RESEARCH
Peer reviewed scientific video journal
Video encyclopedia of advanced research methods
Visualizing science through experiment videos
EDUCATION
Video textbooks for undergraduate courses
Visual demonstrations of key scientific experiments
BUSINESS
Video textbooks for business education
OTHERS
Interactive video based quizzes for formative assessments
Products
RESEARCH
JoVE Journal
Peer reviewed scientific video journal
JoVE Encyclopedia of Experiments
Video encyclopedia of advanced research methods
EDUCATION
JoVE Core
Video textbooks for undergraduates
JoVE Science Education
Visual demonstrations of key scientific experiments
JoVE Lab Manual
Videos of experiments for undergraduate lab courses
BUSINESS
JoVE Business
Video textbooks for business education
Solutions
Language
English
Menu
Menu
Menu
Menu
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Research Article
Baihui Zeng1,2, Shurong Wang1, Cheng Li2,3,4
1Department of Ophthalmology Optometry Center,China-Japan Union Hospital of Jilin University, 2Eye Institute & Affiliated Xiamen Eye Center, School of Medicine,Xiamen University, 3Huaxia Eye Hospital of Quanzhou, 4Shen Zhen Research Institute of Xiamen University
Erratum Notice
Important: There has been an erratum issued for this article. View Erratum Notice
Retraction Notice
The article Assisted Selection of Biomarkers by Linear Discriminant Analysis Effect Size (LEfSe) in Microbiome Data (10.3791/61715) has been retracted by the journal upon the authors' request due to a conflict regarding the data and methodology. View Retraction Notice
A novel serum-free culture system using the small molecule combination 2C (Y27632 and SB431542) is introduced to efficiently expand lacrimal gland epithelial cells (LGECs) in both 2D and 3D cultures, enabling precise control of their proliferation and differentiation.
Lacrimal gland (LG) dysfunction is a major cause of aqueous-deficient dry eye disease, and cell-based and tissue engineering therapies show significant potential for this condition. However, the limited availability of sufficient seed cells cultured under serum-free conditions has hindered their widespread application. In this study, we developed a novel serum-free culture system using two small molecules, Y27632 and SB431542 (2C), to efficiently expand LG epithelial cells (LGECs). For the 2D primary culture of LGECs, LGs were isolated from 6-8 weeks old mice and enzymatically digested using Dispase II and Collagenase A. The resulting cell suspension was seeded into culture dishes at a density of 7,500 cells/cm2 and cultured with 2C for 12-14 days. When the cell confluence reached 80-90%, subculture was initiated at a 1:2 ratio. For 3D culture, 10,000 P1 LGECs were resuspended in 10 µL of 2C and 10 µL of matrix gel, then seeded in the center of a 24-well plate. After a 30 min solidification period at 37 °C, 600 µL of 2C was added for continued culture. For differentiation, the 3D spheroids were cultured with 2C for 7 days, followed by removal of 2C and continued culture for an additional 7 days. LGECs cultured with 2C exhibited high proliferation, with elevated expression of stemness and proliferation markers (Ki67, K14, P63, K5, K15 [P = 0.0011, 0.0002, 0.0012, 0.0003, 0.0014, respectively]), and maintained morphology and proliferative capacity even after ten passages. Furthermore, under 3D conditions, LGECs formed spheroids with stem/progenitor characteristics, which further differentiated into microglandular structures containing multiple LG cell types (AQP5, K19, α-SMA-positive) and mature secretory functions after the removal of 2C. This approach is expected to provide a stable source of seed cells for tissue engineering and offers a new in vitro model to study LG physiology.
The lacrimal gland (LG) is essential for producing the aqueous layer of the tear film, which is crucial for maintaining ocular surface homeostasis1. Dysfunction of the LG, caused by injury or inflammation, results in aqueous-deficient dry eye disease (ADDE). This condition can lead to severe ocular surface inflammation, chronic corneal disease, and, in severe cases, permanent vision loss2. Current treatments for ADDE primarily manage symptoms, without addressing the underlying glandular dysfunction, which limits their long-term efficacy1. The development of targeted therapies for LG dysfunction presents several challenges, including the lack of long-term, simple in vitro models, which limit the understanding of LG pathophysiology and hinder the development of effective therapies. While cell transplantation has shown potential in promoting LG regeneration, the limited expansion capacity of cells in vitro and the complexity of existing culture systems present significant obstacles to clinical application1,3. Therefore, establishing a simple, long-term culture system for adult mouse LGs is essential for advancing understanding of LG physiology and pathology, as well as providing a reliable source of LG stem/progenitor cells for LG injury repair and regeneration.
Existing in vitro culture systems for LG have made significant progress, but still face notable limitations. Many of these methods rely on serum-supplemented media, which introduces several issues such as batch-to-batch variability, undefined components, and the risk of fibroblast or mesenchymal cell contamination4,5,6,7,8. Moreover, serum-based systems are unsuitable for studying the pathogenic mechanisms of LG diseases and pose challenges for cell transplantation therapies due to potential immune rejection risks9. In response to these limitations, several serum-free methods have been developed for culturing LG epithelial cells (LGECs) from both mice and humans. For example, Ueda et al. successfully employed a serum-free method to culture LGECs from newborn mice10. However, this method was limited by the inability to pass the cells through subcultures and the need for a large number of neonatal glands to obtain sufficient LGECs. Similarly, Kobayashi et al. developed a serum-free culture system with cholera toxin, but faced difficulties in maintaining cellular morphology during passage11. Recent advancements include Zhang et al.'s development of a 3D culture system for mouse LG stem cells and Bannier-Hélaouët et al.'s LG organoid culture system for both mice and humans12,13,14,15. However, these systems rely on complex media formulations with multiple small molecules, growth factors, and additives, complicating the culture process and limiting scalability. These challenges highlight the need for a simplified, effective serum-free culture system that can facilitate the efficient expansion of LGECs, while maintaining their proliferative and stem/progenitor characteristics for further therapeutic applications and research.
In recent years, the rapid development of small molecule-mediated chemical reprogramming has introduced new strategies for maintaining and expanding primary adult cells in vitro16. By regulating intracellular signaling pathways, cell-matrix interactions, and cell adhesion, small molecules significantly enhance cell proliferation and plasticity, improving cell expansion efficiency and fate control17. Due to their controllable production, low immunogenicity, and non-genomic integration, small molecules are ideal for constructing in vitro systems for expanding adult epithelial cells16. Combinations of different small molecules have been shown to effectively maintain the in vitro expansion of various primary cell types, including skin, corneal, and conjunctival epithelial stem cells18,19,20. Therefore, developing a small molecule-based strategy for expanding LGECs shows potential for future applications in both research and therapeutic settings.
A simple and efficient serum-free culture system was developed in this protocol using two small molecules, Y27632 and SB431542 (2C), to support the expansion of LGECs. By combining the advantages of these two molecules, a serum-free system was established for both 2D and 3D cultures. LGECs cultured with 2C exhibited high proliferative capacity and stem/progenitor cell characteristics, maintaining typical epithelial cell morphology after at least 10 passages in vitro. In the 3D culture, LGECs not only retained stem/progenitor cell features but also exhibited the ability to further differentiate into secretory structures after the removal of 2C, forming microglandular structures with secretory function. This serum-free system is suitable for in vitro models of LG physiology and pathology, while also providing a substantial source of cells for LG tissue engineering and regenerative applications. However, the present protocol only provides a preliminary exploration of 3D culture. Long-term 3D culture is beyond the scope of this research at this stage. It is important to note that this method is designed specifically for adult mouse LGECs and may not be applicable to other species without further optimization.
All experiments were performed in compliance with the regulations of the Association for Research in Vision and Ophthalmology (ARVO) and the Experimental Animal Ethics Committee of Jilin University and Xiamen University.
NOTE: All cell culture procedures were performed in a UV-sterilized biosafety cabinet in the cell operation room.
1. Primary culture of LGECs
2. Subculturing of LGECs
NOTE: Subculture when the cell confluence reaches 80-90%, which typically occurs approximately 14 days after primary culture.
3. Three-dimensional (3D) culture of LGECs
NOTE: The 3D culture experiment uses P1 LGECs. When the P1 LGECs reach 80-90% confluence after 7 days of culture with 2C, they are used for 3D culture.
4. Embedding and frozen sectioning of differentiated 3D LGEC spheroids
NOTE: Differentiation of 3D spheroids is induced as described in section 3.3. After 7 days of differentiation, follow the steps below for optimal cutting temperature (OCT) embedding and frozen sectioning of the differentiated 3D spheroids.
5. Secretion function detection of differentiated 3D LGEC spheroids
6. RNA isolation
7. Quantitative RT-PCR (qRT-PCR)
8. Immunofluorescence staining
NOTE: Immunofluorescence staining is performed on LGECs cultured in 24-well plates with confluence rates of 70-80% or on frozen sections of differentiated LGECs 3D structures.
Establish a serum-free LGECs culture system using 2C
In this protocol, the aim was to establish a simpler, more efficient culture system for expanding primary mouse LGECs. After extensive screening, a serum-free 2C combination, composed solely of Y27632 and SB431542, was successfully developed, enabling long-term in vitro expansion of LGECs. After mixed enzyme digestion, primary LGECs began to adhere and form multiple cell clones after 3 days of culture with 2C (data not shown). The first 3 days are a crucial period for LGEC culture; disturbance during this period should be avoided, as it significantly impacts clone formation and results in failed expansion of LGECs. After 12 days of culture with 2C, the clones gradually fused, and the cells displayed a well-organized epithelial morphology with tight cell-cell connections. In contrast, the control group (Null), without 2C, showed only a few adherent cells with irregular morphology (Figure 1A). Compared to the Null group, 2C significantly enhanced the proliferative capacity and stemness characteristics of LGECs, as evidenced by a higher proportion of Ki67-positive cells and increased expression of K14 (Figure 1B,C). Furthermore, qRT-PCR results showed that, compared to normal LG tissue, primary LGECs cultured with 2C exhibited higher expression of epithelial progenitor/stem cell markers (K14, P63, K15, K5) and the proliferation marker Ki67 (Figure 1D). Conversely, the expression of the differentiation marker AQP5 was nearly negligible (Figure 1D). These results indicate that the 2C serum-free culture strategy effectively maintains the stemness and proliferative capacity of LGECs.
2C supports the sustained expansion of LGECs in 2D culture
To investigate the long-term effects of 2C on maintaining the proliferative capacity of LGECs, subculturing of primary cells (P0) cultured with 2C was performed. Primary LGECs cultured with 2C maintained their morphological characteristics after 10 passages in vitro. Cells at each passage exhibited a well-organized, cobblestone-like epithelial morphology (Figure 2A). Even after more passages (P15), LGECs retained strong proliferative capacity, displayed clonal growth, and preserved epithelial morphology21. Immunofluorescence staining showed that the fluorescence intensity of the stemness marker K14 and the number of Ki67-positive proliferating cells in different passages (P3, 5, 8, 10) were comparable to those of P1 cells (Figure 2B,C). qRT-PCR results further demonstrated that the cells maintained high expression of stem/progenitor cell markers (K14, P63, K5, K15) and low expression of differentiation markers (AQP5 and α-SMA) across different passages, with minimal variation across different passages (Figure 2D). Additionally, cells from later passages (P6-P10) were cryopreserved. After 4 months of storage, they exhibited clonal growth upon thawing, maintained the typical cobblestone-like morphology, and demonstrated continued passage and expansion capability21. These results suggest that 2C supports the long-term expansion of LGECs in vitro. Even after multiple passages and cryopreservation, LGECs effectively maintain their stemness and proliferative capacity.
Establish a three-dimensional (3D) culture of LGECs using 2C
To better simulate the in vivo characteristics of the LG, LGECs were further cultured in a 3D system. Direct digestion of glandular tissue for 3D culture may result in contamination by non-epithelial cells. Therefore, in this study, relatively pure P1 LGECs were used and seeded in a low-growth-factor matrix gel for 3D culture. First, the effect of 2C on 3D spheroid formation was investigated. After 14 days of 3D culture, the number and size of the 3D spheroids were significantly increased in the 2C-treated group (+) compared to the control group without 2C (-) (Figure 3A). The mean diameter of the spheroids in the 2C-treated group was approximately 150 µm after 14 days of culture, with some variability in size. The distribution of spheroids was found to be relatively uniform. Additionally, the 2C group exhibited stronger stemness and proliferative capacity compared to the control group (Figure 3B). Thus, 2C was used for the in vitro expansion of 3D spheroids.
After 3 days of culture with 2C, cells began to aggregate into small clusters that resembled spheroid structures. After 7 days, the clusters expanded, and by day 14, they had formed more substantial structures (Figure 3C). qRT-PCR analysis showed that, compared to freshly isolated mouse LG tissue, the 3D spheroids cultured for 14 days exhibited high levels of stem/progenitor cell markers (K14, P63, K15, K5) and the proliferation marker Ki67, while the expression of the LG maturation marker AQP5 was nearly undetectable (Figure 3D). These results demonstrate that the 2C culture system not only effectively maintains the proliferative capacity and stem/progenitor cell characteristics of LGECs in 2D culture but also supports proliferation and stemness maintenance in 3D culture.
Induce differentiation of 3D cell spheroids cultured with 2C
The primary function of the LG is tear secretion, which makes the establishment of 3D LG cultures with secretory function essential. In 2D culture, various methods have been employed to induce differentiation of LGECs, such as the addition of serum, lower concentrations of EGF and bFGF, and Ca2+ supplementation. Removal of 2C has also been investigated as an induction method21. Compared to these approaches, removal of 2C most effectively induced LGECs to express the maturation marker AQP5 and the secretory function marker LTF21.
Therefore, in the 3D culture system, differentiation was induced by removing 2C. After 7 days of culture with 2C, the 3D spheroids were cultured for an additional 7 days after 2C removal. Results showed that the internal structure of individual spheroids became denser after 7 days without 2C (Figure 4A). Additionally, the differentiated spheroids aggregated and formed microglandular structures with complex ducts-like structures (red arrows in Figure 4A). qRT-PCR analysis revealed that, compared to continuous 2C culture, the induced differentiation group (Null) showed significantly reduced expression of stemness and proliferation markers (K14, P63, K15, K5, Ki67). In contrast, the expression of differentiation and secretory function markers, such as α-SMA (myoepithelial cell marker), K19 (ductal cell marker), AQP5, SOX10 (essential for forming secretory units in exocrine glands), and LTF, were significantly increased (Figure 4B). Immunofluorescence staining of the differentiated 3D spheroids revealed that AQP5 and α-SMA-positive cells were primarily located at the periphery of the spheroids, while K19-positive cells were scattered in other regions, indicating the presence of multiple LG cell types (Figure 4C). The secretory function of the differentiated microglandular structures was evaluated by pilocarpine stimulation. After 24 h, LTF levels in the culture medium were significantly elevated, confirming their secretory function (Figure 4D).
In conclusion, LGECs cultured with 2C exhibit high proliferative capacity and stemness, and are capable of forming 3D spheroids with these characteristics under in vitro conditions. Moreover, upon removal of 2C, the 3D spheroids can be induced to differentiate and self-assemble into microglandular structures with diverse cell types and secretory functions.

Figure 1: Establishment and characterization of LGECs with enhanced stemness and proliferative capacity by 2C. (A) Comparison of LGEC morphology on day 12 with and without 2C. (B,C) Immunofluorescence staining of K14 (green) and Ki67 (green), with nuclei counterstained using DAPI (blue). (D) mRNA expression levels of genes related to stemness (K14, p63, K5, K15), proliferation (Ki67), and differentiation (AQP5) were compared between primary LGECs (P0) cultured with 2C and normal LG tissues (n = 3). Statistical significance was assessed using a two-tailed Student's t-test. Data are presented as mean ± SD; **P < 0.01, ***P <0.001. This figure has been adapted with permission from Zeng et al.21. Please click here to view a larger version of this figure.

Figure 2: 2C supports continuous expansion of LGECs in vitro. (A) Cellular morphology of LGECs at different passages (P1-P10) cultured with 2C. (B) Immunofluorescence staining of K14 (green) and Ki67 (green) in LGECs from different passages (P1, 3, 5, 8, 10), with nuclei stained using DAPI (blue). (C) Statistical analysis of the fluorescence intensity of K14 and the number of Ki67-positive cells at specific passages (P1, 3, 5, 8, 10), n = 4-7. (D) Comparison of mRNA expression levels of stemness markers (K14, P63, K5, K15) and differentiation markers (AQP5, α-SMA) in LGECs from different passages (P1, 3, 5, 8, 10) cultured with 2C, compared to normal LG tissues, n = 3. * indicates a statistically significant difference between LG and LGECs of P1, 3, 5, 8, 10; # indicates a statistically significant difference between P1 and P3, 5, 8, 10. Statistical significance was assessed using a two-tailed Student's t-test. Data are presented as mean ± SD; *, #P < 0.05, **, ##P < 0.01, ***, ###P < 0.001, ****P < 0.0001, ns: no statistical significance. This figure has reprinted with permission from Zeng et al.21. Please click here to view a larger version of this figure.

Figure 3: Establishment and characterization of three-dimensional (3D) culture of LGECs with 2C. (A) Representative bright-field microscopy images of 3D cell spheroids derived from P1 cells cultured without (-) or with 2C (+) for 14 days. (B) qRT-PCR results comparing the mRNA expression levels of the proliferation and progenitor/stemness markers (Ki67, P63, K15, K5) in 3D cell spheroids cultured without (-) and with 2C (+) on day 14, n = 3. (C) Representative images of 3D cell spheroids derived from P1 single cells under 2C culture conditions at day 0, day 7, and day 14. (D) qRT-PCR analysis of mRNA expression levels of genes related to proliferation and stemness (Ki67, K14, P63, K15, K5) and differentiation markers (AQP5) in 3D cell spheroids (3D-Sph) cultured with 2C for 14 days and normal LG tissue, n = 3. Statistical significance was assessed using a two-tailed Student's t-test. Data are presented as mean ± SD; *P < 0.05, ***P < 0.001, ****P < 0.0001. This figure has been adapted with permission from Zeng et al.21. Please click here to view a larger version of this figure.

Figure 4: Differentiation of 3D cell spheroids cultured with 2C. (A) Representative bright-field microscopy images of 3D cell spheroids cultured continuously with 2C or after removal of 2C for differentiation. Red arrows indicate the duct-like structures between the 3D spheroids after differentiation. (B) Comparison of mRNA expression levels of genes related to proliferation and stemness (Ki67, K14, P63, K15, K5) and LG lineage-specific and functional markers (AQP5, SOX10, α-SMA, K19, LTF) in 3D cell spheroids with and without differentiation, n = 3. (C) Immunofluorescence staining for AQP5 (green), K19 (green), and α-SMA (green) in differentiated microglandular structures. Nuclei were counterstained with DAPI (blue). (D) ELISA analysis of LTF protein concentration in the culture medium of differentiated microglandular structures following 24 h of pilocarpine stimulation, n = 3. Statistical significance was assessed using a two-tailed Student's t-test. Data are presented as mean ± SD; *P < 0.05, **P < 0.01, ***P < 0.001. This figure has been adapted with permission from Zeng et al.21. Please click here to view a larger version of this figure.
As described in the Introduction, several serum-free culture systems for LG cells have been developed in recent years10,11,12,13. However, many of these methods have limitations, including poor cell proliferation and the inability to achieve large-scale expansion in vitro10,11. Furthermore, recent serum-free culture systems for LG stem cells and organoids have relied on complex formulations that involve a multitude of additives, making the culture conditions unnecessarily complicated12,13,14,15. For example, Zhang et al. used a combination of EGF, FGF10, Wnt3A, and Y27632, along with several cell culture supplements, to promote the expansion of LG stem cells in 3D culture. However, this method does not effectively achieve directed differentiation through simple adjustments in growth factors or environmental conditions12,15. Similarly, Bannier-Hélaouët et al. expanded mouse LG organoids using a mixture of factors, including B27, Glutamax, HEPES, N-acetylcysteine, nicotinamide, Noggin, R-spondin 3, A83-01, PGE2, FSK, and FGF10. However, this method involved complex signaling pathways regulation and poses challenges in terms of achieving precise control over LG cell fate13,14.
In contrast, the protocol presented here offers a novel, simplified serum-free culture system using only two small molecules-Y27632 and SB431542 (2C)-for the long-term expansion of LGECs. By combining the advantages of these two small molecules, this system streamlines the cell expansion process, eliminating the need for multiple additives and reducing the complexity of the culture conditions. The use of 2C allows precise control over the proliferation and differentiation of LGECs, providing an efficient and convenient approach for LG research and regeneration applications.
Several critical steps in this protocol ensure optimal culture results. First, the simplification of the digestion procedure, which previously involved multiple enzymes and filtration steps, is a key improvement4,5,11. Only two enzymes, Dispase II and Collagenase A, are used for LG digestion, which simplifies the procedure. However, this process requires careful dissection of the LG tissue. It is especially important to remove the connective tissue, including the LG capsule and the fibrous connective tissue within and between the lobules, to ensure complete exposure of ducts within the lobules. After removing the connective tissue, the tissue should be meticulously divided into fragments to ensure complete digestion and successful isolation of LGECs. Do not directly cut the LG after extraction without removing the capsule to begin digestion, as this will prevent the digestion solution from adequately penetrating and lead to culture failure. After digestion, it is crucial to assess the tissue morphology to confirm the success of the digestion process. If the digestion solution contains mostly clumps of cells rather than individual cells with good motility, it indicates incomplete tissue processing. In this case, the issue can be addressed by more thoroughly removing the connective tissue and finely mincing it before digestion.
Another critical step is the digestion time, which is crucial for obtaining high-quality LGECs. A 2.5 to 3h digestion time, combined with manual shaking and microscope monitoring, allows for optimal cell dissociation. Digestion should be stopped when there are no visible particles remaining in the digestion solution and large numbers of single cells, as well as some duct-like cell aggregates, are observed under the microscope. After digestion, the cells should be pipetted several dozen times to ensure complete dissociation. It is important to count the cells before cell seeding. Normally, 6-8 × 10⁴ cells can be obtained from one LG of a 6-8 weeks old male mouse. A low cell count indicates incomplete digestion. In this case, the digestion time should be extended and the cells should be thoroughly dissociated by pipetting. Another factor that can contribute to culture failure is residual digestion enzymes. Before seeding the cells, wash them twice with DPBS to completely remove any remaining enzymes. Insufficient washing may result in poor cell adhesion after 72 h or a significant reduction in clone formation. Alternatively, the cells may detach and die over time. Incomplete or excessive digestion can negatively impact both the yield and quality of LGECs. For the first 72 h, it is important not to disturb the cells to ensure proper adhesion and clonal growth. After the first media change at 72 h, gentle handling is necessary, as the cells have not yet fully adhered to the plate. Do not pipette or disturb the cells during this change, as doing so may prevent them from continuing to grow and lead to culture failure. Normally, cells begin to adhere 72 h after seeding, and several small cell clones become visible under a microscope. If this does not occur as expected, the potential issues mentioned above should be addressed systematically.
While the protocol demonstrates the efficacy of 2C in expanding LGECs in 2D culture, the 3D culture system still requires further refinement. This protocol offers a preliminary exploration of 3D spheroid formation but does not yet include long-term subculture or comprehensive structural and functional assessments. Future studies should focus on characterizing the structure and receptor profiles of differentiated 3D spheroids, as well as evaluating their responses to various stimulants. Furthermore, the secretion of additional proteins, such as lysozyme, should be explored to better understand the full functional capacity of the 3D cultures. Additionally, while the effects of 2C on LGEC expansion are well-documented, the precise molecular mechanisms behind the synergistic action of Y27632 and SB431542 remain unclear. Y27632, a ROCK pathway inhibitor, has been shown to promote cell adhesion and proliferation22,23. On the other hand, SB431542, a TGF-β pathway inhibitor, has been shown to promote cell proliferation and delay aging24,25. However, the synergistic effects of these two molecules remain unknown. Research on the interactions of these small molecules with the ROCK and TGF-β pathways in LG physiology and pathology is important for a deeper understanding of their roles in promoting cell proliferation and differentiation. Subsequent studies will utilize sequencing technologies to investigate the specific molecular mechanisms by which 2C regulates the proliferation and differentiation of LGECs. This will improve our understanding of the LGEC culture system, facilitate more precise control of cell behavior, and identify potential targets for LG regeneration. Moreover, while the protocol has been successfully applied to mouse LGECs, its effectiveness in human LGECs has not yet been evaluated. Future studies should assess whether this serum-free culture system can be effectively applied to expand human LGECs, which would represent an important step toward clinical and translational applications.
In conclusion, this protocol presents a novel serum-free culture method, 2C, which effectively supports the expansion of LGECs in both 2D and 3D cultures while precisely regulating their proliferation and differentiation. This method overcomes the complexity and limited proliferative capacity of traditional culture systems, providing a simplified and efficient approach for research in LG physiology and pathology. Moreover, the 2C culture system offers abundant cell resources for LG regeneration and tissue engineering, presenting new potential and opportunities for the treatment of LG dysfunction and ADDE.
The authors declare no competing interests.
This work was supported by the National Natural Science Foundation of China (82471048, 82271045); the Shenzhen Science and Technology Program (JCYJ20240813145510014); the Health Research Talents Special Project of Jilin Province (2023SCZ63, 2024SCZ53, 2025SCZ65); and the Jilin Province Science and Technology Development Plan Project (YDZJ202601ZYTS389).
| -20°C Ultra-low temperature refrigerator | Haier | ||
| -80°C Ultra-low temperature refrigerator | Haier | ||
| 0.25% Trypsin-EDTA | Gibco | 25200056 | |
| 1.5 mL micro centrifuge tube | Kirgen | KG2211 | Rnase-free |
| 35mm cell culture dish | LABSELECT | 12111 | |
| 4 °C Refrigerator | Haier | ||
| 4% paraformaldehyde (PFA) | Servicebio | G1101 | |
| 4',6-diamidino-2-phenylindole (DAPI) | Yeasen | 708939ES03 | Store at -20 °C, stock at 1 mg/mL, 500x, dilute to 1x with 1x PBS |
| 5 mL centrifuge tube | ACMEC | AC17457 | |
| 50mL centrifuge tube | LABSELECT | CT-002-50-SS | |
| Anti-alpha smooth muscle actin rabbit antibody | Abcam | ab5694 | Dilute with the antibody dilution buffer at 1:100 |
| Anti-AQP5 rabbit antibody | ABclonal | A9927 | Dilute with the antibody dilution buffer at 1:100 |
| Anti-Cytokeratin 14 rabbit antibody | Abcam | ab181595 | Dilute with the antibody dilution buffer at 1:200 |
| Anti-Cytokeratin 19 rabbit antibody | Abcam | ab52625 | Dilute with the antibody dilution buffer at 1:400 |
| Anti-Ki67 rabbit antibody | Abcam | ab16667 | Dilute with the antibody dilution buffer at 1:200 |
| Biosafety cabinet | SterilGARD | ||
| Bovine serum albumine (BSA) | Yeasen | 36101ES60 | Store at 4°C |
| C57BL/6J mice | Laboratory Animal Center of Xiamen University | ||
| Cell culture plate | LABSELECT | 11312 | 24-well |
| Cell incubator | Eppendorf | ||
| Centrifuge | Eppendorf | ||
| Chloroform | HUSHI | 10006818 | CAUTION, Performing operations in a fume hood |
| CO2 constant temperature incubator | Eppendorf | ||
| Collagenase A | Roche | 10103586001 | Store at -20 °C, stock at 200 mg/mL, 100x |
| Defined trypsin inhibitor solution(DTI) | Gibco | R007100 | |
| DermaLife K Keratinocyte Medium Complete Kit (Serum-free medium) | Life Line | LL-0007 | Store at 4 °C |
| D-Hanks | Biosharp | BL559A | Used for diluting Dispase II |
| Dimethylsulfoxide(DMSO) | Sigma | D4540 | Used for diluting Y27632 and SB431542 |
| Dispase II | Sigma | D4693 | Store at -20 °C, stock at 200 mg/mL, 100x |
| DMEM basic (1X) | Gibco | C11995500BT | |
| Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 | Invitrogen | A-21206 | Dilute with the antibody dilution buffer at 1:300 |
| Dulbecco's Phosphate-bufferd Saline (DPBS) | Servicebio | G4200 | |
| Ethanol absolute | HUSHI | 10009218 | CAUTION, Use to prepare other Ethanol dilutions |
| Freezing microtome | Leica | ||
| High-speed low-temperature grinder | Servicebio | ||
| Inverted fluorescence microscope | Leica | ||
| Inverted microscope | Olympus | ||
| Isopropanol | HUSHI | 80109270 | |
| Laser Scanning Confocal Microscope FV3000 | OLYMPUS | ||
| Low temperature high speed centrifuge | Eppendorf | ||
| LTF enzyme-linked immunosorbent assay (ELISA) kit | Elabscience | E-MSEL-M0047 | Store at -20 °C |
| Matrix gel (Matrigel) | 82703 | Mogengel | Aliquot and store at -20 °C |
| Micropipettor | Eppendorf | ||
| Microplate reader | Thermo Fisher Scientific | ||
| Nuclease-free water | Biosharp | BL510B | |
| OCT compound | Scigen | 4586 | |
| PBS,1× (pH7.4) | Servicebio | G4202 | |
| PCR amplifier | BIO-RAD | ||
| Penicillin-Streptomycin | Biosharp | BL505A | |
| Penicillin-Streptomycin-Amphotericin | Biosharp | BL142A | |
| PerfectStart Green qPCR SuperMix kit | TransGen Biotech | AQ601-01-V2 | Store at -20 °C |
| PerfectStart Uni RT&qPCR Kit | TransGen Biotech | AUQ-01 | Store at -20 °C |
| Pilocarpine | Aladdin | P424663 | Store at -20 °C, 2500x |
| Primer AQP5 sequence: Forward:CATGAACCCAGCCCGATC TT Reverse:CTTCTGCTCCCATCCCAT CC | Sangon Biotech | ||
| Primer K14 sequence: Forward:CCCACCTTTCATCTTCC CAATT Reverse: AAGCCTGAGCAGCATGTAGCAG | Sangon Biotech | ||
| Primer K15 sequence: Forward:GAGGTGGCGTCTAACACA GA Reverse:TCTGAGCCTCCATCTCAC AG | Sangon Biotech | ||
| Primer K19 sequence: Forward:ATTACTGCCCTGAGGAGC CA Reverse:TTCAGCTCCTCAATCCGA GC | Sangon Biotech | ||
| Primer K5 sequence: Forward:CTCAGAGCTGAGGAACAT GC Reverse:AGCTCCGCATCAAAGAAC AT | Sangon Biotech | ||
| Primer Ki67 sequence: Forward:ACCATCATTGACCGCTCC TT Reverse:TTGACCTTCCCCATCAGG GT | Sangon Biotech | ||
| Primer LTF sequence: Forward:CAGGAGCCAACAAATGTG CC Reverse:TTGTACTGGTCCCTTTCG GC | Sangon Biotech | ||
| Primer P63 sequence: Forward:ATGTCACCGAGGTTGTG AAA Reverse: GAATTCAGTGCCAACCTGTG | Sangon Biotech | ||
| Primer SOX10 sequence: Forward:ATCAGCCACGAGGTAATG TCCAAC Reverse:ACTGCCCAGCCCGTAGCC | Sangon Biotech | ||
| Primer α-SMA sequence: Forward:CTCCCTGGAGAAGAGCTA CG Reverse:CGCTGACTCCATCCCAAT GA | Sangon Biotech | ||
| Real-Time fluorescence quantitative PCR instrument | Roche | ||
| RNA isolater Total RNA Extraction Reagent | Vazyme | R401-01 | CAUTION, Performing operations in a fume hood |
| SB431542 | Apexbio | A8249 | Store at -20 °C, stock at 20 mM, 2000x |
| Spectrophotometer NanoDrop 1000 | Thermo Fisher Scientific | Measure RNA concentration | |
| Sucrose | Macklin | S818046 | Dissolve with distilled water |
| Triton X-100 | Solarbio | T8200 | |
| Ultra pure water purification system | Millipore | ||
| Universal antibody dilution buffer | Epizyme | PS119 | Store at 4 °C |
| Y27632 | Apexbio | B1293 | Store at -20 °C, stock at 20 mM, 2000x |