Method Article

Generation and Phenotypic Characterization of a CRISPR/Cas9-Engineered Cracd-Deficient Mouse Model for Post-Myocardial Infarction Remodeling Studies

78 views

⸱

DOI:

10.3791/71451

⸱

September 8th, 2026

In This Article

Summary

This protocol describes the generation and phenotypic characterization of a C57BL/6N-Cracdem1(c.538-83 to c.3352+255 del) mouse model using CRISPR/Cas9 technology to study the role of CRACD in cardiac remodeling following myocardial infarction.

Abstract

Myocardial infarction (MI) remains a major cause of morbidity and mortality worldwide. This protocol describes a method for generating and characterizing a Cracd-deficient mouse line on the C57BL/6N background using CRISPR/Cas9 technology. Zygotes were co-injected with Cas9 mRNA, a gRNA construct, and a donor template designed to generate a 3153-bp genomic deletion. The edited allele was confirmed by PCR genotyping and Sanger sequencing. To assess the functional role of CRACD in post-MI remodeling, Cracd-deficient and wild-type (WT, C57BL/6N) mice underwent MI induced by permanent ligation of the left anterior descending coronary artery. On postoperative day 7, cardiac function and left ventricular wall motion were assessed using transthoracic echocardiography and speckle-tracking strain imaging, followed by histopathological evaluation with H&E and Masson's trichrome staining. Representative results showed that Cracd-deficient mice exhibited reduced ventricular dilation and preserved systolic function compared to WT controls. This protocol provides a reliable experimental platform for mechanistic studies of CRACD in cardiac pathophysiology.

Introduction

Myocardial infarction (MI) remains a leading cause of morbidity and mortality worldwide, contributing to a significant burden on global cardiovascular health1. The long-term prognosis following MI is primarily determined by the process of left ventricular (LV) remodeling2, which involves ventricular dilation, wall thinning, and interstitial fibrosis3,4, which are key contributors to the progression to heart failure (HF). The global incidence of HF resulting from post-MI cardiac remodeling further exacerbates the burden of cardiovascular disease5. Despite these well‑established clinical observations, systematic studies that use sensitive, reproducible in vivo models to assess the role of specific genes in post‑MI remodeling are lacking. No protocol currently combines a CRISPR/Cas9‑engineered knockout model with advanced strain imaging to evaluate a cytoskeletal regulator like CRACD. Thus, a method enabling precise genetic manipulation and high‑resolution cardiac phenotyping is urgently needed.

Capping protein inhibiting regulator of actin dynamics (CRACD), also known as KIAA1211, is a regulator of actin polymerization predominantly localized in the cytosol that plays a critical role in cytoskeletal dynamics6. It positively regulates actin polymerization by binding to actin-capping proteins (CAPZA1, CAPZA2, CAPZB) and preventing them from capping to the barbed ends of actin filaments7. In epithelial tissues, CRACD plays a critical role in maintaining cell morphology and signal transduction by preserving the integrity of the actin cytoskeleton8,9. In tumor cells, its dysregulation is associated with enhanced cell metastasis and proliferation6,10. The role of CRACD in the heart has not been fully understood. Cardiac transcriptome and experimental intervention studies show that Cracd gene expression responds to pathological stress and may regulate genes related to the cytoskeletal dynamics during ventricular remodeling9,11. Furthermore, its inhibiting protein CapZ has been closely linked to cardiac pathology: the phosphorylation of CapZ regulates the growth of myofibrils during hypertrophy induced by phenylephrine12. Our early research indicates that moderate downregulation of CRACD confers protection against myocardial damage and preserves myofilament contractility following acute ischemia13. These findings raise the possibility that CRACD plays a role in maladaptive ventricular remodeling after MI. However, systematic in vivo loss‑of‑function studies testing whether Cracd deficiency modulates post‑MI remodeling have been lacking, largely due to the absence of a validated step‑by‑step protocol for generating and phenotyping a Cracd‑deficient mouse under ischemic stress.

Several approaches exist for generating constitutive knockout mice. Traditional homologous recombination in embryonic stem (ES) cells is precise but costly, time‑consuming (12–18 months), and limited to certain mouse strains14. ENU (N‑ethyl‑N‑nitrosourea) mutagenesis produces random point mutations requiring extensive backcrossing and sequencing15. In contrast, CRISPR/Cas9 offers distinct practical advantages for this study: (i) direct zygote injection shortens the timeline to 4–6 months; (ii) it allows deletion of a large genomic fragment (3153 bp) to ensure complete loss of function; (iii) it works directly on the C57BL/6N background without strain conversion; and (iv) it avoids a selectable marker, minimizing unintended transcriptional interference. Therefore, CRISPR/Cas9 is the most efficient choice for generating a Cracd‑deficient line suitable for routine cardiovascular phenotyping. This technology has been widely used for conducting precise in vivo loss-of-function studies16,17.

Speckle‑tracking strain imaging is a post‑processing technique that follows the movement of natural acoustic speckles within the myocardium frame by frame, allowing the calculation of myocardial deformation parameters such as strain (fractional change in length) and strain rate (rate of deformation)18. Unlike conventional M‑mode or two‑dimensional echocardiography, which provides global functional indices (ejection fraction, fractional shortening, left ventricular internal diameter) and is relatively insensitive to regional wall‑motion abnormalities, strain imaging can quantify segmental contractile function. This is particularly important in the early post‑infarction period, where compensatory hyperkinesis of non‑infarcted segments may preserve global ejection fraction despite significant regional dysfunction. Speckle‑tracking offers several advantages over standard endpoints: it yields segmental strain and strain rate, displacement, and velocity, thereby detecting subtle subclinical changes19; it can identify dyssynchrony and early contractile deficits before irreversible remodeling occurs; and it directly interrogates the subendocardium, the layer most vulnerable to ischemia20. In this study, CRACD is a cytoskeletal regulator that may influence myofiber contractility at the microscopic level. Conventional cavity‑based measurements could easily miss such local mechanical effects. Thus, integrating speckle‑tracking analysis into this protocol enhances the ability to detect early protective effects of Cracd deficiency. Accordingly, integrating speckle‑tracking into this protocol provides a sensitive and quantitative tool to evaluate post‑infarction remodeling, especially during the first week after MI when early dilation and contractile dysfunction emerge21,22.

This protocol is designed for researchers investigating the functional impact of a specific gene deletion on acute (7‑day) post‑MI remodeling using a combination of constitutive knockout and high‑resolution imaging. It is appropriate for hypothesis‑generating studies where global loss of the target gene is acceptable and the main endpoint is early systolic function and structural changes. However, several limitations should be considered. First, the Cracd‑deficient mouse is a global knockout; therefore, observed cardioprotective effects cannot be exclusively attributed to loss of CRACD in cardiomyocytes, as systemic contributions may also play a role. Future studies using conditional knockout strategies will be needed to achieve cardiac‑specific deletion. Second, the protocol focuses on a single time point (day 7) and does not address chronic remodeling or HF progression. Longitudinal studies beyond the acute phase will be required. Third, speckle‑tracking analysis demands high‑quality images (clear endocardial borders) and dedicated software, which may not be available in all core facilities. Despite these limitations, the protocol provides a robust, reproducible platform for initial functional characterization of genes involved in post‑MI cardiac remodeling.

This study aimed to utilize the CRISPR/Cas9 system to generate and validate a Cracd-deficient mouse model (C57BL/6N-Cracdem1 (c.538-83 to c.3352+255 del)) for investigating the impact of Cracd deficiency on post-MI cardiac remodeling and ventricular wall motion. MI was induced in both wild-type (WT, C57BL/6N) and Cracd-deficient mice, and comprehensive evaluations were performed one week after MI. Assessments included conventional echocardiographic parameters, speckle-tracking strain analysis, and histopathological evaluation. We specifically focused on the early post-MI phase (day 7) to capture initial remodeling events and to determine whether Cracd deficiency affects ventricular dilation and systolic function during the acute phase of MI. The findings are expected to provide valuable insights into the role of CRACD in modulating adverse cardiac remodeling after MI.

Protocol

All animal experiments were approved by the Institutional Animal Care and Use Committee of the Guangdong Institute of Biotechnology (Approval No. IACUC2025179). The study utilized 20 SPF Cracd-deficient and 20 age- and weight-matched WT mice. All mice were 10–12 weeks old and weighed 20–25 g. All male animals were housed in an AAALAC-accredited facility (License No. SYXK (Yue) 2016-0122) at the Guangdong Institute of Biotechnology (Guangdong Laboratory Animals Monitoring Institute). The housing environment was maintained at 22–25 °C with 50–70% relative humidity under a 12 h light/12 h dark cycle.

1. Generation of Cracd-deficient mice using CRISPR/Cas9

  1. Use CRISPR/Cas9 gene editing technology to generate Cracd-deficient mice on a C57BL/6N background. Delete the genomic sequence from c.538-83 to c.3352+255 (partial intron 5 to intron 6) of Cracd by homology-directed repair.
    NOTE: The mouse Cracd gene (NCBI RefSeq: NM_001163793.1; Ensembl: ENSMUSG00000036377) is located on chromosome 5 and contains 9 exons, with the ATG start codon in exon 2 and the TAA stop codon in exon 9.
  2. Design the sequence of gRNA targeting vector and donor oligonucleotide (with targeting sequence flanked by 120 bp homologous sequences combined on both sides).
    1. Log in to the NCBI website, select the Primer-BLAST function, and design PCR primers for genotyping.
    2. Paste the NCBI reference sequence number of Cracd (NM_001163793.1) into the PCR template field, specify the exon range for amplification, and click “Get Primers” to retrieve multiple pairs of candidate primers for PCR-based detection of the deletion and wild-type alleles.
  3. Design single-guide RNAs (gRNAs) to target sites flanking the intended deletion interval in the Cracd gene.
    1. Select four gRNA sequences (20 nt upstream of the PAM) using online CRISPR design tools.
    2. To minimize potential off-target effects, score the candidate gRNAs with CRISPRater and select the two optimal sequences (including the NGG PAM).
      NOTE: Example selected sequences:
      gRNA-A1: CGGCGCTCTTAACATCCAGAGGG (score: 0.71)
      gRNA-A2: CCCTTCAGTCTGGGTAGTAGAGG (score: 0.71)
      ​Accept gRNAs with a CRISPRater score ≥ 0.5. For in vitro validation, accept gRNAs with > 50% cleavage efficiency in a Cas9/gRNA target efficiency detection kit.
  4. Design a single-stranded donor oligonucleotide to promote efficient joining of the intended breakpoints. Example donor sequence: TTAACCATCAACGGGCCGCTGCAAGGGCTGCTGT
    GTCTATA CTCAGGACCACCTGCCCTCTAGAGGCAGGAAGGT
    AGAGTTCCAAGCTCTGCTGTGCTAGGTTAAATGCAACTTAACATC.
  5. Co-inject Cas9 mRNA, gRNA and donor oligonucleotide into fertilized eggs to generate Cracd-deficient mice. Prepare Cas9 mRNA and gRNA by in vitro transcription.
    1. Preparation of gRNA.
      1. Transcribe gRNAs in vitro from DNA templates using the MEGAshortscript™ T7 transcription kit (see Table of Materials) following the manufacturer's protocol.
      2. Purify the transcribed gRNAs using an RNA purification kit (see Table of Materials) and elute them in RNase-free water.
      3. Assess gRNA cleavage activity using an in vitro Cas9/gRNA target efficiency detection kit (see Table of Materials).
      4. Perform all RNA preparation steps on ice using RNase‑free consumables (pipette tips, tubes, water). Keep RNA samples on ice at all times to prevent degradation.
    2. To perform the cleavage assay: mix the transcribed gRNA (25 ng/µL) with recombinant Cas9 protein (50 ng/µL) and a PCR-amplified DNA fragment containing the target sequence (50 ng).
      1. Incubate the reaction at 37 °C for 30 min.
      2. Run the products on a 2% agarose gel to visualize uncleaved and cleaved bands.
      3. Calculate cleavage efficiency as the ratio of cleaved band intensity to total (cleaved + uncleaved) band intensity.
      4. Accept gRNAs with > 50% cleavage efficiency.
    3. Preparation of Cas9 mRNA.
      1. Thaw the reagents from the T7 ARCA mRNA Kit (see Table of Materials).
      2. At room temperature, combine 10 µL of 2× ARCA/NTP mix, 1 µL of template DNA, 2 µL of T7 RNA polymerase mix, and nuclease-free water to 20 µL.
      3. Mix thoroughly, pulse-spin in a microfuge (5 s at 5000 × g), and incubate at 37 °C for 30 min.
    4. Remove the template DNA by adding 2 µL of DNase I (1 U/µL), mix well, and incubate at 37 °C for 15 min to obtain Cas9 mRNA. Optionally add 1 µL of RNase inhibitor (40 U/µL) (see Table of Materials) to the reaction to prevent RNA degradation.
      1. Perform all steps on ice with RNase‑free consumables. Keep the Cas9 mRNA on ice until use.
    5. Superovulate 4-week-old C57BL/6N female mice by intraperitoneal injection of 5 IU of pregnant mare serum gonadotropin (PMSG), followed 48 h later by 5 IU of human chorionic gonadotropin (hCG).
      CAUTION: PMSG and hCG are hormones that may cause skin sensitization. Wear gloves and dispose of needles in a sharps container.
    6. Approximately 14–18 h after hCG injection, euthanize the C57BL/6N female mice and one 8–12-week-old C57BL/6N male mouse by cervical dislocation. Collect oocytes from the oviducts of the females and sperm from the cauda epididymis of the male.
      ​CAUTION: Euthanasia must be performed in accordance with institutional guidelines. Cervical dislocation should only be performed by trained personnel.
    7. Capacitate the sperm in capacitation medium (see Table of Materials).
      1. Add a small volume of the sperm suspension to the oocytes for in vitro fertilization and co-culture for 3–4 h at 37 °C to obtain fertilized zygotes.
    8. Dilute the transcribed gRNA and Cas9 mRNA with RNase-free water to working concentrations (typically 25 ng/µL for gRNA and 50 ng/µL for Cas9 mRNA) and donor oligonucleotide at 10 ng/µL.
      1. Microinject 1–2 pL of the mixture into the cytoplasm of fertilized zygotes using a microinjection system (see Table of Materials).
      2. Identify healthy zygotes by the presence of two distinct pronuclei and an intact polar body under a stereomicroscope.
      3. Transplant 300 healthy fertilized zygotes into the oviducts of pseudopregnant female mice that have been mated with vasectomized males.
        ​NOTE: This results in the generation of 2 positive founder mice (F0).
      4. Use RNase‑free water and ice‑cold conditions during dilution to maintain RNA integrity.
    9. Identify F0 mice by PCR genotyping of tail biopsies (see section 1.6).
      1. Breed F0 founders with WT mice to generate F1 heterozygous offspring, to obtain germline transmission of the deletion.
      2. Intercross heterozygous F1 mice to produce F2 homozygous Cracd-deficient mice.
  6. Genotype by Polymerase Chain Reaction (PCR)
    NOTE: The following protocol uses a commercial TIANamp Genomic DNA Kit (see Table of Materials). Buffer GL is the lysis buffer, Buffer GB is the binding buffer, and Buffer WA and Buffer WB are wash buffers.
    1. Place approximately 2–5 mm of mouse tail tissue in a microcentrifuge tube containing 180 µL of Buffer GL, 20 µL of Proteinase K (20 mg/mL stock solution), and 10 µL of RNase A (10 mg/mL stock solution).
      1. Incubate the sample at 56 °C overnight to digest the tissue.
    2. Centrifuge the tube at 13800 × g for 2 min at room temperature to pellet tissue debris and transfer the supernatant to a new tube.
    3. Add 200 µL of Buffer GB and 200 µL of 100% ethanol to the supernatant, mix thoroughly, and apply the mixture to a spin column placed in a collection tube.
      1. Centrifuge at 13800 × g for 2 min at room temperature and discard the flow-through.
    4. Add 500 µL of Buffer WA to the column, centrifuge at 13800 × g for 1 min at room temperature and discard the flow-through.
    5. Carefully add 700 µL of Buffer WB (wash buffer containing ethanol, pre-mixed with 100% ethanol) to the spin column, centrifuge at 13800 × g for 1 min at room temperature and discard the flow-through.
      1. Apply Buffer WB to the inner wall of the column to wash residual salts.
    6. Repeat step 1.6.5 once, then transfer the column into a new collection tube and centrifuge at 13800 × g for 2 min at room temperature to dry the membrane and remove residual ethanol.
    7. Place the column into a new 1.5 mL microcentrifuge tube. Add 50–200 µL of sterilized water or elution buffer (preheated to 65 °C) to the center of the membrane, incubate for 5 min.
      1. Centrifuge the column at 13800 × g for 2 min at room temperature to elute the DNA.
      2. To increase DNA yield, either reapply the flow-through to the membrane or add an additional 50–200 µL of sterilized water, incubate for 5 min.
      3. Perform a final centrifugation at 13800 × g for 2 min.
        ​NOTE: Expect DNA yield of 50–200 ng/µL from tail tissue; A260/A280 ratio of 1.8–2.0 indicates pure DNA.
  7. Genotyping by multiplex PCR using three primers in a single reaction.
    1. Design three primers to distinguish WT, heterozygous, and homozygous genotypes in one PCR reaction: Forward primer F1 (5’-CAGAAGTCATAGCAGCAAGGCAG-3’, binds upstream of the deletion), Forward primer F2 (5’-GAGGGAATTGAGAGGGAGCC-3’, binds within the deleted region, present only in the WT allele), and Reverse primer R1 (5’-GCCAATTTAGCTGCTTCAAATGTTC-3’, common reverse primer downstream of the deletion).
      NOTE: The targeted allele generates a 421 bp amplicon (F1 + R1) only when the deletion is present; the WT allele generates a 357 bp amplicon (F2 + R1) only when the intact allele is present.
    2. Set up the PCR reaction in a 25 µL total volume containing 50–100 ng genomic DNA, 0.2 µM of each primer (F1, F2, and R1), 200 µM dNTPs, 1.5 mM MgCl₂, and 1 U Taq DNA polymerase (see Table of Materials).
    3. Use the following thermocycling program: initial denaturation at 95 °C for 3 min; 35 cycles of denaturation at 95 °C for 15 s, annealing at 60°C for 15 s, and extension at 72 °C for 25 s; and a final extension at 72 °C for 5 min.
      1. Separate the PCR products by 1–2% agarose gel electrophoresis (120 V, 30 min) in 1× TAE buffer.
    4. Genotype interpretation based on band pattern: WT shows only a 357 bp band (F2+R1); Heterozygous shows both 421 bp (F1+R1) and 357 bp (F2+R1) bands; Homozygous shows only a 421 bp band (F1+R1).

2. Myocardial infarction model establishment

  1. Anesthetize the mice via inhalation of 3% isoflurane (delivered in 100% oxygen at 1 L/min), place them in a supine position on a surgical platform, and confirm deep anesthesia by the absence of pedal withdrawal reflex.
    CAUTION: Isoflurane is a volatile anesthetic. Use only in a well-ventilated area or under a fume hood to avoid inhalation.
  2. Perform orotracheal intubation using a 20-gauge intravenous catheter sheath. Apply ophthalmic ointment to both eyes to prevent corneal drying during surgery.
    1. Connect the tube to a mechanical ventilator upon successful intubation to maintain ventilation and anesthesia with 2% isoflurane.
      NOTE: Successful intubation is confirmed by visible chest movements synchronized with the ventilator.
  3. Remove hair from the anterior chest with depilatory cream. Disinfect the surgical area by applying povidone-iodine and 70% alcohol in a circular motion for multiple times, starting from the center and moving outward.
    1. After fully exposing the skin, make a 1–1.5 cm incision in the left chest wall between the 2nd and 3rd intercostal spaces to open the thoracic cavity.
    2. Incise the pericardium to fully expose the heart.
      CAUTION: Surgical procedures must be performed under sterile conditions. Use appropriate personal protective equipment (PPE), including gloves and a surgical mask.
  4. Using the inferior border of the left auricle as a landmark, pass a 7–0 atraumatic suture needle beneath the left anterior descending coronary artery (LAD) approximately 2–3 mm distal to its origin.
    1. Pass the needle to a depth of approximately 0.5–1 mm and tighten the ligature slowly to avoid myocardial tearing.
    2. Confirm successful occlusion by observing pallor (whitening) of the left ventricular anterior wall distal to the ligation site within 30 s.
      1. In sham-operated controls, open the chest and pass the suture beneath the coronary artery without tying the knot.
  5. After establishing the model, sequentially suture the ribs (4-0 absorbable suture, simple interrupted pattern) and skin (4-0 absorbable suture, continuous pattern) to close the thoracic cavity. Remove the endotracheal tube once the mouse resumes stable spontaneous breathing.
  6. Place mice on a heating pad (37 °C) until fully conscious.
    1. Administer postoperative analgesia (e.g., buprenorphine 0.05–0.1 mg/kg, subcutaneously, every 12 h for 48 h) according to institutional IACUC guidelines and closely monitor the postoperative health status for several days.
      NOTE: Monitor for signs of distress (hunched posture, ruffled fur, reduced mobility, weight loss > 20%).
  7. Mortality and exclusion criteria.
    1. Record the number of mice that die within the first 7 days after MI surgery.
      NOTE: In a typical cohort, expect a mortality rate of approximately 10–20% by postoperative day 7, with no significant difference between WT and Cracd‑deficient mice. Common causes of death include extensive infarction leading to acute heart failure, surgical bleeding, or pneumothorax. Exclude any mouse with persistent arrhythmia (heart rate < 350 bpm) or signs of severe distress (e.g., hunched posture, ruffled fur, weight loss > 20%) from subsequent echocardiographic and histological analyses. For sham‑operated mice, mortality should be < 5%.

3. Echocardiographic assessment

  1. Animal Preparation and Anesthesia
    1. Power on the high-resolution small animal ultrasound imaging system (see Table of Materials) and its integrated heated stage.
      1. Ensure that the appropriate high-frequency transducer is securely connected to the mounting apparatus following the manufacturer’s instructions. Set the temperature of the heated stage to 37 °C and allow it to stabilize.
    2. Place mice in an induction chamber and anesthetize them with 3% isoflurane in oxygen (1–2 L/min) until the pedal withdrawal reflex is absent. Transfer anesthetized mice to the heated platform in a supine position.
      1. Maintain anesthesia with 1–1.5% isoflurane delivered via a nose cone, adjusting to maintain heart rate between 450–550 beats per min.
    3. Apply ophthalmic ointment to both eyes to prevent corneal drying.
      1. Shave the thoracic region, evenly apply depilatory cream for no longer than 3 min, then remove the depilatory cream thoroughly with wet gauze.
      2. Rinse the skin gently with warm saline if necessary and dry the area. Attach surface ECG electrodes to the limbs using electrode gel at the contact sites and secure them with tape.
        ​NOTE: Confirm stable ECG and heart rate within 450–550 bpm before proceeding to ultrasound imaging.
  2. Conventional Echocardiography Image Acquisition
    1. Position the mouse in a horizontal, supine posture on the heated stage, with a slight leftward tilt if needed to optimize cardiac imaging.
      1. Apply a generous amount of pre-warmed ultrasound coupling gel to the hairless left precordial region, avoiding air bubbles.
      2. Place the transducer gently on the chest wall at the left parasternal position. Adjust its orientation so that the index mark points toward the mouse’s right shoulder and fine-tune the angle and pressure to optimize image quality.
    2. Switch to B-mode (two-dimensional) imaging, adjust depth, focus zone, and frame rate to obtain a clear parasternal long-axis view of the left ventricle. Acceptable image quality requires clear visualization of the endocardial border with no dropouts.
    3. Once the heart rate stabilizes (450–550 bpm), acquire three separate parasternal long-axis B-mode cine loops, each containing at least 3–5 consecutive cardiac cycles.
      1. Save each loop by pressing “Cine Store”, and store representative still frames using “Frame Store”.
    4. From the long‑axis view, rotate the transducer 90° clockwise to obtain a short‑axis view at the mid‑papillary level.
      1. Acquire three separate short‑axis B‑mode cine loops (each with ≥ 3–5 cycles).
      2. Activate M‑mode, position the cursor perpendicular to the interventricular septum and posterior wall, and record three separate M‑mode tracings.
        ​NOTE: Acceptable M‑mode tracings require clear endocardial borders throughout the cardiac cycle.
    5. Use the VevoLab 3.2.0 software (see Table of Materials) to measure the following parameters from M‑mode tracings according to the American Society of Echocardiography leading‑edge method: interventricular septum thickness at diastole and systole (IVSd, IVSs), left ventricular internal diameter at diastole and systole (LVIDd, LVIDs), and left ventricular posterior wall thickness at diastole and systole (LVPWd, LVPWs).
      1. Calculate left ventricular ejection fraction (EF) and fractional shortening (FS) using the Teichholz formula: EF (%) = [(LV Vold - LV Vols) / LV Vold] × 100, LV Vold = ((7 / (2.4 + LVIDd)) × LVIDd3), LV Vol;s = ((7 / (2.4 + LVIDs)) × LVIDs3), FS (%) = [(LVIDd – LVIDs) / LVIDd] × 100.
        NOTE: For each mouse, measurements were averaged from three consecutive cardiac cycles per M‑mode recording, and the average was taken across three separate recordings, resulting in a total of 9 measurements per parameter per mouse.
  3. Speckle-Tracking Strain Analysis
    1. Perform speckle-tracking analysis using the dedicated analysis software (VevoStrain module within VevoLab 3.2.0).
      1. Open a clear parasternal long-axis B-mode cine loop, select "Vevo Strain" to enter the strain analysis mode, retain only complete cardiac cycles, and choose "Long Axis".
    2. Manually trace the endocardial border at the end‑diastolic frame. After the endocardial border is drawn, the software automatically generates an epicardial border (adjust as needed). Then start the strain analysis and activate the "toggle contour/vector/orbit line/B mode" function to visualize the motion trajectory.
    3. Assess tracking quality via the colour‑coded mesh: it should appear green, closely follow the endocardial and epicardial borders without jerking, and move synchronously with myocardial contraction/relaxation. If not, manually refine the borders and re‑analyze.
    4. Activate "Time‑to‑peak analysis" to divide the left ventricle into six segments (basal anterior, mid anterior, apical anterior, apical posterior, mid posterior, basal posterior), with each colour representing an individual segment. Once satisfactory tracking is achieved, export data for wall motion parameters: velocity (cm/s), displacement (cm), strain (%), strain rate (1/s) for both longitudinal and radial.
      NOTE: If tracking quality remains poor after three acquisition attempts (e.g., erratic strain curves, or inability to visualise clear motion trajectories), exclude the mouse from strain analysis.

4. Histopathological analysis

  1. After echocardiography, administer a lethal dose of isoflurane to deeply anesthetized mice and apply a secondary physical method (e.g., cervical dislocation) according to institutional guidelines.
    1. Open the thoracic cavity, rapidly harvest the hearts and rinse the hearts gently in cold phosphate-buffered saline (PBS).
      CAUTION: Euthanasia must be performed according to institutionally approved protocols.
  2. Trim the hearts, remove the great vessels and cut transversely from apex to base into 2–3 slices (approximately 2–3 mm thick).
    1. Immerse the tissue slices in 4% paraformaldehyde in PBS and fix them at 4 °C for 12–24 h.
      NOTE: Use a volume ratio of fixative to tissue of at least 10:1.
      CAUTION: Paraformaldehyde is toxic and a suspected carcinogen. Handle in a fume hood and wear appropriate PPE (gloves, lab coat, safety goggles). Dispose of paraformaldehyde waste as hazardous chemical waste according to institutional guidelines.
  3. Dehydrate tissue through a graded ethanol series (50%, 70%, 80%, 95%, 100% ethanol, each for 1 h), clear them in xylene (2 changes, 30 min each), embed them in paraffin, and section them at 4–5 µm thickness using a microtome.
    NOTE: Sections should be free of folds and tears.
    CAUTION: Xylene is flammable and toxic. Use only in a fume hood and avoid skin contact. Collect xylene waste in a designated container and dispose of as hazardous chemical waste.
  4. Deparaffinize the sections in xylene (2 changes, 5–10 min each), rehydrate them through descending ethanol series (100%, 95%, 80%, 70%, each for 3 min) to water.
    1. Stain them using standard Hematoxylin and Eosin (H&E) (see Table of Materials) and Masson’s trichrome protocols (see Table of Materials).
      CAUTION: Xylene is toxic. Use only in a fume hood and avoid skin contact. Dispose of xylene waste as hazardous material.
  5. Examine the stained sections under a light microscope (see Table of Materials).
    1. For quantitative analysis, capture digital images at 4×, 20×, and 40× magnification using a digital camera attached to the microscope. Measure infarct size and fibrotic area using ImageJ.
      NOTE: Infarct size (%) = (infarct area / total LV area) × 100; collagen content (%) = (blue-stained area / total myocardial area) × 100.

Results

Generation of Cracd-deficient mice

A heritable mouse model carrying a targeted deficiency in the Cracd gene was generated using CRISPR/Cas9-mediated genome editing (Figure 1A, Figure 1B). To distinguish WT, heterozygous, and homozygous genotypes, a multiplex PCR was performed using three primers (F1, F2, R1) in a single reaction. Mice homozygous for the deletion (Cracd‑deficient) displayed only the 421 bp band, WT mice showed only the 357 bp band (Figure 1C). Sanger sequencing of genomic DNA from Cracd-deficient mice confirmed the predicted deletion in the target gene compared to WT controls (Figure 1D). Western blot analysis further demonstrated a marked reduction in CRACD protein levels in cardiac tissues from Cracd-deficient mice compared with WT controls (Figure 1E). Together, these data confirm the successful establishment of the Cracd-deficient mouse line.

Echocardiography

Echocardiographic assessment on postoperative day 7 revealed pronounced pathological cardiac remodeling in WT mice after MI (WT-MI) compared with sham-operated controls (Figure 2A). The WT-MI group showed thinning of the interventricular septum (Figure 2B, C), significant left ventricular (LV) dilation as reflected by increased LVIDd (Figure 2D) and LVIDs (Figure 2E), and thinning of the posterior wall (Figure 2F, G). These structural alterations were associated with a pronounced decline in global systolic function, as demonstrated by significantly reduced EF (Figure 2H) and FS (Figure 2I). In contrast, Cracd-deficient mice displayed a cardioprotective phenotype following MI. LV dilation was significantly attenuated, with notably smaller LVIDd and LVIDs compared with the WT-MI group. Furthermore, these mice exhibited improved systolic thickening of the posterior wall and maintained significantly higher EF and FS values. These findings indicate that Cracd deficiency effectively attenuates post-infarction LV dilation and preserves global systolic function.

Speckle-tracking strain analysis

Left ventricular myocardial motion and deformation were further evaluated by speckle‑tracking echocardiography using only parasternal long‑axis views (Figure 3A). To ensure data reliability, we defined pragmatic criteria for acceptable output based on the capabilities of the VevoStrain software. Acceptable strain analysis required: (i) a clear parasternal long‑axis view with endocardial borders visible throughout the cardiac cycle; (ii) a stable heart rate between 450–550 bpm during acquisition; (iii) after automatic tracking, the colour‑coded mesh (activated via “toggle contour/vector/orbit line/B mode”) had to closely follow the endocardial and epicardial borders without jerking or losing contact; and (iv) strain curves had to be smooth, show consistent waveforms across segments, and lack sudden spikes or arrhythmic interruptions. Suboptimal output—most commonly erratic strain curves or inability to visualise clear motion trajectories—led to manual adjustment of endocardial or epicardial contours and re‑analysis. If quality remained poor after three attempts, the mouse was excluded. Using these criteria, we obtained reliable strain data in WT‑MI mice and Cracd‑deficient MI mice.

Compared with the sham group, WT-MI mice exhibited significantly reduced radial velocity (Figure 3B) and longitudinal velocity (Figure 3C), as well as radial displacement (Figure 3D) and longitudinal displacement (Figure 3E), indicating impaired global myocardial motion. The absolute values of radial strain (Figure 3F), radial strain rate (Figure 3G), longitudinal strain (Figure 3H), and longitudinal strain rate (Figure 3I) were also markedly decreased, reflecting severely compromised regional myocardial deformation and function. In contrast, Cracd-deficient mice showed significant improvement in these parameters. Compared with the WT-MI group, they displayed better recovery of radial and longitudinal displacements. Furthermore, radial velocity, radial strain, and radial strain rate were maintained at higher levels, while longitudinal strain and longitudinal strain rate were significantly improved. These results suggest that Cracd deficiency not only preserves global systolic function but also enhances regional LV myocardial deformation after MI.

The speckle‑tracking imaging analysis also included visualization of segmental strain distribution and cardiac motion trajectories. Parasternal long‑axis B‑mode images with segmented six regions (BA, MA, AA, AP, MP, BP) and color gradient mapping are displayed in Figure 4A. Cardiac motion trajectories, time‑to‑peak curves for radial and longitudinal strain, parametric distribution maps of strain synchrony, and three‑dimensional reconstructions are presented in Figure 4B. These data further support the functional improvements observed in Cracd‑deficient mice.

Histological examination

To assess the protective effect of Cracd deficiency against MI, histopathological examination was performed on heart sections from WT and Cracd-deficient mice at 7 days post-MI using H&E and Masson's trichrome staining. Whole‑heart longitudinal sections are shown in Figure 5A, with quantitative analysis of infarct size and collagen content presented in Figure 5B and Figure 5C, respectively. High‑magnification views of the infarct zone, border zone, and remote zone are displayed in Figure 5D. In WT-MI hearts, H&E staining showed pronounced left ventricular wall thinning and a well-demarcated infarct zone. Within the infarct region, extensive inflammatory cell infiltration, myocardial necrosis, and marked fibrosis with scar formation were observed. In the border zone, inflammatory infiltration, myocardial necrosis, fibrosis and cardiomyocyte hypertrophy were evident, while the remote zone displayed prominent hypertrophic changes. Corresponding Masson's trichrome staining further demonstrated extensive interstitial fibrosis within both the infarct and border zones of WT hearts following MI. In contrast, Cracd-deficient mice exhibited substantially attenuated pathological alterations, including reduced wall thinning, diminished inflammatory infiltration and myocardial necrosis, less pronounced cardiomyocyte hypertrophy, and markedly decreased interstitial fibrosis compared with WT-MI hearts. These histological findings indicate that Cracd deficiency mitigates post-infarction myocardial damage and adverse remodeling.

Successful protocol execution should yield: (i) a well‑demarcated infarct zone with extensive collagen deposition in WT-MI hearts; (ii) clear cellular morphology without staining artifacts; and (iii) significantly attenuated pathology in Cracd‑deficient MI hearts. Although infarct size may vary with ligation precision, the genotype‑dependent difference is a reliable indicator of successful performance.

Gene editing workflow; sgRNA, Cas9, microinjection; PCR, Sanger sequencing, Western blot data.
Figure 1: Generation of Cracd-deficient mice. (A) Construction of Cracd-deficient mice. (B) Schematic of the Cracd gene modification strategy. (C) PCR genotyping of tail genomic DNA. WT mice show a single 357 bp band, while homozygous (Cracd‑deficient) mice show a single 421 bp band. (D) Sanger sequencing of genomic DNA confirmed the predicted deletion in the Cracd locus of deficient mice compared to WT controls. (E) Western blot analysis showed significantly reduced CRACD protein levels in the hearts of Cracd-deficient mice compared to WT controls. n = 6 mice per group. Data are presented as mean ± SEM. Statistical significance was calculated with a two-tailed unpaired Student's t-test. Please click here to view a larger version of this figure.

Cardiac ultrasound images, systolic/diastolic comparison, echocardiography graphs for research analysis.
Figure 2: Echocardiographic assessment of cardiac function. (A) Representative B-mode and M-mode echocardiographic images of mouse hearts at diastole and systole. Quantitative analysis of (B) interventricular septum thickness at diastole (IVSd) and (C) systole (IVSs), (D) left ventricular internal diameter at diastole (LVIDd) and (E) systole (LVIDs), (F) left ventricular posterior wall thickness at diastole (LVPWd) and (G) systole (LVPWs), (H) ejection fraction (EF), and (I) fractional shortening (FS). n = 10 mice per group. Data are presented as mean ± SEM. Statistical significance was determined by one-way ANOVA followed by Tukey's multiple comparisons test. Please click here to view a larger version of this figure.

Cardiac strain analysis using echocardiography; diagrams and graphs; velocity, displacement comparison.
Figure 3: Speckle-tracking strain analysis. (A) Representative images of left ventricular wall motion and deformation at diastole and systole. Quantitative analyses of the following parameters: (B) radial velocity, (C) longitudinal velocity, (D) radial displacement, (E) longitudinal displacement, (F) radial strain, (G) radial strain rate, (H) longitudinal strain, and (I) longitudinal strain rate. n = 10 mice per group. Data are presented as mean ± SEM. Statistical significance was determined by one-way ANOVA followed by Tukey's multiple comparisons test. Please click here to view a larger version of this figure.

Cardiac strain analysis: diagrams show radial, longitudinal strain, peak timing; B-mode ultrasound, graphs.
Figure 4: Speckle-tracking imaging in WT-Sham, WT-MI, Cracd-deficient Sham, and Cracd-deficient MI groups at 7 days post-MI. (A) Parasternal long‑axis B‑mode images. Left ventricular wall was segmented into six regions: BA (basal anterior), MA (mid anterior), AA (apical anterior), AP (apical posterior), MP (mid posterior), and BP (basal posterior). Color gradient from blue to red represents increasing strain magnitude. (B) Cardiac motion trajectories; time-to-peak curves for radial and longitudinal strain values along with corresponding peak times. Parametric distribution maps of strain synchrony (blue/red indicate direction: radial – away from/toward center; longitudinal – away from/toward apex). White dots = highest velocity regions, black dots = lowest velocity. Three-dimensional reconstructions (X: time, Y: spatial position, Z: strain magnitude). Please click here to view a larger version of this figure.

Histological analysis of cardiac tissue using H&E and Masson staining; infarction size chart included.
Figure 5: Histopathological analysis of cardiac remodeling after MI. (A) Whole-heart longitudinal sections with H&E and Masson's trichrome staining. Scale bars: 2 mm. (B) Quantitative analysis of infarct size and (C) collagen content. (D) High‑magnification views of infarct zone (IZ), border zone (BZ), and remote zone (RZ). H&E: yellow circles = inflammatory infiltration; black arrows = myocardial necrosis; green stars = fibrosis; blue arrows = hypertrophy. Masson’s trichrome: blue indicates collagen deposition. Scale bar: 50 μm. n = 5 mice per group. Data are presented as mean ± SEM. Statistical significance was determined by one-way ANOVA followed by Tukey's multiple comparisons test. Please click here to view a larger version of this figure.

Discussion

In this study, we generated a CRISPR/Cas9-engineered Cracd-deficient mouse and set up a workflow to phenotype it after MI using conventional echocardiography, speckle‑tracking strain imaging, and histology. The protocol produced knockouts with confirmed loss of CRACD protein. Cracd‑deficient mice showed less ventricular dilation, better EF, and reduced fibrosis than WT controls after MI, confirming the model’s utility for studying cardiac remodeling.

The success of this model depends on several critical steps. gRNA design and in vitro validation directly affect the efficiency of zygote editing23. We use CRISPick or Benchling to select gRNAs with CRISPRater scores ≥ 0.5 and then test cleavage efficiency with an in vitro Cas9/gRNA assay. Only gRNAs achieving > 50% cleavage are microinjected. Proper LAD ligation is equally crucial: the 7‑0 suture must pass 2–3 mm from the LAD origin at a depth of 0.5–1 mm to avoid puncturing the right ventricle (too deep) or failing to occlude the vessel (too shallow); immediate whitening of the anterior wall confirms occlusion. Heart rate control during echocardiography is also essential24, maintaining 450–550 bpm by adjusting isoflurane (typically 1–2%) improves reproducibility of conventional and strain measurements. Finally, for speckle‑tracking analysis, visual assessment of the colour‑coded mesh is essential25. The mesh must follow myocardial borders without jerking, otherwise manual refinement is needed; if quality remains poor after three attempts, the mouse is excluded.

Even when the protocol is followed meticulously, certain technical difficulties may arise. Systematic troubleshooting can resolve most of them. Low germline transmission rates (below 10%) usually point to poor donor oligonucleotide integration or weak gRNA activity26. Consequently, increasing the donor oligo to 20 ng/µL, extending homology arms to 120–200 bp, and re‑checking gRNA cleavage (> 50%) can improve transmission. High post‑MI mortality (above 30%) often comes from pneumothorax, bleeding and a large infarction27. Hence, keeping mice on continuous oxygen until they wake and using a heating pad to maintain body temperature reduces death rates noticeably. If the anterior wall does not turn pale after ligation, the LAD has probably been misidentified or the suture is too shallow. In this case, relocating the LAD (a bright red diagonal vessel) and re‑passing the needle to a depth of 0.5–1 mm, sometimes with a dissecting microscope, resolve this issue. For poor speckle‑tracking quality, low frame rate, fuzzy borders, or motion artifacts are the usual suspects28. Accordingly, raising the frame rate, fine‑tuning gain, manually correcting the endocardial trace, and discarding cycles with arrhythmias help.

Beyond these operational considerations, the method has clear limitations. The Cracd knockout is global, so CRACD is missing in all tissues. Consequently, the observed protection cannot be attributed exclusively to cardiomyocytes, as systemic contributions may also play a role. A conditional knockout would be needed to separate cell‑type‑specific roles. Another limitation is the single time point at day 7; we see nothing about chronic remodeling. Therefore, later time points (4 or 8 weeks) should be added for long‑term studies. Reproducibility also suffers from image quality dependence: not every ultrasound system can deliver clean endocardial borders, and operator experience matters. Thus, having a professionally trained person perform all surgeries and measurements is recommended.

In view of these limitations, it is useful to compare our approach with alternative strategies for studying gene function in post‑MI remodeling. AAV‑mediated gene manipulation and antisense oligonucleotides (ASOs) are two common alternatives29,30. AAV9 can deliver cardiac‑specific, transient overexpression or knockdown without breeding, but its packaging limit (~4.7 kb), variable transduction efficiency, and off‑target effects are drawbacks31. In contrast, our CRISPR/Cas9 knockout model offers permanent, complete loss of function, which is advantageous for long‑term studies. ASOs provide reversible, dose‑dependent knockdown with rapid onset, making them suitable for acute interventions; however, they need repeated dosing and lack tissue specificity32. Therefore, the constitutive knockout described here is best for initial discovery and chronic phenotyping.

Finally, the protocol can be extended well beyond CRACD. The same workflow—CRISPR/Cas9 generation of knockout mice combined with echocardiography, strain imaging, and histology—can evaluate any candidate gene in post‑MI remodeling. The phenotyping framework also fits other cardiovascular disease models like transverse aortic constriction (pressure overload) or ischemia‑reperfusion injury. Additionally, the tissue samples obtained from this protocol can be used for multi‑omics analyses (transcriptomics, proteomics, metabolomics) to uncover molecular mechanisms. The Cracd‑deficient model can serve as a tool for drug testing: compounds suspected to act through the CRACD pathway can be evaluated. Thus, this protocol provides a platform adaptable to a wide range of mechanistic and translational studies in cardiovascular research.

Disclosures

The authors declare that they have no competing interests.

Acknowledgements

This work was supported by the Guangdong Basic and Applied Basic Research Foundation (2023A1515011278), the Guangdong Provincial Biotechnology Research Institute Self-Funded Project (GDBRI-ZL202602), and the China-Canada Academic Exchange and Cooperation on Cardiovascular Disease Models and Pathogenesis (MS202500058).

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
ACRISPR/Cas9
Trizma Hydrochloride SolutionSigma-Aldrich, USAT2663Used for preparing DNA extraction buffer
Proteinase KSigma-Aldrich, USA539480Used for mouse tail digestion
Green Taq MixVazyme, ChinaP131Used for PCR amplification
AgaroseBioFroxx, Germany1110GR500Used for DNA gel electrophoresis at 1–2% concentration
DNA MarkerThermo Scientific, USASM0242Used as DNA ladder for sizing PCR products
TIANamp Genomic DNA KitTiangen Biotech, ChinaDP304Used for extracting genomic DNA from mouse tail tissue
MEGAshortscript™ T7 transcription kitThermo Scientific, USAAM1354Used for in vitro transcription of gRNA
RNA purification kitZymo Research, USAR1016Used for purifying transcribed gRNA
BeyoCRISPR™ sgRNA Screening KitBeyotime, ChinaD8412SUsed for in vitro evaluation of gRNA cleavage activity
RNase inhibitorNEB, USAM0314Used to prevent RNA degradation during in vitro transcription
TaKaRa TaqTakara Bio, JapanR001AUsed for PCR genotyping of mouse tail DNA
FERTIUP® Mouse Sperm Preincubation Medium: PMCosmo Bio, JapanKYD-002-EXUsed for sperm capacitation prior to in vitro fertilization
T7 ARCA mRNA KitNEB, USAE2060Used for in vitro transcription of Cas9 mRNA
Pregnant mare serum gonadotropinMCE, USA9002-70-4Used for superovulation, administered by intraperitoneal injection
Human chorionic gonadotropinProSpec, IsraelHOR-250Used for induction of ovulation, administered by intraperitoneal injection
RNase-free waterAladdin, ChinaR665526Used for RNA dissolution and PCR setup
PrimersSangon Biotech, China/Used for genotyping
Surgery
IsofluraneRWD Life Science, ChinaR510-22-10Used for induction and maintenance of anesthesia during surgery
Hair removal creamVeet, France1000207Applied to the chest area to remove fur prior to surgery and ultrasound
7-0 SutureLingqiao, ChinaLQ7022380206Used for permanent ligation of the left anterior descending (LAD) coronary artery
4-0 SutureLingqiao, ChinaLQ4022380412Used for closing the skin incision after surgery
Anesthesia ventilatorHarvard Apparatus, USATabletopUsed for delivering isoflurane and supporting respiration
Small animal ventilatorTaimeng, ChinaHX-101EUsed for providing positive pressure ventilation during open-chest surgery
Constant temperature heating padTigerGene, USATG-TP-GSUsed for maintaining mouse body temperature during surgery and recovery
Rib retractorShenzhen Huayon Biotech, ChinaLN-18-4101Used for separating the ribs and exposing the heart for LAD ligation
ScissorsShenzhen Huayon Biotech, China18-0551Used for making skin incisions and cutting tissue
Stereoscopic microscopeNikon, JapanSMZ 745Used for providing a magnified view during LAD artery ligation surgery
Microscopic needle holderShenzhen Huayon Biotech, China18-2211Used for manipulating the small 7-0 suture needle under the microscope
Chemicals and reagents
Ultrasonic coupling agentsTianjin Jinya Technology Development, ChinaTM-100Applied to the chest for echocardiography, ensures proper probe contact
ParaformaldehydeSigma-Aldrich, USAV900894Used for heart tissue fixation after harvest
XyleneMacklin, China1330-20-7Used for paraffin removal and tissue clearing before staining
HematoxylinSigma-Aldrich, USAH3136Nuclear stain, used in HE staining,
EosinSigma-Aldrich, USAE4009Cytoplasmic stain, used in HE staining,
Ponceau SSigma-Aldrich, USAP3504Used in Masson staining for cytoplasm staining
Phosphomolybdic acidSigma-Aldrich, USA221856Used in Masson staining as a mordant and for differentiation
Aniline blue solutionSigma-Aldrich, USA415049Used in Masson staining for collagen fiber staining (blue)
CRACD antibodyAbsea, ChinaKC-35356Primary antibody for detecting CRACD protein by Western Blot, dilution 1:2000
GAPDH antibodyCST, USA2118SLoading control antibody for Western Blot, dilution 1:5000
EthanolMacklin, China64-17-5Used for dehydration and reagent preparation (70%, 80%, 95%, 100% grades)
Laboratory equipment
Sorvall™ Legend™ Micro 17 CentrifugeThermo Scientific, USA75002541Used for routine sample preparation
PCR Thermal CyclerBio-Rad Laboratories, USA1861096Used for DNA amplification
Microinjection systemEppendorf, Germany5193000020Used for microinjection of CRISPR/Cas9 reagents into zygotes
Vevo 2100 Imaging SystemVisualSonics, CanadaVevo2100High-frequency imaging system for non-invasive assessment of cardiac function and structure post-MI
Light MicroscopeLeica, GermanyDM2500Used for observing HE and Masson-stained heart sections
Analysis software
ImageJNational Institutes of Health, USA/Used for image analysis, including area measurement, signal quantification, and processing of histological images (HE and Masson staining)
VevoLab 3.2.0 / VevoStrainVisualSonics, Canada/VevoLab software for cardiac function analysis; VevoStrain module used for myocardial strain analysis to assess cardiac performance post-MI
GraphPad Prism 8GraphPad Software, USA/Used for statistical analysis and graph preparation

References

  1. Fauconnier J, Meli AC, Thireau J, Roberge S, Shan J, Sassi Y, et al. Ryanodine receptor leak mediated by caspase-8 activation leads to left ventricular injury after myocardial ischemia-reperfusion. Proc. Natl. Acad. Sci. U. S. A. 2011;108(32):13258-63.
  2. Cohn JN, Ferrari R, Sharpe N. Cardiac remodeling-concepts and clinical implications: a consensus paper from an international forum on cardiac remodeling. J Am Coll Cardiol. 2000.
  3. Liu D, Tian X, Liu Y, Song H, Cheng X, Zhang X, et al. CREG ameliorates the phenotypic switching of cardiac fibroblasts after myocardial infarction via modulation of CDC42. Cell Death Dis. 2021;12(4).
  4. Contessotto P, Pandit A. Therapies to prevent post-infarction remodelling: from repair to regeneration. Biomaterials. 2021;275.
  5. Zhu R, Sun H, Yu K, Zhong Y, Shi H, Wei Y, et al. Interleukin-37 and dendritic cells treated with interleukin-37 plus troponin I ameliorate cardiac remodeling after myocardial infarction. J Am Heart Assoc. 2016;5(12).
  6. Chang Y, Zhang J, Huo X, Qu X, Xia C, Huang K, et al. Substrate rigidity dictates colorectal tumorigenic cell stemness and metastasis via CRAD-dependent mechanotransduction. Cell Rep. 2022;38(7).
  7. Seo Y, Jang J, Ko KP, Zou G, Huang Y, Zhang S, et al. Actin dysregulation induces immune evasion via oxidative stress-activated PD-L1 in gastric cancer. bioRxiv. 2024.
  8. Kim B, Zhang S, Huang Y, Ko KP, Jung YS, Jang J, et al. CRACD loss induces neuroendocrine cell plasticity of lung adenocarcinoma. Cell Rep. 2024;43(6).
  9. Jung YS, Wang W, Jun S, Zhang J, Srivastava M, Kim MJ, et al. Deregulation of CRAD-controlled cytoskeleton initiates mucinous colorectal cancer via β-catenin. Nat Cell Biol. 2018;20(11):1303-14.
  10. Liu Z, Cao H, Shi Y, Yang R. KIAA1211 plays an oncogenic role in human non-small cell lung cancer. J Cancer. 2019;10(26):6747-53.
  11. Snider PL, Snider E, Simmons O, Lilly B, Conway SJ. Analysis of uncharacterized mKiaa1211 expression during mouse development and cardiovascular morphogenesis. J Cardiovasc Dev Dis. 2019;6(2).
  12. Lin YH, Warren CM, Li J, McKinsey TA, Russell B. Myofibril growth during cardiac hypertrophy is regulated through dual phosphorylation and acetylation of the actin capping protein CapZ. Cell Signal. 2016;28(8):1015-24.
  13. Yang FH, Pyle WG. Reduced cardiac CapZ protein protects hearts against acute ischemia-reperfusion injury and enhances preconditioning. J Mol Cell Cardiol. 2012;52(3):761-72.
  14. Tong C, Huang G, Ashton C, Wu H, Yan H, Ying QL. Rapid and cost-effective gene targeting in rat embryonic stem cells by TALENs. J Genet Genomics. 2012;39(6):275-80.
  15. Cordes SP. N-ethyl-N-nitrosourea mutagenesis: boarding the mouse mutant express. Microbiol Mol Biol Rev. 2005;69(3):426-39.
  16. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, et al. Multiplex genome engineering using CRISPR/Cas systems. Science. 2013;339(6121):819-23.
  17. Kanke KL, Rayner RE, Bozik J, Abel E, Venugopalan A, Suu M, et al. Single-stranded DNA with internal base modifications mediates highly efficient knock-in in primary cells using CRISPR-Cas9. Nucleic Acids Res. 2024;52(22):13561-76.
  18. Mihos CG, Liu JE, Anderson KM, Pernetz MA, O'Driscoll JM, Aurigemma GP, et al. Speckle-tracking strain echocardiography for the assessment of left ventricular structure and function: a scientific statement from the American Heart Association. Circulation. 2025;152(10).
  19. Garg PK, Biggs ML, Kizer JR, Shah SJ, Psaty B, Carnethon M, et al. Glucose dysregulation and subclinical cardiac dysfunction in older adults: the Cardiovascular Health Study. Cardiovasc Diabetol. 2022;21(1).
  20. Asanuma T, Fukuta Y, Masuda K, Hioki A, Iwasaki M, Nakatani S. Assessment of myocardial ischemic memory using speckle tracking echocardiography. JACC Cardiovasc Imaging. 2012;5(1):1-11.
  21. Chong SY, Zharkova O, Yatim SMJM, Wang X, Lim XC, Huang C, et al. Tissue factor cytoplasmic domain exacerbates post-infarct left ventricular remodeling via orchestrating cardiac inflammation and angiogenesis. Theranostics. 2021;11(19):9243-61.
  22. Hung CL, Verma A, Uno H, Shin SH, Bourgoun M, Hassanein AH, et al. Longitudinal and circumferential strain rate, left ventricular remodeling, and prognosis after myocardial infarction. J Am Coll Cardiol. 2010;56(22):1812-22.
  23. Labuhn M, Adams FF, Ng M, Knoess S, Schambach A, Charpentier EM, et al. Refined sgRNA efficacy prediction improves large- and small-scale CRISPR-Cas9 applications. Nucleic Acids Res. 2018;46(3):1375-85.
  24. Wu J, Bu L, Gong H, Jiang G, Li L, Ma H, et al. Effects of heart rate and anesthetic timing on high-resolution echocardiographic assessment under isoflurane anesthesia in mice. J Ultrasound Med. 2010;29(12).
  25. Voigt JU, Pedrizzetti G, Lysyansky P, Marwick TH, Houle H, Baumann R, et al. Definitions for a common standard for 2D speckle tracking echocardiography: consensus document of the EACVI/ASE/Industry Task Force to standardize deformation imaging. J Am Soc Echocardiogr. 2015;28(2):183-93.
  26. Port F, Chen HM, Lee T, Bullock SL. Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proc Natl Acad Sci U S A. 2014;111(29).
  27. Gao E, Lei YH, Shang X, Huang ZM, Zuo L, Boucher M, et al. A novel and efficient model of coronary artery ligation and myocardial infarction in the mouse. Circ Res. 2010;107(12):1445-53.
  28. Rösner A, Barbosa D, Aarsæther E, Kjønås D, Schirmer H, D'Hooge J. The influence of frame rate on two-dimensional speckle-tracking strain measurements: a study on silico-simulated models and images recorded in patients. Eur Heart J Cardiovasc Imaging. 2015;16(10):1137-47.
  29. Argiro A, Bui Q, Hong KN, Ammirati E, Olivotto I, Adler E. Applications of gene therapy in cardiomyopathies. JACC Heart Fail. 2024;12(2):248-60.
  30. Micheletti R, Plaisance I, Abraham BJ, Sarre A, Ting CC, Alexanian M, et al. The long noncoding RNA Wisper controls cardiac fibrosis and remodeling. Sci Transl Med. 2017;9(395).
  31. Wu Z, Yang H, Colosi P. Effect of genome size on AAV vector packaging. Mol Ther. 2010;18(1):80-6.
  32. Juliano RL. The delivery of therapeutic oligonucleotides. Nucleic Acids Res. 2016;44(14):6518-48.

Reprints and Permissions

Tags

Cracd-Deficient MiceCRISPR Mouse ModelCardiac RemodelingPCR GenotypingSanger SequencingTransthoracic EchocardiographySpeckle-Tracking ImagingHistopathological EvaluationVentricular Dilation

This article has been published

Video Coming Soon