Here, we present a protocol to capture RNA-associated chromatin DNA-DNA interactions for mapping RNA-related three-dimensional genome organization.
Method Article
Here, we present a protocol to capture RNA-associated chromatin DNA-DNA interactions for mapping RNA-related three-dimensional genome organization.
RNA-Associated Chromatin DNA-DNA Interaction Method (RDD) is a targeted strategy for mapping chromatin interactions anchored by a specific RNA. It simultaneously identifies genomic loci associated with the RNA of interest and resolves long-range DNA-DNA contacts among these loci, enabling inference of spatial organization and regulatory relationships. In RDD, biotinylated antisense probes complementary to the target RNA are used to enrich RNA-chromatin complexes. Cells are crosslinked, chromatin is fragmented and end-repaired, and proximity ligation is performed using a designed linker to join DNA fragments that are spatially adjacent within the captured complexes. The ligation products are purified, converted into sequencing libraries, and analyzed by high-throughput sequencing to generate RNA-anchored interaction maps. RDD is applicable to endogenous RNAs as well as exogenous RNAs derived from host-infecting microorganisms and viruses, and it is compatible with diverse cell types and experimental conditions. The method yields locus-specific, high-resolution contact profiles suitable for dissecting enhancer-promoter pairing, long-range regulation, and three-dimensional genome architecture associated with regulatory coding and non-coding RNAs. By integrating biochemical enrichment with proximity ligation and next-generation sequencing, RDD provides a robust and reproducible workflow to reveal how RNAs organize chromatin and influence gene expression.
Hi-C and ChIA-PET have transformed studies of three-dimensional (3D) genome organization by converting spatial proximity among chromatin fragments into covalent DNA junctions that can be sequenced to infer physical contacts across scales from loops to compartments1,2. Beyond proteins, numerous RNAs participate in chromatin interactions, influencing enhancer/repressor-promoter communication and higher-order chromatin organization3; however, despite advances in protein-anchored assays, it remains challenging to determine directly how a specific RNA organizes long-range DNA-DNA interactions among its bound loci. The overarching goal of the RNA-Associated Chromatin DNA-DNA Interaction Method (RDD)4 is to generate high-resolution, RNA-anchored chromatin interaction maps that reveal how a defined RNA species associates with chromatin and orchestrates DNA-DNA contacts within its local neighborhood, enabling mechanistic inference about enhancer/repressor-promoter communication and higher-order genome architecture centered on that RNA5. Methodologically, RDD enriches crosslinked RNA-chromatin complexes with biotinylated antisense probes against the RNA of interest, performs on-complex proximity ligation with a designed linker to join spatially adjacent DNA fragments, and constructs sequencing libraries to yield locus-specific contact profiles suitable for hypothesis-driven analyses across diverse cell types and conditions, including contexts involving exogenous bacterial or viral RNAs in infected hosts. These features position RDD as an RNA-anchored counterpart to established chromosome-conformation methods, providing interpretable contact information at resolutions appropriate for regulatory analysis.
The rationale for RDD stems from limitations of existing RNA-chromatin mapping strategies. Targeted capture approaches such as ChIRP-seq and CHART-seq identify genome-wide DNA occupancy of a single RNA, a one RNA to all DNA paradigm that reports binding but not the physical DNA-DNA contacts among occupied loci6,7. Global assays, including GRID-seq and MARGI, have extended to all RNA to all DNA, cataloging RNA-DNA proximities genome-wide yet lacking explicit resolution of DNA-DNA contacts within RNA-centered complexes3,8. Multiplexed methods such as RD-SPRITE report higher-order co-localization among many RNAs and DNA loci and convey aspects of nuclear topology9, but signals are typically dominated by abundant RNAs, which can obscure low-abundance regulatory RNAs and limit targeted depth for a single RNA's interaction network. Protein- or mark-anchored enrichment-plus-ligation strategies, such as ChIA-PET10, PLAC-seq11, and HiChIP12, effectively map factor-centered loops but do not anchor interactions to a defined RNA without an RNA-specific capture module, leaving the RNA-anchored DNA-DNA dimension unresolved. By integrating targeted biochemical enrichment with on-complex proximity ligation, RDD directly captures DNA-DNA contacts among chromatin fragments co-occupied by the RNA of interest4, increases sensitivity and specificity for low- to moderate-abundance RNAs, and generates high-resolution, locus-specific contact maps that complement occupancy-centric (ChIRP/CHART)6,7 and proximity-centric global methods (GRID-seq/MARGI/RD-SPRITE)3,8,9 while conceptually paralleling protein factor-anchored ligation strategies (ChIA-PET/PLAC-seq/HiChIP)10,11,12. Readers should consider RDD when a biological question requires resolving spatial relationships among chromatin loci specifically associated with a target RNA -- particularly when that RNA is hypothesized to scaffold, bridge, or constrain long-range genomic interactions to tune transcription -- or when prioritizing putative regulatory targets from an RNA's binding set, distinguishing direct RNA-centered hubs from mere co-occupancy, delineating enhancer/repressor networks for specific RNAs, or tracking rewiring of RNA-anchored contacts across perturbations, developmental stages, or infections. In such scenarios, RDD addresses an unmet need by delivering RNA-anchored DNA-DNA interaction information with the sensitivity, specificity, and resolution required for rigorous mechanistic studies.
NOTE: For this RDD method, the example system uses Drosophila S2 cells and both the roX2 and 7SK ncRNAs; reaction reagents are listed in Table 1, buffer compositions are in Table 2, reagent details and instrument details are in Materials . Figure 1 provides an overview of the protocol for RDD library generation. Procedures involving rotation (F8) use the following parameters: F8, 20 rpm, uu20, and UU30. For all buffers used from Step 2 to Step 10, freshly supplement with 1x proteinase inhibitor (PI) and RNase inhibitor (RI, 0.05 U/µL).
Probe design principles: For novel, unreported RNA, design probes online with the Stellaris Probe Designer, then filter out non-specific sequences using alignment tools (e.g., BLAST-like alignment) or UCSC BLAT, followed by 3′-biotinylation of the selected probes. For new target RNAs, design sequences that match the target RNA to serve as negative controls, also subjected to 3′-biotinylation. Quality control involves designing reverse transcription primers against the target RNA for transcription validation and genomic DNA-targeted primers for qPCR to assess contamination; include primers locating genomic binding sites and non-binding regions to evaluate binding specificity. roX2 and 7SK related probes are provided in Table 1.
1. Cell harvest and dual crosslinking
2. Cell lysis and nuclei permeabilization
3. Chromatin fragmentation
4. Preclear chromatin with C1 beads
5. Hybridize the RNA probe with the precleared chromatin
6. Immobilize probe - chromatin complex on C1 beads
7. Blocking unoccupied sites on C1 beads with denatured Iodoacetyl-PEG2-Biotin (IPB)
8. Chromatin end-repair (on beads)
9. Chromatin A-tailing (on beads)
10. Chromatin proximity ligation (on beads)
11. Releasing the proximity-ligated chromatin DNA from the C1 beads
12. Proximity-ligated DNA purification (with Phenol: Chloroform: IAA reagents)
13. Proximity-ligated DNA Tn5 tagmentation
14. Blocking M280 beads
15. Immobilization of ligated DNA on M280 beads
16. Amplification of ligated-DNA on M280 beads
This protocol outlines the RDD method for detecting RNA-associated chromatin DNA-DNA interactions. The workflow begins with biochemical enrichment of RNA-chromatin complexes using biotinylated probes, followed by proximity ligation to link spatially adjacent DNA fragments. After constructing sequencing libraries, high-throughput sequencing is performed.
Bioinformatic analysis of RDD data is streamlined by the ChIA-PIPE platform13. Key steps in this analytical pipeline include: trimming sequencing linkers from raw reads, mapping paired-end reads to the reference genome, filtering for uniquely mapped read pairs, removing PCR duplicates, and assigning interactions to targeted RNA sites based on probe coordinates. Typically, about 50% of sequenced reads are successfully retained after linker and quality filtering. Valid interaction events were then aggregated to generate locus-specific contact maps, providing detailed profiles of RNA-guided chromatin architecture. For RDD data, we implemented three ChIA-PIPE adjustments: the RDD linker sequence ("ACGCGATATCTTATCTGACT") was used in place of the default ChIA-PET linker ("ACGCGATGGCTACTCTGACT"); loop clustering was performed with a shortened PET extension of 50 bp in addition to the default 500 bp to increase positional precision of RNA interaction sites; and RNA enrichment coverage was computed with deepTools (bamCoverage v3.5.1) using a 1 bp bin size. These modifications-linker configuration, reduced PET extension for finer clustering, and high-resolution coverage-adapt ChIA-PIPE for the RDD libraries.
Figure 4 displays representative RDD results for two non-coding RNAs: roX214 (Figure 4A,C; green), a dosage compensation complex RNA involved in regulating X-chromosome structure and gene expression in Drosophila, and 7SK15 (Figure 4B,D; purple), a highly conserved small nuclear RNA that modulates transcription elongation by regulating P-TEFb activity in metazoans. RNA binding and chromatin interactions detected by RDD are visualized together with RNAPII ChIA-PET data (blue arcs), highlighting the structural relationship between RNA-associated loops and key regulatory elements such as promoters (P), enhancers (E), and transcription start or end sites (TSS/TES). Prominent interaction peaks in the aggregated data support a model in which both roX2 and 7SK mediate critical enhancer-promoter or long-range chromatin contacts.
Multi-dimensional analysis is achieved by integrating RDD-anchored interactions with Hi-C genome-wide chromatin conformation maps (bottom panel red heatmaps) and epigenomic marks (H3K27ac, H3K27me3), nascent transcription (RNA-seq), and RNAPII ChIA-PET data (Figure 4C,D). In these regions, topologically associating domains (TADs) are clearly visualized, with RNA-guided chromatin loops often situated at TAD boundaries or spanning multiple TADs. Additional annotation with histone modification and transcription data enables discrimination between active and inactive chromatin regions. Key RNA-centric regulatory hubs are circled in the figure.
Distinct patterns emerge for different ncRNAs. roX2 is characterized by binding at TES regions and looping to TSSs, frequently localizing at TAD boundaries and forming long-range contacts that can cross multiple TADs. In contrast, 7SK predominantly binds to enhancers and forms shorter-range loops with neighboring promoters, generally without traversing TAD borders.
Collectively, these results affirm that RDD is a reliable and high-resolution method for dissecting RNA-specific 3D chromatin organization. This approach enables direct investigation into the spatial roles of regulatory RNAs in genome architecture and gene expression across diverse biological settings.

Figure 1: Schematic of the RDD library generation workflow. The central workflow steps for RDD library generation are shown in sequence and accompanied by corresponding schematic illustrations. The procedure begins with dual-crosslinking and chromatin tagmentation, followed by hybridization with a biotin-modified RNA probe and immobilization via streptavidin. Subsequent steps include A-tailing, proximity ligation with biotin-modified linkers, and library construction. After ligating the DNA, purification, Tn5-mediated fragmentation, biotin enrichment, and library amplification are performed. Please click here to view a larger version of this figure.

Figure 2: Representative microscopy images of Drosophila S2 cells demonstrating visual quality control criteria for cell lysis and nuclei permeabilization. (A) Successful cell lysis is characterized by plasma membrane permeabilization and cytoplasmic release, making the nuclei readily visible. (B) Successful nuclei permeabilization is indicated by cell swelling, partial detachment of the plasma membrane, and intact, clearly visible nuclei. Scale bar = 100 µm. Please click here to view a larger version of this figure.

Figure 3: Electropherogram analysis of chromatin preparations. Screenshot of a capillary electrophoresis system electropherograms profiling various chromatin samples. (A) Displays fragmented chromatin (sonication) with a size ranging from approximately 1000 to 3000 bp, indicating successful fragmentation. (B) Illustrates chromatin associated with RNA (RNA-associated + unbound probes), with a smaller peak representing unbound probes, as indicated by the arrow. (C) Shows RNA-associated chromatin, also exhibiting a concentration range from 1000 to 3000 bp, reflective of RNA-protein complexes. (D) Depicts chromatin tagged with Tn5, revealing a range indicative of tagmentation efficiency. (E) Displays the fragment size distribution of the sequencing library after amplification, spanning approximately 180-1000 bp. (F) Shows the fragment size distribution of the sequencing library after size selection, with fragments predominantly enriched in the ~250-600 bp range. The RFU (relative fluorescence units) values are indicated for each sample, demonstrating effective quantification of chromatin integrity and size. The purple peaks represent the marker. Please click here to view a larger version of this figure.

Figure 4: Representative results of RDD for ncRNA-associated chromatin interactions. (A-B) Displays the genomic locations of ncRNA roX2 (green) and 7SK (purple) binding, along with the corresponding remote chromatin interaction loops. Data from RNAPII ChIA-PET (blue) reveals a clear regulatory relationship between these ncRNAs and gene expression, with peaks indicating interaction strength. Abbreviations: TSS = transcription start site; TES = transcription end site; P = promoter; E = enhancer. (C-D) Provides a higher-dimensional view of the relationship between ncRNA roX2 and 7SK-related chromatin loops and TADs (red), as well as the differing active versus inactive chromatin states and gene expression levels. Circles highlight areas with significant interactions across TADs. Please click here to view a larger version of this figure.
Table 1: RDD reaction reagents. Please click here to download this Table.
Table 2: RDD buffer compositions. Please click here to download this Table.
Critical steps in the method
Estimating the quantity of RNA probes and the corresponding RNA levels in chromatin is crucial. Excess probes can lead to unbound probes occupying streptavidin sites during the immobilization step, which can hinder the intended capture of target RNA interactions. Additionally, adding too much streptavidin wastes materials and requires more denatured IBP for effective blocking of vacant sites. Insufficient blocking can negatively impact the efficiency of subsequent proximity ligation, especially as the proximity ligation linker also features biotin modifications. If blocking is not adequately performed, portions of the linker may bind directly to the streptavidin beads, complicating results. Moreover, the ratio of linker to chromatin must be carefully estimated-too much linker can cause both ends of chromatin DNA to be tagged, inhibiting effective proximity ligation.
Modifications of the method
In this study, we illustrate the RDD method using Drosophila S2 cells with roX2 ncRNA as an example. The reagent volumes need adjustment based on cell type and ncRNA expression levels; if ncRNA expression is high, one can reduce cell quantity or increase RNA probe concentration, and vice versa. Although this protocol immobilizes chromatin on beads, an alternative approach involves performing in situ proximity ligation followed by enrichment with RNA probes.
Specificity, controls, and QC
We previously described and validated RDD and performed parallel RDDs on multiple RNAs, showing strong specificity; readers may refer to the prior work4,16. RDD requires probe-dependent, locus-specific enrichment that is reproducible and, where possible, orthogonally validated. True interactions meet three criteria: enrichment at probe-targeted loci versus nearby non-binding regions; probe dependence (absent or markedly reduced in negative controls); and reproducibility across biological replicates and independent validation (e.g., RT-qPCR). Antisense probes were designed with Stellaris, screened by BLAST/BLAT to remove off-targets, ordered with 3'-biotin, and validated by RT and qPCR (including DNA-contamination checks and site vs non-site enrichment). We recommend three controls -- no-probe, scramble/non-targeting, and unrelated-RNA or non-binding-region probes -- and assess specificity by comparing qPCR or sequencing coverage across target and control samples, reporting fold-enrichment and background. For low-abundance RNAs, increase probe density (within off-target constraints), raise sequencing depth, and perform orthogonal validation.
Troubleshooting the method
If captured RNA-chromatin interactions are notably low, the efficiency of proximity ligation may need optimization through adjustments of linker and chromatin quantities. Additionally, high peaks of unbound probes were observed through automatic capillary electropherograms. Results indicate that too many probes were added, which can be rectified by reducing the amount used.
Limitations of the method
A key advantage of the RDD method is its efficiency in capturing specific RNA-associated chromatin interactions, meaning each experiment can only focus on one specific RNA at a time. Furthermore, as proximity ligation is designed to detect pairwise interactions, multiple-site interactions cannot be assessed simultaneously.
Significance of the method
The RDD method not only reveals RNA binding sites but also elucidates the interaction relationships among those sites, enhancing our understanding of chromatin architecture.
Practical uses and future potential of RDD
RDD is suitable for various chromatin-associated RNAs, including endogenous host RNAs and exogenous RNAs from viruses or other microorganisms, highlighting its broad applicability in different research fields.
A patent (Chinese Patent No. ZL202210182253.X) related to the RDD technology described in this protocol has been granted.
This work was supported by grants from the National Key R&D Program of China (2022YFC3400400 and 2022YFC3400401) and the National Natural Science Foundation of China (32170644).
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| 0.5 M EDTA | Invitrogen | AM9260G | |
| 1 M Magnesium acetate | Sigma-Aldrich | 63052-100ML | |
| 1 M Tris-HCl pH 7.0 | Invitrogen | AM9851 | |
| 1 M Tris-HCl pH 8.0 | Invitrogen | AM9856 | |
| 1.5-mL Tubes | Eppendorf | 30108051 | |
| 10 mM dATP | Invitrogen | 18252015 | |
| 10% SDS (wt/vol) | Invitrogen | AM9822 | |
| 10× A-tailing buffer | NEB | B7002S | |
| 10× End-repair buffer | NEB | B6002S | |
| 10× T4 DNA ligase buffer | NEB | B0202S | |
| 10× TBE buffer | Invitrogen | AM9863 | |
| 14-mL Round-bottom test tubes | Corning | 352057 | |
| 2× PCR master mix | NEB | M0541 | |
| 20× SSC buffer | Invitrogen | AM9770 | |
| 200-μL PCR tubes | Sangon Biotech | F611541-0010 | |
| 250-mL Square PET storage bottles | Corning | 431531 | |
| 2-Mercaptoethanol (β-ME) | Sigma-Aldrich | M6250-100mL | ! CAUTION β-ME is toxic; always use it in a fume hood. |
| 2-mL Tubes | Eppendorf | 22431048 | |
| 3 M Sodium acetate pH 5.5 | Invitrogen | AM9740 | |
| 5 M NaCl | Invitrogen | AM9759 | |
| 5 M Potassium acetate | Sigma-Aldrich | 95843-100ML-F | |
| 500-mL Square PET storage bottles | Corning | 431532 | |
| Analytical balance | Sartorius | BP211D | |
| Automated cell counter | Counterstar | IC1000 | |
| Automatic capillary electrophoresis system | Bioptic | C100100 | |
| Biotinylated probes | GENEWIZ | Refer to Table 1 | |
| Blocking powder | Invitrogen | T2015 | |
| Bridge linker oligos | GENEWIZ | Refer to Table 1 | |
| CO2 incubator | Thermo Scientific | 51033549 | |
| Dimethyl sulfoxide (DMSO) | Sigma-Aldrich | D2650-100mL | |
| DNA library preparation kit V2 for Illumina | Vazyme | TD501 | |
| DNA purification kit | Zymo | D4013 | |
| Dulbecco’s phosphate buffered saline (DPBS) (1×) | Gibco | 14190250 | |
| EDTA-free protease inhibitor cocktail | Roche | 11836170001 | |
| EGS (Ethylene glycol bis[succiniMidylsuccinate]) | Thermo Scientific | 21565 | |
| Elution buffer | Qiagen | 19086 | |
| Ethyl alcohol, pure | Sigma-Aldrich | E7023-500mL | |
| Formaldehyde solution | Sigma-Aldrich | 47608-250mL-F | ! CAUTION Formaldehyde is toxic; always use it in a fume hood. |
| Formamide | Invitrogen | AM9342 | |
| Gel imaging system | Tanon | 3500R | |
| Glycine | Invitrogen | 50046-1kg | |
| Glycogen with blue dye | Invitrogen | AM9516 | |
| High sensitivity cartridge | Bioptic | C105105 | |
| High-density phase-lock tubes (1.5 mL) | Qiagen | 129046 | |
| High-sensitivity dsDNA fluorometric assay kit | Invitrogen | Q32851 | |
| Index kit V2 for Illumina | Vazyme | TD202 | |
| Iodoacetyl-PEG2-Biotin (IPB) | Thermo Scientific | 21334 | |
| Isopropyl alcohol | Sigma-Aldrich | I9030 | ! CAUTION Isopropyl alcohol is toxic; always use it in a fume hood. |
| Kilo base cartridge | Bioptic | C105106 | |
| Klenow fragment (3'→5' exo-) | NEB | M0212L | |
| Magnetic beads | Beckman | A63881 | |
| Magnetic separation rack for 15-mL tube | Invitrogen | 12301D | |
| Magnetic separation rack for 2-mL tube | Invitrogen | 12321D | |
| Magnetic separation rack for PCR tube | NEB | S1515S | |
| Microbiological incubator | Thermo Scientific | IMH180 | |
| Microscope | Nikon | Eclipse TS2 | |
| Mixer | ELMI | RM-2L | |
| N,N-Dimethylformamide (DMF) | Sigma-Aldrich | 227056-100ML | ! CAUTION DMF is toxic; always use it in a fume hood. |
| Non-refrigerated microcentrifuge | Eppendorf | 5405000204 | |
| Nuclease-free water (not DEPC-treated, 1000 mL ) | Invitrogen | AM9932 | |
| Nuclease-free water (not DEPC-treated, 50 mL) | Invitrogen | AM9937 | |
| Nucleic acid quantifier | Invitrogen | Q33226 | |
| Orbital shaker | Crystal | SYC-2102 | |
| Phenol:Chloroform:IAA | Solarbio | P1012-100mL | |
| Proteinase K solution | Invitrogen | AM2548 | |
| Refrigerated centrifuge | Eppendorf | 22628180 | |
| Refrigerated incubator | Thermo Scientific | IMP180 | |
| Refrigerated microcentrifuge | Eppendorf | 5404F1621754 | |
| Refrigerator | Haier | DW-25L262 | |
| RNase inhibitor | Ambion | AM2696 | |
| RNase-free 15-mL tubes | Invitrogen | AM12500 | |
| RNase-free 50-mL tubes | Invitrogen | AM12502 | |
| Sonicator | Sonics & Materials | VCX130 | |
| Streptavidin-coated magnetic beads C1 | Invitrogen | 65001 | |
| Streptavidin-coated magnetic beads M-280 | Invitrogen | 11205D | |
| T4 DNA ligase | NEB | M0202S | |
| T4 DNA polymerase | NEB | M0203S | |
| TE buffer pH 8.0 | Invitrogen | AM9849 | |
| Thermal cycler | Bio-Rad | 1851148 | |
| Thermomixer | Eppendorf | 5382000023 | |
| Triton X-100 | Acros Organics | 327371000-100mL | |
| Ultra-low temperature freezer | Thermo Scientific | 995 | |
| Vacuum concentrator | TOMY | MV-100 |