained nuclei should appear crisp blue-purple against a clear background. Insufficient staining yields faint nuclei, while over-staining obscures cellular details. Only slides meeting these optimal staining criteria should proceed to the next step.
6. Blot the slides dry using absorbent paper and then air-dry completely (10-15 min).
   NOTE: Ensure that the slides are fully dried before proceeding with LCM. Then place the slides into the 50 mL centrifuge tubes and store them temporarily on ice until LCM is performed.

4. Laser capture microdissection

NOTE: The duration of the LCM experiment for each slide should be maintained between 30 min and 1 h. It is recommended that the entire LCM experiment be completed within 4 h. This limit is set to minimize RNA degradation at RT and to prevent the evaporation of the collection buffer in the tube cap, which is crucial for efficient sample retrieval. In practice, the target yield of approximately 1,000 cells from morphologically defined regions can be reliably harvested within 4 h.

1. Wipe the surfaces of the laboratory bench using the RNase decontamination agent.
2. Turn on the controller and allow the microscope to complete its initialization process.
3. Rotate the key clockwise from the Off position to the On position to initiate the laser system.
   NOTE: The laser system requires about 10 min to warm up.
4. Turn on the computer and open the LCM software, then wait for the initialization process to complete.
5. Insert a sterile 0.2 mL PCR tube (collection tube) into the collection device.
6. Add 10 µL of a proteinase K digestion buffer (see the Table of Materials) to the cap of the PCR tube.
   NOTE: The total volume of proteinase K digestion buffer will be brought to 150 µL in a subsequent step (see Step 5.4.1) as part of the complete lysis procedure.
7. Load the collection device into the microscope's specimen holder.
8. Within the Change Collector Device window, first select Move to Reference Point button. Next, adjust the camera focus to ensure a clear view of the reference point. If necessary, use the arrows in the window to center the reference point in the field of view.
9. Load a tissue section into the specimen holder, ensuring the tissue section is oriented face down, and the label is to the right.
10. Select the 10× objective lens, identify and outline regions of interest exhibiting specific pathological features, such as microvesicular steatosis (characterized by hepatocytes with numerous small, clear cytoplasmic vacuoles and centrally located nuclei). Then, navigate to the Laser menu and click the Calibrate button. Confirm the on-screen message by selecting Yes and proceed with calibration.
    NOTE: The 10× objective lens is not exclusive for microdissection; other magnification lenses (e.g., 20×) can be selected based on sample clarity and the desired resolution.
11. In the laser control panel, set the cutting parameters to: Laser Power = 50, Aperture (laser beam diameter) = 5, and Speed = 9.
    NOTE: The above-listed parameter values serve as a reference for the UV-LCM system with the tissue samples used in this protocol. Users of other UV-LCM systems should consider these as a starting point and will likely need to adjust settings empirically. Optimal settings may vary with tissue type, section thickness, and other LCM systems.
12. Draw a circle around the target area using the graphic toolbar. Select the Single Shape, click the Start Cut button to perform LCM, and then position the collection device to collect the dissected tissue.
    NOTE: Successful detachment is indicated by a separation of the selected area, often with a visible gap or fragment movement. For consistency, collect from a pre-defined number of regions of similar size per sample. If the target area does not detach automatically, click the Move and Cut button to cut the specimen manually using the mouse. For a more precise estimate of cell number, LCM software can automatically record the total cut area. This value can be divided by the average cross-sectional area of a target cell to approximate the total number of cells captured.
    CAUTION: During the LCM process, do not stare directly at the laser beam to avoid laser radiation exposure.
13. Optionally, capture a Before and After image of the dissection site by selecting the Save Image As command in the File menu. In the dialog box, choose a location, filename, and save in a preferred format (e.g., .tif).
14. Upon collecting the desired number of cells, click the Unload button to remove the collector from the stage. Before sealing the PCR tube, verify that the proteinase K digestion buffer volume in the cap remains at 10 µL; replenish the buffer if evaporation occurred during LCM (see Step 4.6).
    NOTE: Adding 10 µL of the buffer ensures that the cap surface is fully wetted, which facilitates the efficient transfer of the micro-dissected tissue pellet during centrifugation in Step 4.16.
15. Vortex the collection tubes thoroughly.
16. Spin the collection tubes briefly and store the sample tubes at -80 °C until RNA extraction.
    NOTE: Repeat Steps 4.5 to 4.16 for the next sample. The protocol can be paused until RNA extraction.

5. Total RNA extraction of micro-dissected samples

1. Wipe the surfaces of the laboratory bench using the RNase decontamination agent.
2. Transfer the LCM samples from the -80 °C freezer to an ice bath. If desired, pool different batches of the same captured samples.
3. Incubate the micro-dissected sample tubes upside down at 42 °C for 30 min.
   NOTE: This inversion ensures that any tissue remaining adhered to the cap after brief centrifugation (Step 4.16) is released into the digestion buffer. This ensures maximal sample transfer into the buffer prior to the volume adjustment and high-speed centrifugation in Step 5.4.1.
4. Isolate total RNA from LCM samples using a standard RNA extraction kit optimized for fixed tissues (see the Table of Materials).
   1. Adjust the volume in each sample tube to a final 150 µL with the proteinase K digestion buffer (see the Table of Materials). Spin the tubes at 11,000 × g (1 min), then transfer the samples to a sterile 1.5 mL tube.
   2. Add 10 µL of proteinase K (20 mg/mL) per tube, then gently mix the samples through repeated pipetting. This results in a final volume of 160 µL and a final proteinase K concentration of approximately 1.25 mg/mL in the digestion reaction per sample.
   3. Perform a two-step sample incubation: first at 56 °C for 15 min, followed by 15 min at 80 °C. During each incubation, briefly vortex the tubes every 5 min.
      NOTE: For optimal workflow, use two pre-heated water baths. If using a single bath, pause after the 56 °C incubation: hold the samples at RT while the bath heats to 80 °C, then proceed.
   4. Place the samples for 3 min on ice, followed by centrifugation at 20,000 × g (15 min).
   5. Aspirate the clarified supernatant to a new 1.5 mL tube, taking care to avoid the pellet.
   6. Add 16 µL of DNase incubation buffer and 10 µL of DNase I enzyme (2.73 units/µL, see the Table of Materials) to each sample. Then, mix the contents thoroughly by gently inverting the tubes. This results in a final volume of 186 µL and a final DNase I concentration of approximately 0.15 units/µL in the digestion reaction per sample.
   7. Perform a quick spin to collect residual liquid from the tube walls.
   8. Incubate the sample tubes at RT for 15 min.
   9. Transfer 320 µL of high-salt wash buffer (see the Table of Materials) to each sample and mix the samples thoroughly. This results in a final volume of 506 µL per sample.
   10. Transfer 720 µL of absolute ethanol to each tube, mix the samples by pipetting (no centrifugation), and proceed immediately. This results in a final volume of 1,226 µL per sample.
       CAUTION: Absolute ethanol is highly flammable. Collect waste ethanol in a designated non-halogenated organic solvent waste container for proper disposal.
   11. Transfer 700 µL of the sample mixture to a purification column (placed in a 2 mL collection tube, see the Table of Materials). Gently close the lid, and centrifuge at 8,000 × g (15 s).
   12. Discard the flowthrough of the collection tube. Retain the purification column.
   13. Repeat Steps 5.4.11 to 5.4.12.
   14. Add 500 µL of ethanol-based wash buffer (see the Table of Materials) to each sample tube. Gently close the lids, and centrifuge at 8,000 × g (15 s). Then, discard the flow-through of the collection tube.
   15. Repeat Step 5.4.14 in its entirety, with the sole modification of increasing the centrifugation time to 2 min at 8,000 × g.
   16. Transfer each purification column to a new 2.0 mL tube. Centrifuge at 14,000 × g (5 min) with the cap open, then discard the tube and residual liquid.
   17. Transfer each purification column to a new 1.5 mL tube. Pipette 16 µL of RNase-free water onto the membrane, close the cap, and centrifuge at 14,000 × g (5 min) to facilitate the elution of the total RNA.
       NOTE: Keep all eluted RNA samples on ice for Steps 5.5 and 5.6 to prevent degradation.
5. Quantify the RNA samples and check the purity (A₂₆₀/A₂₈₀ ratio) by spectrophotometry.
   NOTE: The measurement of concentration and purity (A₂₆₀/A₂₈₀ ratio) in this step, along with the integrity assessment in Step 5.6, serves as the definitive quantitative checkpoint for successful RNA recovery. A clear RNA eluate is expected.
6. Perform agarose gel electrophoresis with a 1% gel concentration and determine the RNA integrity number (RIN) using a Bioanalyzer system to evaluate RNA quality.
7. Store the RNA samples at -80 °C until performing qRT-PCR or RNA-Seq.

6. RNA analysis

NOTE: qRT-PCR is described in Steps 6.1 and 6.2, and RNA-Seq is described in Step 6.3.

1. Prepare the reverse transcription reaction mixture and add 50 ng of total RNA per reaction on ice. Proceed with the reverse transcription reaction using a thermal cycler according to the instructions provided (see the Table of Materials).
2. On ice, prepare quantitative PCR master mix for β-actin according to the manufacturer's instructions (see the Table of Materials for primer sequences). Perform real-time PCR amplification on a quantitative PCR system using the manufacturer's recommended cycling protocol with 10 ng of cDNA per reaction.
3. Using a low-input stranded kit (see the Table of Materials), construct RNA-Seq libraries from 50 ng of total RNA. Determine the library size and concentration with a bioanalyzer system (see the Table of Materials) and then perform paired-end sequencing on a high-throughput platform (see the Table of Materials).

Results

The experimental workflow, which includes PFA fixation, 30% sucrose dehydration, OCT embedding and cryosectioning, hematoxylin staining, identification and precise collection of the target region (~1,000 cells) by LCM, cell lysis, RNA isolation, RNA quality control metrics and the two key analytical applications, is outlined in Figure 1. The hematoxylin-stained liver section on the PEN slide is shown under the microscope before (Figure 2A) and after (

Discussion

The strength of LCM lies in its precise, in situ capture of selected cells or tissue regions, facilitating the study of specific areas within a heterogeneous tissue. But its low sample yield, time-consuming process, high cost, and the need for specialized equipment limit the widespread application of this technique in laboratories²³. In this study, the LCM-RNA protocol was established to overcome key historical limitations. This protocol implemented a rapid hematoxylin staining step (~10 ...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Material
0.2 ml Thin-walled Tubes	Axygen	PCR-02-C	Tubes for LCM collection
1.5 mL centrifuge tube	Axygen	339653
4% paraformaldehyde	Leagene	DF0135
50 mL centrifuge tube	ThermoFisher Scientific	339653
DEPC (diethyl pyrocarbonate)	Sigma	D-5758
DNase I digestion set	Qiagen	73504	Component of the RNeasy FFPE Kit, includes DNase I stock solution and DNase Booster Buffer
Ethanol (100%)	Thermo Fisher Scientific	BP2818	Purified for molecular biology
Ethanol-based wash buffer	Qiagen	73504	Buffer RPE (component of RNeasy FFPE Kit)
High-salt wash buffer	Qiagen	73504	Buffer RBC (component of RNeasy FFPE Kit)
Low profile microtome blades	Leica Biosystems	819
Mayer’s hematoxylin	Leagene	DH0001
OCT compound	Sakura	4583
PEN membrane-coated slide	Leica	11505188
Phosphate buffered saline	Leagene	CC0010	DNase/RNase-free
Poly-L-lysine	Macklin	P875131S
proteinase K digestion buffer	Qiagen	73504	Buffer PKD (component of RNeasy FFPE Kit)
Purification column	Qiagen	73504	RNeasy MinElute spin column (component of RNeasy FFPE Kit)
Quantitative PCR master mix	Takara Bio	RR820A	TB Green Premix Ex Taq II (Tli RNaseH Plus)
Reverse transcription kit	Qiagen	205411	QuantiNova Reverse Transcription Kit
RNA extraction Kit	Qiagen	73504	RNeasy FFPE Kit
RNA Sequencing Kit (Low-input, Stranded)	Takara Bio	634412	SMARTer stranded total RNA-seq kit - pico input mammalian v2
RNase decontamination agent	Solarbio	SR0040	Cleaning
Sucrose	Macklin	S818049
Animals and Diet
Mouse: C57BL/6J	Laboratory Animal Center of Guangdong Province	03
Special diet & drinking water
High-fat, choline-deficient diet (Base diet)	TROPHIC Animal Feed High-Tech Co., Ltd.	TP36310M	Macronutrients: protein, 14 kcal%; carbohydrates, 26 kcal%; fat, 60 kcal%)
Sugar supplemented drinking water	Macklin	N/A (prepared in-house)	A mixture of D-glucose (Macklin, Cat# F87500) and D-fructose (Macklin, Cat# S818049) was added to autoclaved drinking water at a final concentration of 42 g/L, with a glucose-to-fructose ratio of 55:45 (w/w)
Mouse Primers
β-actin (Forward: AGAGGGAAATCGTGCGTGAC )	BGI Sequencing	Customized	HPLC purified
β-actin (Reverse: CAATAGTGATGACCTGGCCGT)	BGI Sequencing	Customized	HPLC purified
Equipment
Cryostat microtome	Leica Biosystems	CM3050 S
Bioanalyzer system	Agilent	G2939BA
High-throughput sequencing platform	Illumina; Inc.	NovaSeq 6000 system
Laser Capture Microdissection system	Leica Microsystems	Leica LMD6500
Quantitative PCR system	Applied Biosystems	QuantStudio 5 Real-Time PCR System
Spectrophotometer	ThermoFisher Scientific	NP80	NanoDrop
Thermal Cycler	BioRad	T100
Software
Adobe Illustrator CC 2019 (version 23.0.2)	Adobe	https://www.adobe.com/products/illustrator.html
GraphPad Prism (version 8.3.0)	GraphPad Software	https://www.graphpad.com