The goal of this protocol is to facilitate functional analysis of parasitoid-host interactions in Asobara japonica and Drosophila melanogaster through optimized rearing methods, a single-oviposition infection assay, and RNAi-mediated gene knockdown.
Method Article
The goal of this protocol is to facilitate functional analysis of parasitoid-host interactions in Asobara japonica and Drosophila melanogaster through optimized rearing methods, a single-oviposition infection assay, and RNAi-mediated gene knockdown.
Parasitism is a biological interaction in which one organism exploits the body or resources of another (the host), resulting in substantial damage or death to the host. Among parasitic animals, parasitoid wasps are one of the most species-rich lineages, accounting for nearly 20% of all insect species. In particular, endoparasitoid wasps oviposit directly into host bodies and deploy a diverse array of venom factors to manipulate host development, immunity, and physiology. In response to wasp attack, hosts attempt to eliminate parasitoid eggs through innate immune mechanisms. However, the molecular and cellular mechanisms by which individual venom components modulate host biology and promote successful parasitism remain poorly understood. Here, we describe a standardized laboratory protocol for rearing the endoparasitoid wasp Asobara japonica and its host Drosophila melanogaster. Both parthenogenetic and sexual strains of A. japonica are available, and the parthenogenetic strain exhibits a high parasitism success rate, allowing stable maintenance of laboratory stocks for genome analysis and parasitism assays. A single-oviposition infection assay and a double-stranded RNA-based gene knockdown method were optimized for functional analysis of venom genes. Together, these protocols provide a practical experimental framework for dissecting the molecular mechanisms underlying parasitoid-host interactions and will facilitate future research in developmental biology, immunology, and physiology.
Parasitism is a lifestyle in which one organism exploits the nutritional resources of another and is widespread across taxa. It is estimated that up to half of all known organisms exhibit parasitism in their life cycle1. Among parasites, parasitoid wasps are a particularly diverse group, accounting for approximately 20% of all insects2. They exploit a wide range of arthropod hosts, such as insects, spiders, and mites, and exhibit remarkable diversity in their life histories and parasitic strategies3. These features make parasitoid wasps one of the most evolutionarily and ecologically successful insect groups.
Interactions between parasitoids and their hosts have been extensively studied as model systems of evolutionary “arms races.” In particular, endoparasitoid wasps deploy a diverse array of factors, including venoms, symbiotic viruses, and teratocytes4,5. These factors manipulate host physiology and development, thereby ensuring successful development within the host. Despite these advances, the molecular mechanisms underlying parasitism remain poorly understood across most parasitoid species. One major limitation is their small body size, which has hindered the biochemical identification of venom components. In addition, it is technically challenging to maintain parasitoids and their hosts with synchronized developmental stages under laboratory conditions.
Recent advances in next-generation sequencing and other omics technologies now enable genome-wide analyses even in very small parasitoid species. These approaches have opened new avenues for investigating previously inaccessible molecular mechanisms, allowing parasitoid-host interactions to be studied at unprecedented resolution. In this context, our laboratory focuses on Asobara japonica Belokobylskij (Hymenoptera: Braconidae), a species originally identified in Japan6,7,8. A. japonica includes a thelytokous parthenogenetic strain, in which females produce offspring without mating. This feature allows us to collect substantial amounts of genetically uniform genomic DNA for whole-genome sequencing9. In addition, this species parasitizes a broad range of Drosophila species, including the model organism D. melanogaster, which offers major experimental advantages due to its well-established rearing conditions and precisely defined developmental stages, enabling reproducible infection assays and accurate control of parasitoid development10.
During parasitism of A. japonica, a female wasp injects venom together with a single egg into a fly larva, inside which a wasp larva grows alongside its host. Notably, A. japonica exhibits a high parasitism success rate on the host D. melanogaster, making this parasitoid-host pair a powerful experimental model. Here, we describe protocols for stable rearing, a single-oviposition infection assay, and a double-stranded RNA (dsRNA)-based gene knockdown method in A. japonica. These protocols provide a reliable framework for dissecting molecular mechanisms underlying parasitoid-host interactions.
A schematic overview of the synchronized rearing method for D. melanogaster and A. japonica is presented in Figure 1.
1. Rearing the host fruit fly Drosophila melanogaster in the laboratory
2. Rearing the endoparasitoid wasp Asobara japonica in the laboratory
3. Single-Oviposition Infection Assay
4. Generation of RNA interference (RNAi) wasps by dsRNA injection
The asexual and sexual strains of Asobara japonica
A. japonica is widely distributed throughout Japan. Thelytokous parthenogenetic strains are predominant in the main islands, while arrhenotokous sexual strains are found in the subtropical islands, including Amami-Oshima and Iriomote-jima islands8,12. In sexual strains, males emerge earlier than females by a few days so that the timing of adult transfer is distinct between these strains. Thelytokous parthenogenesis in A. japonica is induced by infection with Wolbachia, a maternally transmitted endosymbiotic bacterium13. Elimination of Wolbachia by antibiotic treatment results in the production of males9,14, and transplantation of Wolbachia into sexual strains induces parthenogenesis15. Both asexual and sexual strains of A. japonica exhibit high parasitism success across multiple Drosophila species. For example, they can parasitize D. suzukii, an economically important fruit pest, and are considered potential biological control agents in agriculture16. Among the available strains, we primarily used the Wolbachia-infected TK strain for our experiments. The TK strain exhibits higher parasitism activity toward host larvae compared to the IR strain14, making it suitable for analyses.
Parasitism success depends on rearing conditions
Parasitism success rate of A. japonica is generally high, but it is strongly affected by the rearing condition of host flies. Under nutrient-poor conditions, the growth period of fly larvae is prolonged and the timing of pupariation is delayed17. Under these conditions, wasps may fail to properly utilize host resources and to synchronize their development with that of hosts. To examine this possibility, we reared flies and wasps under normal-yeast (1×) and yeast-poor (0.1×) conditions. We then evaluated parasitism success and developmental timing (Figures 2C, 2D). Parasitism success was calculated as the ratio of emerged adult wasps to host larvae.
Under normal-yeast conditions, the parasitism success rate was 81.7% in the single-oviposition infection assay (Figure 2C, left; Table 2). When the yeast content was reduced to 10% (yeast-poor condition), the parasitism success rate decreased to 35.0% (Figure 2C, right; Table 2). This reduction may be explained by the fact that approximately 50% of host larvae died following infection. These results suggest that resource allocation between host and parasitoid is disrupted under nutrient-poor conditions.
Notably, the timing of wasp eclosion was not delayed to the same extent under yeast-poor conditions as it was under normal-yeast conditions. While fly eclosion timing was delayed by up to 9 days, wasp eclosion timing was delayed by only up to 4-5 days. This result suggests that nutrient availability primarily affects host development. The timing of eclosion is consistent both in flies and wasps under normal-yeast conditions, but not yeast-poor conditions, suggesting that synchronized development between parasitoids and hosts depends on the nutrient availability.
RNAi-based approach for functional analysis of venom genes
Although transcriptomic and proteomic analyses of the venom gland identify numerous candidate molecules, it remains unclear which of these are required for successful parasitism. To determine the physiological roles of these candidate molecules, in vivo functional analyses using gene knockdown approaches are required.
We recently reported that A. japonica parasitism induces apoptosis, autophagy, and mitotic arrest in the imaginal discs of D. melanogaster larvae, resulting in severe tissue degradation, a phenomenon termed imaginal disc degradation (IDD)10. To identify the molecules responsible for IDD, we performed RNAi screen of candidate genes identified from transcriptomic, proteomic, and comparative genomic analyses. As a result, two genes, imaginal disc degradation factor (IDDF)-1 and IDDF-2 were identified. Both IDDF-1 and IDDF-2 contain the Domain of Unknown Function 4803 (DUF4803). Notably, following our initial report, an independent study identified multiple A. japonica venom proteins (termed Venom-Induced Degradation, VID) associated with IDD, all of which also possess the DUF4803 domain18.
Based on these results, we further optimized the RNAi protocol to improve reproducibility and efficiency. In particular, the use of Nanoject III enabled precise control of injection volume and speed, resulting in more consistent knockdown outcomes.
To evaluate the efficiency of the optimized RNAi protocol, we performed knockdown of IDDF-1. In eclosed adult wasps, the expression level of IDDF-1 was significantly decreased compared with the control (Figure 3D). For functional validation, we performed single-oviposition infection assays using these RNAi wasps and host fly larvae expressing the apoptosis reporter GC3Ai in the wing pouch region19. A GC3Ai signal was detected in the wing pouch following infection with control (GFP RNAi) wasps. In contrast, the GC3Ai signal was significantly reduced following infection with IDDF-1 RNAi wasps (Figure 3E, 3F). These results are consistent with previous findings, confirming that IDDF-1 function is effectively suppressed by RNAi.

Figure 1. Schematic overview of the rearing procedures for D. melanogaster and A. japonica.
Step-wise procedures are shown according to the developmental stages of D. melanogaster. Please click here to view a larger version of this figure.

Figure 2. Parasitism by Asobara japonica. (A) Schematic of the developmental relationship between D. melanogaster and its parasitoid A. japonica. A female wasp deposits venoms and a single egg into a fly larva. After hatching, the wasp larva develops in parallel with the host larva, which subsequently pupariates. Following pupariation, the wasp consumes the whole fly body and eventually ecloses from the fly pupal case. (B) Adult wasps of the asexual strain (left) and sexual strain (right) of A. japonica. Scale bar, 1 mm. (C) Emergence rate of flies or wasps under normal (1×) and yeast-poor (0.1×) conditions. Single-oviposition infection assays were performed using host fly larvae at 4 days after egg laying (dAEL). n = 267 (1×, flies), 120 (0.1×, flies), 85 (1×, wasps), and 80 (0.1×, wasps), respectively. (D) Eclosion timing of flies and wasps under the two nutritional conditions shown in (C). The ratio of adults to pupae are indicated. n = 250, 107, 61, and 41, respectively. The black arrow indicates the timing of wasp infection. Please click here to view a larger version of this figure.

Figure 3. Optimized RNAi procedure using Nanoject III. (A) Setup of the microinjection apparatus under a stereomicroscope. The glass capillary needle was positioned at an angle of 30-45° relative to the agar plate. (B) The tip of the glass capillary needle was sharpened using a needle grinder. (C) A blue-dyed solution was microinjected into a wasp body using a glass capillary needle. The anterior side of the wasp is indicated by A in the image. P, posterior. Scale bar, 1 mm. (D) Expression levels of IDDF-1 in GFP RNAi and IDDF-1 RNAi wasps were quantified using the delta-delta Ct method. Expression levels were normalized to RpL32-Aj. Data represent the mean ± SD with individual data points (n = 5). ***P < 0.005 (Student’s t-test). (E and F) GC3Ai signals in wing discs of uninfected larvae and host larvae at 6 h post-infection (hpi) following infection with control (GFP RNAi) or IDDF-1 RNAi wasps. Wing discs are outlined with white dotted lines based on DAPI staining of nuclei (1:10000, 62247; Thermo Fisher Scientific). The ratio of GC3Ai-positive area to wing pouch area was quantified. ***P < 0.005 (One-way ANOVA followed by Tukey’s multiple comparisons test). n = 11 biological replicates per group. Scale bar, 100 µm. Please click here to view a larger version of this figure.
| Components | Amount |
| Water | 1 L |
| Agar | 5.5 g |
| Yeast | 40 g |
| Corn meal | 90 g |
| Glucose | 100 g |
| Propionic acid | 3 mL |
| 10% butyl p-Hydroxybenzoate in 70% EtOH | 3.5 mL |
Table 1: Components of standard cornmeal-yeast-agar medium (Fly food).
| Food type | Condition | # of total individuals | # of eclosed or dead individuals | Emergence rate of flies or wasps (%) | |||
| Fly | Wasp | Pupal lethal | Larval lethal | ||||
| 1× | Uninfected | 267 | 248 | 0 | 2 | 17 | 92.88389513 |
| A. japonica infected | 120 | 0 | 98 | 9 | 13 | 81.66666667 | |
| 0.1× | Uninfected | 85 | 38 | 0 | 23 | 24 | 44.70588235 |
| A. japonica infected | 80 | 0 | 28 | 13 | 39 | 35 | |
Table 2: Number of individuals and emergence rates under normal (1x) and yeast-poor (0.1x) conditions.
| Primer name | Sequence (5'>3') | Purpose |
| AjRpL32_qPCR_Fwd | CCCGTCACATGCTTCCTACT | qRT-PCR |
| AjRpL32_qPCR_Rev | GAATTTGCGATTCTGCATCA | qRT-PCR |
| qPCR_gene007424_Fwd | TGGGCAATGATTGTGTGAGT | qRT-PCR |
| qPCR_gene007424_Rev | GCGTCCCTGTATCGAAGGTA | qRT-PCR |
| Aj_gene007424_ex1_Fwd | ATGAGCATCAAGCAAGCAGTGCTAG | CDS cloning |
| Aj_gene007424_ex10_Rev | TCAGCACCTTCTACCCGGCAAATT | CDS cloning, dsRNA template |
| Aj_gene007424_RNAi_Fwd | GAGGAGAGTGGAAGCCAGTTGTAG | dsRNA template |
| T7_Aj_gene007424_ex10_Rev | GGATCCTAATACGACTCACTATAGGT CAGCACCTTCTACCCGGCAAATT | dsRNA template |
| T7_Aj_gene007424_ RNAi_Fwd | GGATCCTAATACGACTCACTATAGGGAG GAGAGTGGAAGCCAGTTGTAG | dsRNA template |
| ※ These primers and dsRNA templates are reported in Kamiyama et al. 2022. | ||
| ※ gene007424 stands for IDDF-1. | ||
Table 3: Sequences of primers and dsRNA templates used in this study.
In this study, we established a versatile experimental platform for investigating parasitoid-host interactions at the molecular level. By optimizing rearing conditions, a single-oviposition infection assay, and the RNAi protocol, we provide a robust system for functional studies of parasitoid-derived factors. This platform will facilitate future studies aimed at uncovering the mechanisms by which parasitoid wasps manipulate host development and may also contribute to the development of biological pest control strategies.
The Wolbachia-infected TK strain of A. japonica provides a highly reproducible experimental system for analyzing parasitism. In many parasitoid-host studies, experimental outcomes are often variable, with host survival and parasitoid success depending sensitively on environmental and physiological conditions. In contrast, the TK strain exhibits consistently high parasitism success, effectively creating a “parasitoid-dominant” condition in which the outcome of infection is largely uniform. Moreover, as a parthenogenetic strain, it reduces experimental variation among individuals due to its uniform genetic background. This reproducibility enables reliable tracking of the parasitism process and facilitates quantitative analyses of host responses and parasitoid-derived factors.
In addition, thelytokous reproduction greatly facilitates genomic analyses by enabling the generation of highly homogeneous genomic DNA, which is critical for high-quality genome assembly9. While such parthenogenetic strains are not available in all parasitoid species, our results highlight the potential of Wolbachia-induced thelytoky as a strategy to improve genomic resources. Establishing Wolbachia-infected lines in other parasitoid species may therefore be a powerful approach to expand genomic resources and accelerate comparative molecular studies across parasitoids.
Parasitism outcomes are strongly influenced by host nutritional conditions, indicating that rearing conditions are a critical determinant of parasitoid success. Because successful parasitism depends on precise temporal coordination with host and wasp development, uncontrolled nutritional conditions are likely to disrupt this process and reduce reproducibility. Therefore, careful standardization of host rearing conditions is essential for establishing a reliable experimental system to study parasitoid-host interactions. Furthermore, the fly stock vials should be maintained separately from wasp stock vials, as the presence of wasps reduces fly oviposition behaviors20,21.
To enable quantitative evaluation of parasitoid-host interactions, we devised a single-oviposition infection assay in which a single egg is deposited into each host. This assay contrasts with conventional bulk infection assays, which often involve multiple oviposition events that lead to excessive host damage and mortality. To promote efficient oviposition within a limited time window (~15 min.), newly-eclosed wasp adults were preconditioned with a glucose and vitamin C solution, thereby improving oviposition efficiency and overall reproducibility.
Furthermore, we optimized the RNAi protocol for gene function analysis in parasitoid wasps. By using the microinjection system, we achieved precise control of injection volume and improved the consistency of knockdown efficiency. Functional validation using IDDF-1 confirmed that this method effectively suppresses gene expression and produces reproducible phenotypic outcomes. Given that transcriptomic and proteomic studies continue to identify large numbers of candidate venom factors, the availability of a functional screening platform will be essential for determining their biological roles.
A limitation of this RNAi protocol is that it is not suitable for analyzing genes that function during the early stages of wasp development, as it is technically challenging to inject dsRNA into wasp eggs that are present inside the host bodies. To overcome this, establishing an ex vivo rearing system may provide a useful approach22. Alternatively, gene knockout approaches using Direct Parental (DIPA)-CRISPR may provide a complementary strategy, whereby reagents are injected into adult females to generate genome-edited offspring23. Indeed, this approach has successfully generated gene knockout individuals in the pupal ectoparasitoid Nasonia vitripennis by injecting reagents into adult females or individuals at the late pupal stage24. Together with our RNAi-based gene knockdown method, these approaches will facilitate more comprehensive analyses of gene functions involved in the parasitism process.
We have no conflict of interest to be disclosed.
The authors would like to thank Kanata Tachibana, Shion Kudo, Toshiya Makino, Shunta Yorimoto, Shuji Shigenobu, Akiko Kawamura, Ari Fujinoki, and Masako Iida for technical assistance. We also thank all other members in our laboratory.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| 50 mL tube | Greiner Bio-One | 210261 | Infection assay |
| 1 mL syringe | TERUMO | SS-01T | dsRNA injection |
| Agar | Daisin, Ltd. | P-700 | Rearing |
| Asnol Petri Dish φ40×13.5mm | As One Corporation | 1-8549-01 | Infection assay |
| Asnol Petri Dish φ55×17mm | As One Corporation | 1-8549-02 | dsRNA injection |
| Blue dye (Erioglaucine disodium salt) | Sigma-Aldrich Co. Llc. | 861146-25G | dsRNA injection |
| Butyl p-Hydroxybenzoate | Nacalai Tesque, Inc. | 06327-15 | Rearing |
| CO2 pressure regulator | YAMATOSANGYO | YR-507F-2 | Infection assay |
| Confocal laser scanning microscope | Zeiss | LSM700 | Image analysis |
| Corn meal | Sunny Maize Co., Ltd. | No.4M | Rearing |
| DAPI | Thermo Fisher Scientific Inc. | PI62247 | Nuclei staining, 1:10000 |
| Deionized water | Millipore Inc. | ZLXEV030WW | Infection assay |
| Dual-Stage Glass Micropipette Puller | Narishige | PC-10 | dsRNA injection |
| Fiji | NA | https://fiji.sc | Image analysis |
| Filter paper | Advantec | ITEM 526 | Rearing |
| Fly food vial | Chiyoda Science Co., Ltd. | KFB-3M | Rearing |
| Fly food vial plug | Chiyoda Science Co., Ltd. | AS-275 | Rearing |
| Forceps | Dumont Biologie | 11252-20 | Dissection |
| Freezer, -20 °C | Nihon Freezer | GS-3120HC | Sample storage |
| Freezer, -80 °C | Nihon Freezer | CLN-52UD2 | Sample storage |
| Glass slides | Matsunami Glass Ind., Ltd | S7213 | Infection assay |
| Glucose | Showa Sangyo Co., Ltd. | Not availavle | Rearing |
| KOD Plus Neo | Toyobo | KOD-401 | dsRNA synthesis |
| Incubator | Panasonic | MIR-254-PJ | Rearing |
| Ligation high Ver.2 | Toyobo | LGK-201 | dsRNA synthesis |
| Micropipette Grinder | Narishige | EG-401 | dsRNA injection |
| Mineral oil | Nacalai Tesque, Inc. | 23306-84 | dsRNA injection |
| Nanoject III | Drummond Scientific Company | 3-000-207 | dsRNA injection |
| Nanoject Glass Capillaries | Drummond Scientific Company | 3-000-203-G/X | dsRNA injection |
| pBluescript KS (+) plasmid | Not availavle | Not availavle | dsRNA synthesis |
| pBluescript SK (-) plasmid | Not availavle | Not availavle | dsRNA synthesis |
| PrimeScript reverse Transcriptase | Takara | 2680A | dsRNA synthesis |
| Propionic acid | Nacalai Tesque, Inc. | 29018-55 | Rearing |
| PROWIPE | Daio Paper Corporation | 2-2624-02 | Infection assay, dsRNA injection. |
| ReverTra Ace qPCR RT Master Mix with gDNA Remover | Toyobo | FSQ-301 | qRT-PCR |
| RNAiso Plus reagent | Takara | 9108 | qRT-PCR |
| Small vial (Test tube 12 mL) | Sarstedt | REF 58.487 | Infection assay |
| Small vial plug | Chiyoda Science Co., ltd. | QD-S4 | Infection assay |
| Spatula | As One Corporation | 6-522-02 | Rearing |
| Square petri dish | Eiken Chemical Co., Ltd. | 64-2192-55, AW2000 | dsRNA injection |
| Stereomicroscope | Leica Microsystems | lvesta3 (C-Mount) | Infection assay |
| Stereomicroscope | Nikon Solutions Co., Ltd. | SMZ1000 | dsRNA injection |
| T7 RiboMAX Express RNAi System | Promega | P1700 | dsRNA synthesis |
| Thermal Cycler Dice Real Time System | Takara | TP815 | qRT-PCR |
| Thermal Cycler GeneAtlas | Astel | G02 | dsRNA synthesis, qRT-PCR |
| THUNDERBIRD SYBR qPCR Mix | Toyobo | QPS-201 | qRT-PCR |
| TissueLyser II | Qiagen | Not availavle | qRT-PCR |
| Vitamin C, L-Ascorbic Acid | Nacalai Tesque, Inc. | 03420-65 | Rearing |
| Welch's grape 100 juice | Asahi Soft drinks Co., Ltd. | 32390 | Infection assay |
| Yeast | Asahi Group Foods, Ltd. | HB-P02 | Rearing |
Request permission to reuse the text or figures of this JoVE article
Request Permission