Generation of GABAergic Neurons from Human Induced Pluripotent Stem Cells Using Doxycycline-Inducible ASCL1/DLX2 Expression at AAVS1

Summary

This protocol describes a method for generating GABAergic neurons from human induced pluripotent stem cells by integrating doxycycline-inducible transgenes into the AAVS1. safe harbor locus. The stable, homogeneous transgene expression provides an efficient approach for direct differentiation into GABAergic neurons while limiting transgene silencing, a common issue with lentiviral approaches.

Abstract

Human induced pluripotent stem cells (hiPSCs) offer an unprecedented opportunity to model human neurological diseases in vitro. Reliable generation of defined neuronal populations, such as gamma-aminobutyric acid (GABAergic) neurons, is essential for these studies. This protocol details a robust method for differentiating hiPSCs into GABAergic neurons using a doxycycline-inducible system. The approach relies on the stable integration of transgenes encoding the transcription factors ASCL1 and DLX2 into the safe-harbor adeno-associated virus integration site 1 (AAVS1.) locus via CRISPR/Cas9-mediated knock-in. This targeted integration avoids the transgene silencing often observed with random lentiviral integration. The protocol covers the maintenance of hiPSCs, the nucleofection process for transgene integration, puromycin selection to enrich successfully engineered cells, and the step-by-step differentiation procedure. Upon induction with doxycycline, the engineered hiPSCs rapidly exit the cell cycle, acquire neuronal morphology, and express GABAergic lineage markers within 21 days. Key steps include neuro-induction and subsequent maturation using specific growth factors, as well as potential approaches to improve cellular adhesion during maturation. This standardized method yields enriched populations of induced neurons expressing GABAergic lineage markers, providing a valuable tool for neuroscience research and cellular modeling.

Introduction

Human induced pluripotent stem cells (hiPSCs) provide a unique platform to model human neurological diseases in vitro. and to investigate the complex molecular mechanisms that drive development and degeneration¹. This technology enables the generation of patient-specific cellular models to investigate a wide array of conditions, ranging from early neurodevelopmental anomalies in syndromic ciliopathies² to subtle epigenomic alterations observed in sporadic Alzheimer's disease³. Consequently, directed differentiation of hiPSCs has become a cornerstone of modern molecular neuroscience.

Protocol

CAUTION: Human hiPSC cultures should be handled as potentially biohazardous material under institutional biosafety procedures. Perform all human hiPSC culture procedures in a certified Class II biological safety cabinet using sterile technique. All waste containing human cells, media exposed to human cells, and CRISPR/Cas9 plasmid material should be decontaminated in accordance with local biosafety guidelines before disposal. Doxycycline, puromycin, DMSO, and other chemical reagents should be handled with gloves and appropriate eye and skin protection, and waste should be discarded according to institutional chemical-waste procedures. Basement membrane extract (BME) s....

Results

Successful application of this protocol results in an enriched population of induced neurons with GABAergic molecular features. The strategy is based on targeted insertion of a doxycycline-inducible ASCL1-P2A-DLX2 cassette into the AAVS1 locus (Figure 1A). Following selection of engineered hiPSCs, doxycycline induction is used to drive GABAergic neuronal differentiation, as outlined in the timeline shown in Figure 1B. Following nucleof.......

Discussion

The successful generation of GABAergic neurons relies heavily on several critical steps within this protocol. Maintaining high-quality, undifferentiated hiPSCs is paramount; spontaneous differentiation prior to nucleofection drastically reduces integration efficiency and downstream neuronal purity⁸. Furthermore, precise determination of the puromycin kill curve is essential to ensure complete elimination of non-integrated cells without undue stress on properly engineered clones. During the differe.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
4D-Nucleofector™ Core Unit	Lonza	AAF-1002B	For electroporation/nucleofection of hiPSCs.
6-well culture plates	Sarstedt	83.3920300	Tissue culture-treated plates for hiPSC maintenance and differentiation.
BDNF (Brain-Derived Neurotrophic Factor)	STEMCELL Technologies	78005	Recombinant human protein for neuronal maturation; prepare according to manufacturer instructions and use at 10 ng/mL final concentration.
Cell counter (Countess)	Thermo Fisher Scientific	C10283	Used for cell counting.
Centrifuge	VWR	76468-134	For cell pelleting.
CO2 incubator	Thermo Fisher Scientific	Heracell VIOS 160i or equivalent	Cell culture incubator maintaining 37 °C, humidified atmosphere, and 5% CO2.
Cryotubes	Thermo Fisher Scientific	5000-0020	Sterile cryogenic vials for freezing hiPSCs; equivalent externally threaded 1.8–2.0 mL cryovials may be used.
Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract	Bio-Techne	BME001-05	Standard BME coating matrix used in the protocol. Verify the lot-specific stock concentration from the Bio-Techne certificate of analysis and dilute in DMEM/F-12 to 80 µg/mL working concentration.
DMEM/F-12	Wisent	319-090-CL	Basal medium used for diluting BME.
DMSO (Dimethyl sulfoxide)	Sigma-Aldrich	D2650	Cryoprotectant used in the preparation of freezing medium.
Donor plasmid: inducible ASCL1-P2A-DLX2 AAVS1 targeting cassette	Custom plasmid	Addgene accession pending	Custom AAVS1 donor plasmid containing doxycycline-inducible ASCL1-P2A-DLX2 cassette and selection/reporter elements. Provide plasmid map and full sequence as supplementary file or upon request.
Doxycycline hyclate	Sigma-Aldrich	D9891	Used to induce ASCL1-P2A-DLX2 expression. Prepare sterile stock solution, aliquot, protect from light, store frozen, and use at 1 µg/mL final concentration.
Ethanol (70%)	Commercial Alcohols / Greenfield Global	P016EAAN	For sterilization inside the biological safety cabinet; use institutional approved 70% ethanol or equivalent.
Fluorescence microscope	ECHO	Revolve R4	Microscope used for phase-contrast and fluorescence imaging of reporter expression and neuronal morphology.
GDNF (Glial-Derived Neurotrophic Factor)	STEMCELL Technologies	78058	Recombinant human protein for neuronal maturation; prepare according to manufacturer instructions and use at 10 ng/mL final concentration.
hiPSC line PGP1	EditCo Bio	PGP1 human iPSC line	Commercially available open-consent human iPSC line used in this protocol; record passage number and QC status before editing and differentiation.
Image-analysis software	ImageJ/Fiji	Open-source; version used should be reported	For fluorescence quantification and representative image processing.
KnockOut™ Serum Replacement (KOSR)	Thermo Fisher Scientific	10828028	Used in the preparation of freezing medium.
Laminin-521	STEMCELL Technologies	200-0117	Optional troubleshooting reagent only. Not part of the standard coating protocol; may be used as an alternative or double-coating matrix if neuronal detachment persists.
Liquid nitrogen dewar	Thermo Fisher Scientific	Locator 6 Plus or equivalent	Long-term storage of frozen hiPSCs in vapor-phase or liquid nitrogen according to institutional cryogenic safety procedures.
Mr. Frosty™ Freezing Container	Thermo Fisher Scientific	5100-0001	For controlled-rate freezing of cells at -80 °C.
mTeSR™ Plus	STEMCELL Technologies	100-0276	Feeder-free maintenance medium for hiPSCs.
Neuro-induction medium	STEMCELL Technologies	08582	Commercial neuro-induction medium used for early neuronal induction.
Neuro-maturation base medium (BrainPhys™ Neuronal Medium)	STEMCELL Technologies	05790	Base medium for neuronal maturation; supplement with BDNF, GDNF, NT-3, doxycycline, and PluriSln-1 as described in the protocol.
NT-3 (Neurotrophic Factor 3)	STEMCELL Technologies	78074	Recombinant human protein for neuronal maturation; prepare according to manufacturer instructions and use at 10 ng/mL final concentration.
P3 Primary Cell 4D-Nucleofector™ X Kit	Lonza	V4XP-3024	Kit containing Solution P3 and cuvettes for hiPSC nucleofection.
Penicillin-Streptomycin (10,000 U/mL)	Thermo Fisher Scientific	15140122	Optional antibiotic to reduce bacterial contamination risk.
Plasmocin™ prophylactic	InvivoGen	ant-mpp	Optional antibiotic to prevent mycoplasma contamination.
PluriSIn-1	STEMCELL Technologies	72822	Pluripotent cell survival inhibitor to eliminate undifferentiated hiPSCs; prepare stock according to manufacturer instructions and use at 20 µM final concentration.
Puromycin Dihydrochloride	Thermo Fisher Scientific	A1113803	Antibiotic used for selection; prepare sterile stock solution, aliquot, store frozen, and determine final working concentration by kill curve, typically 0.4–0.6 µg/mL.
pX330-U6-Chimeric_BB-CBh-hSpCas9 AAVS1 gRNA plasmid	Addgene	85802	CRISPR/Cas9 plasmid used for AAVS1 targeting; include the AAVS1 gRNA sequence in the plasmid map or supplementary information.
qPCR analysis software	Applied Biosystems / Thermo Fisher Scientific	QuantStudio Design & Analysis Software or equivalent	For Ct extraction and RT-qPCR analysis; report software version used.
qPCR master mix	Thermo Fisher Scientific	PowerUp SYBR Green Master Mix, A25742	For RT-qPCR quantification of neuronal and GABAergic markers.
qPCR primers: DLX1	Custom oligonucleotides	Sequence provided in comments	Forward: 5' ATGCACTGTTTACACTCGGC 3'; Reverse: 5' GACTGCACCGAACTGATGTAG 3'. Used to assess GABAergic lineage induction at Day 21.
qPCR primers: GAD2	Custom oligonucleotides	Sequence provided in comments	Forward: 5' TGGCGTTTCTGCAAGATGTTA 3'; Reverse:5' TTGGTCTGCCAATTCCCAATTAT 3'. GABAergic neuron marker.
qPCR primers: GAD67	Custom oligonucleotides	Sequence provided in comments	Forward: 5' GCTTCCGGCTAAGAACGGT 3'; Reverse: 5' TTGCGGACATAGTTGAGGAGT 3'. GABAergic neuron marker.
qPCR primers: RPLP0	Custom oligonucleotides	Sequence to be provided	Reference gene primers for ΔΔCt normalization. Primer sequences should be listed in the table or supplementary information. Forward: 5' AGCCCAGAACACTGGTCTC 3'; Reverse: 5' ACTCAGGATTTCAATGGTGCC 3'.
qPCR primers: SLC17A6	Custom oligonucleotides	Sequence provided in comments	Forward: 5' GGGAGACAATCGAGCTGACG 3'; Reverse: 5'TGCAGCGGATACCGAAGGA3'. Glutamatergic neuron marker.
qPCR primers: SLC17A7	Custom oligonucleotides	Sequence provided in comments	Forward: 5' CAGAGTTTTCGGCTTTGCTATTG 3'; Reverse: 5' GCGACTCCGTTCTAAGGGTG 3'. Glutamatergic neuron marker.
ReLeSR™	STEMCELL Technologies	100-0484	Enzyme-free reagent for dissociation and passaging of hiPSCs.
Reverse-transcription kit	Thermo Fisher Scientific	SuperScript IV VILO Master Mix, 11756050	For cDNA synthesis prior to RT-qPCR.
RNA extraction kit	QIAGEN	RNeasy Kit (74104)	Kit used for total RNA extraction before RT-qPCR. Record the exact RNeasy kit format and catalog number used in the final Materials table.
Statistical software	GraphPad Software	GraphPad Prism, version 11	For graphing and statistical analysis of RT-qPCR data.
Trypan Blue Solution (0.4%)	Thermo Fisher Scientific	15250061	Vital stain used to assess cell viability during counting.
Y-27632 (ROCK Inhibitor)	STEMCELL Technologies	72302	Used at 10 µM final concentration to improve survival during passaging and nucleofection.