A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Exogenous Mitochondrial Transfer in Differentiating Brown Adipocytes and AGPAT2-Deficient Preadipocytes

79 views

DOI:

10.3791/71223

June 26th, 2026

In This Article

Summary

Exogenous mitochondria of human and murine origin can be internalized by differentiating preadipocytes and tracked throughout adipogenic differentiation using imaging and genetic tools. While these mitochondria physically interact with the endogenous mitochondrial network, they do not increase the expression of markers associated with mature brown adipocytes.

Abstract

Mitochondria are key signaling hubs; however, whether mitochondrial mass expansion is mechanistically required for differentiation remains an open question. AGPAT2 catalyzes the conversion of lysophosphatidic acid into phosphatidic acid, and its deficiency leads to adipose tissue deficiency and impaired adipogenesis associated with reduced mitochondrial mass. The impact of mitochondrial mass expansion on adipogenesis was assessed by transferring exogenous mitochondria into differentiating brown adipocytes. Whether mitochondrial transfer could rescue the impaired adipogenesis of AGPAT2-deficient cells was also investigated. Human and murine mitochondria were successfully transferred and incorporated into the endogenous mitochondrial network of differentiating mouse preadipocytes and persisted throughout brown adipogenesis. Adipogenic differentiation was required for the retention of transferred mitochondria. Mitochondrial transfer did not modify the expression of molecular markers of mature brown adipocytes or lipid droplet content, although it affected the relative distribution of lipid droplet size in a species-dependent manner. In Agpat2-/- preadipocytes, mitochondrial transfer failed to rescue adipogenesis, indicating that mitochondrial mass expansion alone is insufficient to reverse the mechanisms leading to lipodystrophy in this model. These results indicate that, although exogenous human and murine mitochondria can be incorporated into the mitochondrial network of differentiating adipocytes, they do not directly influence the adipogenic program.

Introduction

Beyond their primary bioenergetic roles, mitochondria serve as signaling hubs in multiple cellular processes, including cell differentiation1,2,3,4. Brown adipose tissue (BAT) possesses a notably high mitochondrial mass to support its thermogenic activity, highlighting its role in whole-body energy balance and in the pathogenesis of obesity5. While mitochondrial mass is regulated by the balance between biogenesis and mitophagy, it remains unclear whether mitochondrial mass expansion during brown adipocyte differentiation is functionally required for adipogenesis or merely a consequence of the process.

Physiological mitochondrial transfer between cells has been documented both in vitro and in vivo, where it contributes to tissue adaptation under pathological conditions, including adipose tissue dysfunction associated with obesity and insulin resistance6,7. Furthermore, artificial mitochondrial transfer in vitro has been shown to enhance the respiratory capacity of recipient cells8. Together, these findings support the concept that mitochondrial transfer can modify cellular metabolic function and may contribute to tissue adaptation under conditions of bioenergetic stress9,10,11. Compared with pharmacological or genetic strategies that stimulate endogenous mitochondrial biogenesis by activating nuclear and mitochondrial transcriptional programs, mitochondrial transfer directly delivers organelles to recipient cells, enabling rapid modification of mitochondrial mass independently of transcriptional manipulations12,13. This approach is critical for correcting defects in mitochondrial diseases but also allows to study mitochondrial actions without the potential off-target effects of pharmacological or genetic approaches14.

In the present study, we investigated the effect of artificially increasing the mitochondrial mass by exogenous mitochondrial transfer in differentiating brown adipocytes. This approach enabled direct assessment of the impact of mitochondrial mass on the adipogenic program. To achieve this, mitochondrial transfer protocols originally developed for mesenchymal stem cells were adapted15 using both human hepatic cells and murine preadipocytes as mitochondrial donors. A method for tracking human mitochondria in differentiating mouse cells was developed using genetic tools combined with imaging techniques, demonstrating that mitochondria from both origins are incorporated into the endogenous mitochondrial network and persist throughout adipogenic differentiation.

To model defective adipogenesis associated with low mitochondrial mass, differentiating brown adipocytes derived from 1-acylglycerol-3-phosphate-O-acyltransferase 2 (AGPAT2)-deficient (Agpat2-/-) mice were used. AGPAT2 is highly expressed in adipose tissue, where it catalyzes the formation of phosphatidic acid in the glycerolipid biosynthesis pathway. AGPAT2 deficiency causes severe lipodystrophy in both humans and mice and impairs adipogenesis in white and brown adipocyte models in association with reduced mitochondrial mass16,17,18. Incorporation of exogenous mitochondria into differentiating preadipocytes slightly altered lipid droplet size distribution but did not increase the expression of mature brown adipocyte markers or rescue the adipogenic impairment of Agpat2-/- preadipocytes.

Access restricted. Please log in or start a trial to view this content.

Protocol

Animal procedures were approved by the Institutional Animal Care and Use Committee at Pontificia Universidad Católica de Chile, protocol 210609003. Wild-type and Agpat2-/- P0.5 neonatal mice of both sexes, derived from a mixed C57BL/6J and 129J genetic background, were used in this study. Personal Protective Equipment (PPE): Wear a laboratory coat, safety glasses, and nitrile gloves. See Supplemental File 1 for additional protocol details and Table 1 for the buffers required for this protocol.

All toxic chemical waste generated during electron microscopy preparation, paraformaldehyde fixation, and nucleic acid extraction must be strictly segregated into designated, clearly labeled streams in compliance with institutional Environmental Health and Safety (EHS) regulations. Under no circumstances should any of these reagents be discharged into the laboratory sink or public sewage system. All hazardous chemical waste generated must be segregated according to institutional EHS classifications.

1. Cell culture

  1. Isolation, differentiation, and maintenance of primary adipocytes (iBAT)
    NOTE: See Supplemental File 1 for a brief description of the procedures and Table 1 for the composition of the required solutions. A complete and detailed explanation of our in vitro brown adipogenic differentiation protocol can be found in Figueroa et al.19.
    1. Isolate preadipocytes from the interscapular brown adipose tissue (iBAT) of neonatal (P0.5) mice following the surgical and enzymatic digestion procedures described by Figueroa et al.19.
    2. Differentiate and maintain the brown adipocyte culture according to the differentiation cocktail and media exchange schedule.
      NOTE: For a successful adipogenic differentiation, it is critically important that cultures reach 90–100% confluence before initiating the adipogenic induction.
  2. HepG2 culture
    1. Culture HepG2 cells in DMEM supplemented with 10% fetal bovine serum, 100 U/mL penicillin, 100 µg/mL streptomycin, and 0.25 µg/mL amphotericin B. Maintain the cells at 37 °C in a humidified incubator with 5% CO2.
      NOTE: These cells grow in clusters and may appear subconfluent despite high density due to multilayered growth.

2. Mitochondrial isolation and transference

  1. Mitochondrial isolation
    NOTE: Perform all steps in a biosafety cabinet at 4 °C or on ice. Use the preparation within 2 h.
    1. Seed 2 × 106 donor cells (HepG2 or preadipocytes) in 100 mm culture dishes. Grow cells until they reach 80% (HepG2) or 100% (preadipocytes) confluence.
    2. Stain donor cells with 100 nM MitoTracker Deep Red FM in FBS-free medium for 30 min at 37 °C in a 5% CO2 incubator.
    3. Wash the cells 2x with growth medium to remove excess dye.
    4. Detach cells using trypsin, collect the suspension, and centrifuge at 300 × g for 5 min at 4 °C.
    5. Resuspend the pellet in 1 mL of mitochondrial isolation buffer (MIB) supplemented with BSA, protease inhibitors, and phosphatase inhibitors. Disrupt the plasma membrane by passing the suspension through a tuberculin syringe 5x. Homogenize the suspension by passing it through an insulin syringe at least 10x until the solution is light-brown and lacks visible clumps.
      NOTE: For western blot analysis, aliquot 50 µL of the total lysate and store at -20 °C.
  2. Centrifuge the homogenate at 900 × g for 11 min at 4 °C.
    NOTE: If the supernatant after the 900 × g spin is not cloudy, cellular lysis is likely incomplete.
    1. Collect the supernatant and centrifuge at 10,000 × g for 10 min at 4 °C to pellet the mitochondria. Wash the mitochondrial pellet 3x with MIB supplemented with BSA.
    2. Perform a final resuspension in 100 µL of BSA-free MIB. Quantify protein concentration using a BCA protein assay.
  3. Mitochondrial transfer assay (MTA) in preadipocytes
    1. Seed recipient preadipocytes at 5 × 105 cells/well in 12-well plates (with 18 mm coverslips for microscopy) 24 h prior to the assay.
    2. Add isolated donor mitochondria directly to the recipient medium at a ratio of 10 µg of mitochondrial protein per 105 cells. Rock the plates gently to distribute the mitochondria. Incubate cells for 24–120 h (corresponding to days 1, 3, and 5 of differentiation) at 37 °C in a humidified incubator with 5% CO₂ prior to analysis.

3. Mitochondrial oxygen consumption and MTA efficiency

  1. Mitochondrial respirometry
    1. Set the external circulating water bath to 25 °C and ensure stable thermal equilibrium in the chamber jacket before initiating any measurements.
    2. Perform a two-point liquid phase calibration using the instrument's acquisition software.
      1. Air-saturation calibration (High Point): Add 500 µL of air-saturated demineralized water to the chamber. Set the magnetic stirrer to 60 rpm and record the signal until it stabilizes at a plateau (>1,500 mV).
      2. Zero-oxygen calibration (Low Point): Add a small (~3 mm diameter) amount of sodium sulfite to the chamber to displace any remaining air. Record until the signal drops to a stable baseline plateau (~1% of the basal signal, ~20 mV).
    3. Initiate real-time recording (total run time: ~10 min).
    4. Record for 3 min until a stable linear reading is achieved.
    5. Resuspend isolated mitochondria in 200 µL of mitochondrial assay buffer (MAS)20 supplemented with 5 mM glutamate and 2.5 mM malate.
      NOTE: For the present work, the pellet of total mitochondria was extracted from two 100 mm cell-plates.
    6. Transfer the suspension to the Oxygraph chamber and close the chamber sealing plunger tightly, ensuring no air bubbles remain.
    7. Record oxygen consumption for 3 min.
    8. Add 150 µM ADP to trigger mitochondrial coupled respiration and measure ATP synthesis-coupled respiration for 3 min.
    9. Manually define the stable, linear segments corresponding to each respiratory phase. Extract the automated slope values calculated by the software, expressed as oxygen consumption rates in nmol∙mL-1∙min-1.
      NOTE: For interplate chamber cleaning, rinse the chamber 2x with 1 mL of demineralized water and ensure the interior is completely dry. Add 100 µL of PBS to the chamber before proceeding to the next plate.
  2. Flow cytometry
    NOTE: Keep all samples on ice throughout the procedure to preserve cellular and bioenergetic integrity.
    1. Isolate mitochondria and perform mitochondrial transfer assay (MTA), as described in Sections 2.1 and 2.2, respectively, in 35 mm culture dishes, using donor cells previously labeled with MitoTracker Deep Red FM.
    2. Aspirate the culture medium and wash the cell monolayer once with 1 mL of sterile PBS.
    3. Add 500 µL of 0.25% Trypsin-EDTA and incubate the dishes at 37 °C until complete cell detachment is observed under a microscope.
    4. Neutralize trypsin by adding 1 mL of complete growth medium (DMEM with 10% FBS). Transfer the entire volume to a 15 mL conical tube and centrifuge at 300 × g for 5 min at 4 °C.
    5. Discard the supernatant by aspiration and retain the cell pellet. Resuspend the pellet in 500 µL of ice-cold PBS by gentle pipetting.
    6. Analyze the samples using a flow cytometer equipped with a 640 nm laser (see Supplemental File 1 for details on flow cytometry acquisition and analysis).
      1. Define the cell population using Forward Scatter (FSC) vs. Side Scatter (SSC) plots and apply a gating strategy to exclude debris and cell doublets.
      2. Quantify the fluorescence intensity in the far-red channel (670/30 nm emission filter) to detect internalized MitoTracker-labeled mitochondria.
      3. Perform analysis using Floreada.io (see Supplemental File 1 for gating protocol details).
        NOTE: Include a negative control (recipient cells without MTA) to set the baseline for background auto-fluorescence.
  3. Confocal and electron microscopy
    1. Live cell imaging assay
      1. Seed primary preadipocytes derived from P0.5 neonatal mice into 12-well plates containing 18 mm coverslips, following the specific cell density and media requirements detailed in Section 1.
      2. Isolate mitochondria and execute the mitochondrial transfer assay (MTA) using donor cells previously labeled with MitoTracker Deep Red FM, as specified in Section 2.
      3. Maintain the recipient cultures in a humidified incubator at 37 °C with 5% CO2 for 24 h to allow for mitochondrial uptake.
      4. Prepare a 70 nM MitoTracker Green working solution by diluting the stock in FBS-free culture medium.
      5. Aspirate the growth medium from the 12-well plates and replace it with the 70 nM MitoTracker Green solution. Incubate the plates for 25 min at 37 °C in a humidified incubator with 5% CO2 to counterstain the total mitochondrial network.
      6. Remove the staining solution and wash the coverslips 2x with 1 mL of warm, complete culture medium.
      7. Replace the final volume with phenol red-free complete medium to minimize background auto-fluorescence during acquisition.
      8. Transfer the coverslips or the plate to the confocal microscope stage. Set the microscope’s incubation chamber to maintain a constant environment of 37 °C and 5% CO2.
      9. Capture images immediately using appropriate excitation/emission settings for both far-red (MitoTracker Deep Red FM) and green (MitoTracker Green) channels. See Supplemental File 1 for additional details.
        NOTE: Perform all staining and handling steps under low-light conditions to prevent photobleaching of the fluorophores. Use a high-numerical aperture (NA) oil-immersion objective (60x or 100x) for optimal resolution of mitochondrial morphology.
    2. Confocal immunofluorescence assay with fixed cells
      NOTE: Following cell fixation, toxic paraformaldehyde and glutaraldehyde solutions are classified as non-halogenated organics. Nucleic acid extraction byproducts require strict segregation: phenol/chloroform mixtures must be disposed of as halogenated organics, while guanidinium-based buffers are classified as corrosive organics.
      1. Seed primary preadipocytes derived from P0.5 neonatal mice into 12-well plates containing 12 mm coverslips, as described in Section 1.
      2. Isolate mitochondria and perform the mitochondrial transfer assay (MTA) following the procedures specified in Section 2.
      3. Incubate the cultures for 24 h to allow for mitochondrial uptake.
      4. Induce brown adipogenic differentiation by following the protocol described in Supplemental File 1 and refer to Table 1 for the required buffers’ composition.
      5. Fix the cells on day 7 of differentiation (168 h). Aspirate the culture medium and add 500 µL of 4% paraformaldehyde (PFA) per well. Incubate for 20 min at room temperature.
      6. Wash the coverslips 2x by adding 1 mL of ice-cold PBS per well. Permeabilize and block the cells by incubating the coverslips in PBS containing 0.05% saponin and 0.2% BSA for 1 h at room temperature. Place the plate on an orbital shaker under gentle agitation.
      7. Wash the cells 2x with 1 mL of PBS. Stain the nuclei and lipid droplets simultaneously. Apply 1 µg/mL Hoechst 33342 and 1 µg/mL BODIPY prepared in the blocking/permeabilization buffer. Incubate for 30 min at room temperature, ensuring the plate is protected from light.
      8. Wash the coverslips 2x with 1 mL of ice-cold PBS. Mount the coverslips onto clean glass slides. Dispense 10 µL of mountant onto the slide and place the coverslip cell-side down onto the mounting medium. Allow the samples to dry overnight in a dark environment at room temperature before imaging.
      9. Acquire images using a confocal microscope. Use two fluorescence channels calibrated for the emission spectra of Hoechst and BODIPY. See Supplemental File 1 for additional imaging details.
      10. Perform lipid droplet analysis using ImageJ v1.54s. Open the lipid droplet channel, identify individual droplets manually using the Freehand selections and ROI Manager tools, and calculate the droplet area using the Analyze | Measure command.
      11. Process and analyze the resulting data using the R scripts provided in Supplemental File 2 within the RStudio v4.5.2 environment.
        NOTE: Acquire exactly five images per coverslip at 10x magnification to ensure representative sampling. Use R version 4.5.2 or higher for compatibility with the provided scripts.
    3. Transmission electron microscopy (TEM)
      NOTE: For electron microscopy byproducts, highly toxic osmium tetroxide and arsenic-containing sodium cacodylate buffers must be collected as toxic heavy metal waste, whereas uranyl acetate is managed separately as radioactive heavy metal waste under institutional radiation safety protocols.
      1. Centrifuge the isolated mitochondria, from Section 2, at 10,000 × g for 10 min at 4 °C to obtain a compact pellet.
      2. Fix the pellet by adding 2.5% glutaraldehyde in 0.1 M sodium cacodylate buffer (pH 7.0). Incubate for 2 h at 4 °C.
        NOTE: Always handle glutaraldehyde stock solutions and perform initial fixation steps inside a chemical fume hood. Wear nitrile gloves and goggles for eye protection. Avoid any contact with heating sources, as heated glutaraldehyde releases highly irritating vapors.
      3. Wash the mitochondrial preparation for 3 × 10 min with 0.05 M sodium cacodylate buffer, and centrifuge briefly to retain the pellet between buffer changes.
      4. Post-fix the sample by adding 1% aqueous osmium tetroxide (OsO4). Incubate for 15 min at room temperature.
        NOTE: Osmium tetroxide must only be opened and handled inside a certified, fully functional chemical fume hood. Wear a lab coat, safety goggles or a full-face shield, and thick or double-nitrile gloves (change gloves immediately if any splash occurs, as OsO4 can penetrate thin nitrile over time).
      5. Wash the sample for 3 × 5 min with double-distilled water. Stain the pellet with 1% aqueous uranyl acetate for 15 min.
        NOTE: Work on disposable plastic-backed bench paper. Dedicate a specific area of the lab for radioactive staining. Wear double gloves, a lab coat, and safety goggles. Wash hands thoroughly after completing the procedure.
      6. Dehydrate the preparation using a graded ethanol series. Incubate the pellet in 30%, 50%, 70%, 95%, and 100% ethanol for 5 min at each concentration.
      7. Embed the mitochondrial fractions. Incubate in a 1:1 Epon/ethanol solution for 30 min, followed by pure Epon resin for 1 h.
      8. Transfer the samples to embedding molds and polymerize in a 60 °C oven for 48 h.
      9. Attach the resin blocks to the ultramicrotome and cut ultrathin sections (80 nm).
      10. Collect sections onto grids. Stain the grids with 1% aqueous uranyl acetate for 4 min. Rinse with double-distilled water.
      11. Stain with lead citrate for 5 min following Reynolds’ method21. Rinse thoroughly. Visualize the grids using the TEM. See Supplemental File 1 for details on the Reynolds’ method and TEM image acquisition.

4. Molecular quantification

  1. Mitochondrial DNA (mtDNA) standard curve
    1. Seed HepG2 cells into five 100 mm culture dishes. Incubate the cultures until they reach 80% of confluence.
    2. Isolate the mitochondria from the harvested cells by following the technical procedure detailed in Section 2.
    3. Extract total DNA from the resulting mitochondrial pellet using the acid-guanidinium-phenol-chloroform method as described in Section 4.2.6. Measure the DNA concentration and evaluate purity ((A260/A280 and (A260/A230 ratios) using a microvolume UV-Vis spectrophotometer.
    4. Prepare a serial dilution series using nuclease-free water as the diluent. Dilute the DNA stock to achieve final amounts of 1, 10-1, 10-2, 10-3, 10-4, and 10-5 ng per reaction volume. Vortex each dilution for 5 s to ensure complete homogeneity before proceeding to the next step in the series.
      NOTE: Adjust the concentration range of the standard curve based on the specific sample concentration and the final PCR reaction volume.
  2. Detection of Human mtDNA in recipient cells
    1. Seed primary preadipocytes derived from P0.5 neonatal mice into 60 mm culture dishes, following the density and media conditions specified in Section 1.
    2. Isolate mitochondria from donor HepG2 cells and execute the mitochondrial transfer assay (MTA) as detailed in Section 2.
    3. Incubate the cultures for 24 h at 37 °C and 5% CO2.
    4. Induce brown adipogenic differentiation for 24–120 h (at days 1, 3, and 5) by following the media exchange protocol described in Section 1.
    5. Aspirate the culture medium and wash the cells 2x with 2 mL of ice-cold PBS.
    6. Extract total DNA using the acid-guanidinium-phenol-chloroform method22.
      NOTE: Always aliquot and perform phase separation inside the fume hood to avoid inhaling toxic phenol vapors. Use double-nitrile gloves or heavy-duty chemical-resistant gloves.
    7. Perform phase separation and discard the entire aqueous phase located above the interphase.
      CRITICAL STEP: Remove the aqueous phase completely to prevent contamination and ensure high DNA purity for downstream qPCR.
    8. Add 0.3 mL of 100% ethanol per 1 mL of the initial extraction reagent. Cap the tube and mix vigorously by inversion.
    9. Let it stand for 3 min at room temperature and centrifuge at 2,000 × g for 5 min at 4 °C to pellet the DNA.
    10. Transfer the phenol–ethanol supernatant to a separate tube for potential protein isolation. Resuspend the DNA pellet in 1 mL of 0.1 M sodium citrate (in 10% ethanol, pH 8.5) per 1 mL of extraction reagent used.
    11. Let it stand for 30 min at room temperature, gently inverting it a few times, and centrifuge at 2,000 × g for 5 min at 4 °C. Discard the supernatant.
    12. Repeat the sodium citrate wash steps two additional times.
    13. Wash the resulting pellet with 2 mL of 75% ethanol per 1 mL of initial extraction reagent.
    14. Let it stand for 20 min at room temperature and centrifuge at 2,000 × g for 5 min at 4 °C.
    15. Discard the supernatant and air-dry the pellet for 10 min. Solubilize the DNA by adding 0.3–0.6 mL of 8 mM NaOH and pipetting up and down repeatedly until the pellet disappears.
    16. Centrifuge at 12,000 × g for 10 min at 4 °C to remove any insoluble debris. Transfer the supernatant to a sterile tube and adjust the pH to 7–8 using HEPES.
    17. Measure DNA concentration and purity ((A(260)/A(280) and (A(260)/A(230) ratios) using a microvolume UV-Vis spectrophotometer.
    18. Dilute the template to a final amount of 15 ng of total DNA in nuclease-free water. Perform quantitative real-time PCR (qPCR) for human mtDNA using optical 96-well plates as specified in Section 4.3.
    19. Analyze the amplification results by applying a logarithmic regression model.
      NOTE: Conduct the logarithmic regression analysis using DNA concentration and corresponding threshold cycle (Ct) values as variables.
  3. RT-qPCR for gene expression
    1. Cell preparation and differentiation
      1. Seed primary preadipocytes derived from P0.5 neonatal mice in 60 mm culture dishes as detailed in Section 1.1.
      2. Isolate mitochondria and perform the mitochondrial transfer assay (MTA) following the procedures in Section 2. Incubate the cultures for 24 h.
      3. Induce brown adipogenesis for 24–120 h (sampling at days 1, 3, and 5 of differentiation) according to the protocol in Section 1.
    2. Total RNA isolation
      1. Remove the culture medium and add 1 mL of Acid-guanidinium-phenol-chloroform extractant reagent per 1 × 106 cells directly to the dish. Homogenize the samples by repeated pipetting until the lysate is uniform.
        NOTE: Always aliquot and perform phase separation inside the fume hood to avoid inhaling toxic phenol vapors. Use double-nitrile gloves or heavy-duty chemical-resistant gloves.
      2. Add 0.2 mL of chloroform per 1 mL of extractant reagent used. Cap the tubes securely and shake vigorously by hand for 15 s. Let it stand for 3 min at room temperature and centrifuge at 12,000 × g for 15 min at 4 °C.
      3. Transfer the upper aqueous phase carefully to a new nuclease-free tube. Avoid contact with the interphase. Keep the samples on ice.
      4. Add 0.5 mL of isopropanol per 1 mL of extractant reagent used. Mix gently by inversion and incubate for 10 min at room temperature.
      5. Centrifuge at 12,000 × g for 10 min at 4 °C to pellet the RNA. Discard the supernatant by inversion.
      6. Wash the RNA pellet with 1 mL of 75% ethanol. Vortex briefly and centrifuge at 7,500 × g for 5 min at 4 °C.
      7. Discard the supernatant and air-dry the RNA pellet for 10 min at room temperature. Resuspend the pellet in 30 µL of nuclease-free water. Incubate the samples at 60 °C for 15 min to ensure complete solubilization.
      8. Determine RNA concentration and purity (A260/A280 ratios) using a microvolume UV-Vis spectrophotometer.
      9. Verify RNA integrity via agarose gel electrophoresis.
    3. DNase treatment
      1. Add 0.1 volumes of 10× DNase buffer and 1 µL of DNase enzyme to each RNA sample. Mix gently by pipetting. Incubate the reactions at 37 °C for 30 min.
      2. Resuspend the DNase Inactivation Reagent by flicking or vortexing until the slurry is homogeneous. Add the Inactivation Reagent (0.1 volumes of the RNA sample or 2 µL, whichever is greater) and mix thoroughly. Incubate for 5 min at room temperature. Flick the tubes 3x during this period to maintain the reagent in suspension.
      3. Centrifuge at 10,000 × g for 1.5 min. Transfer the RNA-containing supernatant to a new tube.
        CRITICAL STEP: Ensure no DNase Inactivation Reagent is carried over, as it inhibits subsequent cDNA synthesis.
    4. Reverse transcription (RT)
      1. Quantify the treated RNA and dilute in nuclease-free water to use up to 2 µg of total RNA per 20 µL reaction.
      2. Prepare the RT master mix on ice following the manufacturer’s instructions. Dispense the mix into reaction tubes and add the RNA samples.
      3. Load into a thermal cycler and run the reverse transcription program as specified by the kit manufacturer.
    5. Quantitative real-time PCR (qRT-PCR)
      1. Use the cDNA generated in Section 4.3.4 as the PCR template. Dilute the cDNA in nuclease-free water to a working concentration of 20 ng per 10 µL reaction. Keep all the reagents on ice.
      2. Prepare a master mix containing SYBR Green, primers, and nuclease-free water. Include excess volume for pipetting loss. Dispense 10 µL of the reaction mixture into each well of an optical qPCR plate.
      3. Seal the plate with optical adhesive film and centrifuge briefly to collect the liquid at the bottom. Load the plate into a real-time PCR instrument and perform amplification using fast cycling mode.
      4. Determine the threshold cycle (Ct) values and perform relative quantification using the ΔΔCt method. Include a melting curve analysis at the end of the run to verify amplification specificity.
        NOTE: Normalize target mRNA abundance to 36B4 mRNA levels as the endogenous housekeeping gene. Run the qPCR plates within 2 h of setup; otherwise, store the sealed plates at 4 °C.
  4. Western blot
    1. Quantify protein concentration from whole-cell and mitochondrial extracts (refer to Sections 2.1.8 and 2.1.12) using a BCA assay.
    2. Prepare 30 µg of protein per sample and add the appropriate volume of SDS-PAGE sample loading buffer (e.g., Laemmli buffer).
    3. Denature the samples by heating at 95 °C for 5 min (or follow specific temperature requirements for membrane proteins.
    4. Load the samples into the wells of a polyacrylamide gel. Separate proteins by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) at a constant voltage (e.g., 80–120 V) until the dye front reaches the bottom of the gel.
    5. Activate a PVDF membrane by immersing it in 100% methanol for 1 min, followed by equilibration in transfer buffer.
    6. Assemble the transfer sandwich, ensuring the absence of air bubbles between the gel and the membrane.
    7. Transfer the proteins onto the PVDF membrane by electroblotting at 400 mA for 2 h. Maintain the system at 4 °C throughout the process.
    8. Block non-specific binding sites by incubating the membrane in 5% non-fat milk prepared in Tris-buffered saline containing 0.1% Tween 20 (TBS-T) for 1 h at room temperature.
    9. Incubate the membrane with primary antibodies (diluted 1:1,000 in blocking solution) overnight at 4 °C under gentle agitation.
    10. Wash the membrane 3 × 15 min with TBS-T.
    11. Incubate with horseradish peroxidase (HRP)-conjugated secondary antibodies for 2 h at room temperature.
    12. Wash the membrane 3x with TBS-T, followed by a final 5-min wash with 1× TBS.
    13. Visualize the protein bands using an enhanced chemiluminescence (ECL) substrate. Capture the signal using a digital imaging system.
      NOTE: Adjust the polyacrylamide gel percentage (e.g., 8%, 10%, or 12%) based on the molecular weight of the target proteins. If the electrotransfer apparatus lacks an active cooling system, replace ice containers every hour and keep the chamber submerged in an ice bath. Store membranes in 1× TBS at 4 °C if visualization is delayed.

Access restricted. Please log in or start a trial to view this content.

Results

Mitochondrial extraction and structural and respiratory integrity

To evaluate the impact of increased mitochondrial mass on brown adipogenesis, a mitochondrial transfer assay (MTA) was performed in undifferentiated preadipocytes (Figure 1A). Mitochondria were isolated from primary murine preadipocytes (mMito) and from the human hepatic HepG2 cell line (hMito). Western blot analysis demonstrated that both preparations were highly enriched in the mi...

Access restricted. Please log in or start a trial to view this content.

Discussion

Biological implications of mitochondrial transfer in adipogenesis

Our results show that although exogenous mitochondria from both human and murine sources can be incorporated into the endogenous mitochondrial network of differentiating preadipocytes, an artificial increase in mitochondrial mass is insufficient to drive the brown adipogenic program. These findings suggest that the mitochondrial expansion characteristic of brown adipogenesis is a consequence of cellular differe...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have no conflicts of interest to declare.

Acknowledgements

We thank Abbhimanyu Garg, Anil Agarwal, and Jay Horton from UT Southwestern Medical Center for providing us the Agpat2-/- mice. Andrea del Campo and Gonzalo Almarza of Faculty of Chemistry and Pharmacy of the Pontificia Universidad Católica de Chile for giving us access to the Oxygraph. This work was supported by the Flow Cytometry Core UC and Advanced Microscopy Unit at Pontificia Universidad Católica de Chile. This work was supported by FONDECYT 1221146 and 1261504, FONDEQUIP 230130 and ACT 210039 all from ANID, Chile, granted to V.C. Figure 1A was created with BioRender.com.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
100 mm plateSPL Life Science10101SPL
10x Tris/Glycine BufferBioRad1610734
12 mm glass coverslipsMarienfeld111520
12-well plateSPL Life Science30012SPL
16% Paraformaldehyde Aqueous SolutionInvitrogen28908
18 mm glass coverslipsHART-
24-well plateSPL Life Science30024SPL
3,3′,5-Triiodo-L-thyronine sodium salt (T3)SigmaT6397
3-Isobutyl-1-methylxanthine (IBMX)Calbiochem410957
30% Acrylamide/Bis Solution, 37.5:1BioRad1610158
35 mm plateSPL Life Science20035SPL
6-well plateSPL Life Science30006SPL
60 mm culture dishSPL Life Science20060SPLUsed for primary preadipocyte and DNA/qPCR experiments; supplier/catalog not provided
AccuRuler RGB Plus Pre-stained Protein LadderMaestrogen02102-250
ACK lysing bufferGibcoA10492-01
Actrapid 100 UI/mL (Insulin)Novo NordiskA10AB01
ADPMerck117105
AgaroseFERMELO BIOTECFER00AL200GUsed for RNA integrity verification; supplier/catalog not provided
Ammonium PersulfateBioRad1610700
Anti-rabbit IgG, HRP-linked AntibodyCell Signaling7074
Anti-rat IgG, HRP-linked AntibodyCell Signaling7077
Antibiotic-antimycoticGibco15240062
Axio Observer inverted microscope standCarl Zeiss431007-9901-000Added from Supplemental Methods
BCA Protein Assay KitThermo ScientificD49328
BD Cytometer Setup and Tracking beadsBD Biosciences-Added from Supplemental Methods; catalog not provided
BD FACSDiva Software v8.0.3BD Biosciences-Added from Supplemental Methods
BD LSRFortessa X-20 cell analyzerBD Biosciences-Existing entry standardized to match supplemental file
BioRenderBioRender-Used to create Figure 1 workflow
Blotting-grade blockerBioRad170-6404
BODIPY 493/503InvitrogenD3922
Bovine Serum Albumin (BSA)SigmaA1470
CaCl2Calbiochem208291
cDNA Reverse Transcription KitInvitrogen4374966
Cell Strainer 100 μm, nylonFalcon352360
Cell Strainer 40 μm, nylonFalcon352340
Collagenase type IIGibco17101-015
DexamethasoneSigmaD4902
DMEM Powder, High Glucose, PyruvateThermo Scientific12800017
DMEM/F-12, no phenol redThermo Scientific21041025
DMEM/F-12, powderGibco12500062
DMSOSigmaD8418Solvent for induction medium; supplier/catalog not provided
EMBed-812 EMBEDDING KIT (Epon)Electron Microscopy Sciences14120
Ethanol absoluteMerck100983
Ethylene glycol-bis(β-aminoethyl ether)-N,N,N′,N′-tetraacetic acid tetrasodium salt (EGTA)Merck324626
FAST SYBR MASTER MIXThermo Scientific4385612
FCCPSigmaC2920
Fetal bovine serumCapricorn ScientificBS-16A
Floreada.ioFloreada.io-Flow cytometry analysis software
Fluoromount-GThermo Scientific7984-25
GAPDH AntibodySanta Cruzsc-32233
GlucoseGibco15023-021
GlutamateSigmaG1626
Glutaraldehyde 25% Aqueous SolutionElectron Microscopy Sciences16210
Goat anti-Mouse IgG (H+L) Secondary Antibody, HRPInvitrogen62-6520
GraphPad Prism v10.6.1GraphPad Software-Statistical/logarithmic regression analysis software
Halt Protease and Phosphatase Inhibitor Cocktail 100XThermo Scientific78442
HEPESBiological Industries41-122-100
Histone H3 (1G1)Santa Cruzsc-517576
Hoechst 33342Life TechnologiesH3570
ImageJ v1.54sNIH-Lipid droplet image analysis software
Immun-Blot PVDF MembraneBioRad1620177
IndomethacinSigmaI7378
Insulin syringeCranberryAAJECIN3Used for cell homogenization; supplier/catalog not provided
KClCalbiochem529552
KH2PO4Calbiochem529568
KHCO3Sigma60339
LAMP-1 AntibodyAbcamab25245
Lane Marker Reducing Sample BufferThermo Scientific39000
MalateSigmaM1000
MgCl2Calbiochem208291Component of mitochondrial assay solution; supplier/catalog not provided
MgSO4SigmaM2643
Microvolume UV-Vis spectrophotometerNanoDropND-1000Used for DNA/RNA quantification; supplier/catalog not provided
MilliQ water sterile--
MitoTracker Deep Red FMThermo ScientificM22426
MitoTracker GreenThermo ScientificM7514
NaClMerck1064041000
Nikon C2plus confocal laser scanning microscopeNikonC2-SCHJ-1Added from Supplemental Methods
Nikon Ti2 inverted microscopeNikonMEA54010Added from Supplemental Methods
NIS-Elements AR software v5.11.03NikonMQS31000Added from Supplemental Methods
Nuclease-free waterWinklerBM-0140
Optical 96-well qPCR plateThermo Scientific4346907Used for qPCR; supplier/catalog not provided
Optical adhesive filmThermo Scientific4311971Used for qPCR plate sealing; supplier/catalog not provided
Orbital shakerLab-Line4630-1Used during blocking/permeabilization; supplier/catalog not provided
Osmium TetroxideElectron Microscopy Sciences19100
Oxygraph+Hansatech-
PBS 10X Biologia MolecularWinklerBM-1340
Plan Apo 60x oil immersion objective, NA 1.4NikonMRD01605Added from Supplemental Methods
Plan-Apochromat 10x/0.45 M27 air objectiveCarl Zeiss420640-9900-000Added from Supplemental Methods
R software v4.5.2R Foundation-Used for data analysis
Real-time PCR instrumentThermo ScientificQuantum Studio 3Used for reverse transcription and qPCR; supplier/catalog not provided
Reynolds Stain (Lead Citrate 3%)Electron Microscopy Sciences22410-1
RIPA lysis bufferThermo Scientific89901
RosiglitazoneMerck557366
RStudioPosit-Used for R analysis; manuscript/supplement cites RStudio
SaponinSigma47036
Sodium bicarbonateSigmaS5761
Sodium CacodylateElectron Microscopy Sciences12300
Sodium Dodecyl SulfateBioRad1610301
Sodium hydroxide (NaOH)MerckB0547933Solvent for T3; supplier/catalog not provided
SucroseMerck573113Component of mitochondrial isolation buffer; supplier/catalog not provided
Tetramethylethylenediamine (TEMED)BioRad1610800
Thermo Scientific F200C TEMThermo Scientific-
TOMM20 antibodyCell Signaling42406
Tris Buffered Saline (TBS-10X)Cell Signaling12498
TRIzol reagentInvitrogen15596018
Trypsin-EDTA (0.25%)Gibco25200056
Tuberculin syringeNIPROJD-01T2516/IBUsed for cell disruption; supplier/catalog not provided
TURBO DNA-free KitThermo ScientificAM1907
Tween 20, Molecular Biology GradePromegaH5152
Ultracut RLeica-
Uranyl AcetateElectron Microscopy Sciences22400
VAP-A AntibodySanta Cruzsc-293278
Vinculin AntibodySanta Cruzsc-73614
Westar SupernovaCyanagenXLS3
Zeiss LSM 880 confocal laser scanning microscope with Airyscan detectorCarl Zeiss421102-9010-000
ZEN softwareCarl Zeiss-Airyscan/deconvolution software
GeneForward (5’→3’)Reverse (5’→3’)
H-mtDNACACTTTCCACACAGACATCACACTTTCCACACAGACATCA
PPARyCACAATGCCATCAGGTTTGGGCTGGTCGATATCACTGGAGATC
PPARαACAAGGCCTCAGGGTACCAGCCGAAAGAAGCCCTTACAG
PCGα-1AACCACACCCACAGGATCTCTTCGCTTTATTGCTCCATGA
UCP1GAGGTGTGGCAGTGTTCATTGGGCTTGCATTCTGACCTTCA
PRDM16GACATTCCAATCCCAGACACCTCTGTATCCGTCAGCA
PLIN1GGGCTGTCTGAGACTGAGGTGCAGAACTCTCTGGAGCACG
FATP4ACCCAAAGCTGCCATTGTGGCATGCGGAATCCAAGTACCA
36b4CACTGGTCTAGGACCCGAGAAGGGTGCCTCTGGAGATTTTCG

Reprints and Permissions

Tags

Biologymitochondriaadipogenesisbrown adipose tissuelipodystrophy
Video Coming Soon