Source: Laboratories of Dr. Ian Pepper and Dr. Charles Gerba - The University of Arizona
Demonstrating Author: Bradley Schmitz
Quantitative polymerase…
1. Sample Collection
2. Nucleic Acids Extraction
3. Reverse Transcription
4. Setting up qPCR
5. qPCR Operation
| Reagent | Sequence (5’ → 3’) | Volume (μL / well) | Final Conc. |
| Forward Primer | GAGTGGTTTGACCTTAACGTTTGA | 2.25 | 900 nM |
| Reverse Primer | TTGTCGGTTGCAATGCAAGT | 2.25 | 900 nM |
| Probe | FAM-CCTACCGAAGCAAATG-BHQ1 | 1.0 | 200 nM |
Table 1. Sample primer and probe sequences for detecting pepper mild mottle virus.
| Reagent | Volume (μL / well) | Number of Wells | Master Mix Volume (μL) |
| LC 480 Mix | 12.5 | 26 | 325 |
| Molecular H2O | 4.5 | 117 | |
| Forward Primer | 2.25 | 58.5 | |
| Reverse Primer | 2.25 | 58.5 | |
| Probe | 1.0 | 26 | |
| Total | 22.5 | 585 |
Table 2. Reagent volumes for individual reaction and master mix.
The advent of quantitative polymerase chain reaction, or qPCR, has made it possible to quantitatively determine the amount of any microorganism in an environmental sample.
Like standard PCR, qPCR identifies microorganisms by detecting for the presence or absence of DNA sequences specific to the organisms of interest. This allows for the detection of microbes that cannot be cultured in lab, making it possible to assay a much wider range of environmental organisms. In addition, qPCR allows the amount of DNA to be quantitatively assessed. But at the same time, PCR methodologies detect DNA from all organisms dead or alive, limiting the ability to only look for actively growing microbes in the sample.
This video will review the chemical innovations that distinguish qPCR from regular PCR, explain how qPCR can be used to quantitatively measure DNA, demonstrate a protocol for using qPCR to detect an RNA virus from soil samples, and finally, show how qPCR is being applied to environmental microbiology today.
The basic principles behind qPCR are the same as regular PCR - repeated cycles of primer annealing to template, elongation of PCR product, and denaturation of product from template, leading to the exponential amplification of a target sequence of interest, known as the amplicon, from a pool of starting material.
The innovation of qPCR is in the addition of fluorescent chemicals into the reaction, which allows the synthesis of PCR product at each cycle to be directly visualized in "real time" by specialized thermocyclers, making it possible to quantify the amount of template sequence in the original sample. The quantity is usually measured in terms of the threshold cycle, abbreviated Ct, also known as the quantification cycle or Cq, which is the PCR cycle at which the amount of fluorescent products exceeds the background level.
Quantification can be relative, where the Ct value of one sequence is compared to that of another standard or control sequence; the relative quantity is equal to two raised to the power of the difference in Ct. Alternatively, if a series of DNA of known quantity is run alongside the samples in the reaction, a standard curve comparing fluorescence value to DNA amount can be produced, and allows the sample DNA to be quantitated absolutely.
There are two broad types of fluorescent molecules used in qPCR. In one case, fluorescent dyes that bind specifically to double-stranded DNA is included in the reaction. The dye only fluoresces when bound to DNA, thus allowing the amount of double-stranded DNA product to be quantitated.
In the other method, a short stretch of DNA, known as a probe, is designed against a specific target sequence of interest. The probe is chemically attached to a fluorescent dye as well as a "quencher" molecule that suppresses the fluorescence signal from the dye when in close proximity. The polymerase enzyme, which synthesizes the DNA product, has a DNA-degrading activity that would cause the fluorescent molecule to be "released" from the probe, thus separating the dye from the quencher and allowing the fluorescence signal to be detected.
Now that you understand the principles behind qPCR, let's look at a protocol for using this technique to identifying an RNA virus that infects plants, the pepper mild mottle virus, from soil samples.
In this demonstration, sample will be collected from the rhizosphere, the zone of soil approximately 7 mm around plant roots that is influenced by the roots and their symbiotic microorganisms.
To collect rhizosphere soil, first carefully extract the plant of interest from the ground, and hit it to remove as much excess bulk soil as possible. Package the plant for further processing in the lab.
After bringing the samples back to the lab, use a sterile spatula to scrap the desired soil into a collection vessel. Then, collect the virus from the soil and extract the RNA.
Once RNA is collected from the sample, convert it into complementary or cDNA via reverse transcription. Please refer to the JoVE SciEd video on reverse transcription-PCR for details of this procedure.
When ready to perform the qPCR, thaw frozen reagents at room temperature inside a dedicated laminar flow hood, and place on ice once thawed. Reagent components containing the DNA polymerase enzyme should always be kept on ice.
Thaw the sample cDNA and a positive control DNA, such as a circular piece of DNA known as a plasmid that has the amplicon of interest cloned into it.
Before assembling the reactions in a 96-well qPCR plate, prepare a 96-cell table template on paper, and label each cell with the reaction that will be loaded into the plate. Include reactions for each sample and standard in triplicate, as well as for the positive control and negative control, such as a no-DNA reaction.
Calculate the reagent volumes needed for a reaction "master mix", which includes all of the reagents that are constant among the reactions. Prepare enough master mix for triplicate reactions for all samples plus controls, and an additional 10% to account for pipetting error.
Once the reagents are thawed, assemble the master mix in a 1.5-mL low-adsorption microfuge tube. To do this, briefly vortex each reagent to mix thoroughly, collect any liquid on the side of the tubes using a mini-centrifuge, and pipette the reagent into the microfuge tube. Be sure to use new pipette tips for each reaction component. After all reagents have been added, vortex to mix and centrifuge. Then, aliquot the appropriate amount of master mix into the designated wells on the PCR plate.
Next, vortex and centrifuge each tube with sample and control DNA, and pipette the appropriate amount into the respective wells on the PCR plate. Once samples have been added, seal the plate with a sealing foil, and use the sealing tool to fully flatten the seal and push out any air bubbles. Carefully tear off the non-adhesive tabs from the ends of the seal.
To fully collect the reaction mixture into the bottom of the wells, place the reaction plate into a centrifuge with a plate-holder and properly balance the rotor with a counterweight plate. Pulse-centrifuge the plate up to 1,000 rpm, then let the centrifuge slowly come to a stop without brakes.
Place the reaction plate into the qPCR machine. Set the PCR program according to the manufacturer's specification, setting the melting temperature according to the primer pair being used. Set the reaction program to run.
Once the qPCR program is completed, the software will be able to use the known concentrations of the positive control to calculate the quantity of cDNA in each reaction. The quantity of virus in the original sample can then be calculated.
Once the qPCR program is completed, the software will be able to use the known concentrations of the positive control to calculate the quantity of cDNA in each reaction.
With the results from the qPCR, the volume transferred into the wells, the extraction from soil, and the factor from the reverse transcription, the number of viruses in the initial soil sample can be calculated.
Now that you know how qPCR is performed, let's look at how it can be used to analyze different environmental samples.
qPCR can be used to quantify the amount of viruses recovered from many different types of samples. In this application, two different kinds of adenoviruses were concentrated from water samples by a number of different methods. DNA was then extracted from the viruses and subjected to qPCR, to evaluate the relative efficiency of the concentration methods.
Another application for qPCR-based microbial enumeration is to quantify bacterial content in food and agricultural samples - in this example, fecal and litter samples from chicken farms. Rather than targeting individual species, the scientists performed qPCR using primers against a highly conserved gene found in all bacteria and quantified the total bacterial community found in the samples.
Finally, as mentioned earlier, one disadvantage of traditional qPCR methodology is that live and dead microbes cannot be distinguished. However, by adding a chemical known as propidium monoazide, or PMA, which can only enter dead cells where it binds to DNA to inhibit subsequent enzymatic reactions such as PCR, researchers here were able to distinguish between live and dead cultures of E. coli O157:H7, a common pathogenic strain found in contaminated food and water.
You've just watched JoVE's introduction to quantifying environmental microorganisms and viruses using qPCR. You should now understand how qPCR works, how to use qPCR to measure the amount of a microbe in an environmental sample, and some applications of this technique. Thanks for watching!
View the full transcript and gain access to JoVE Science Education videos
Q1: How does qPCR differ from standard PCR in measuring microorganisms?
qPCR adds fluorescent chemicals to the reaction, allowing real-time visualization of PCR product synthesis at each cycle. This enables quantification of the target DNA sequence in the original sample by measuring the threshold cycle (Ct), the cycle where fluorescent products exceed background. Standard PCR only detects presence or absence of DNA, while qPCR provides quantitative measurement.
Q2: What is the threshold cycle and why is it important in qPCR analysis?
The threshold cycle (Ct), also called the quantification cycle (Cq), is the PCR cycle at which fluorescent product signal exceeds background noise. It is important because it directly correlates to the amount of target DNA in the original sample. Lower Ct values indicate more starting template, allowing researchers to quantify microorganism concentrations by comparing Ct values between samples and known standards.
Q3: What are the two main types of fluorescent molecules used in qPCR?
The first type uses fluorescent dyes that bind specifically to double-stranded DNA and only fluoresce when bound. The second uses a probe—a short DNA sequence designed against a specific target—chemically attached to both a fluorescent dye and a quencher molecule. When the polymerase degrades the probe during synthesis, the dye separates from the quencher, allowing fluorescence detection.
Q4: Why can qPCR detect microorganisms that culture-based methods cannot?
qPCR identifies microorganisms by detecting specific DNA sequences rather than requiring live cultures. Since only 1 to 10 percent of environmental microorganisms are culturable using classical techniques, qPCR enables detection of non-culturable species. However, qPCR detects DNA from both living and dead organisms, limiting its ability to distinguish actively growing microbes from inactive populations.
Q5: How is rhizosphere soil collected for qPCR virus detection?
Rhizosphere soil is the zone approximately 7 millimeters around plant roots influenced by roots and their symbiotic microorganisms. To collect it, carefully extract the plant from the ground and remove excess bulk soil by striking it. Package the plant for lab processing, then use a sterile spatula to scrape the desired soil into a collection vessel for virus extraction and RNA analysis.
Q6: What role does propidium monoazide play in distinguishing live from dead microorganisms?
Propidium monoazide (PMA) is a chemical that enters only dead cells, where it binds to DNA and inhibits subsequent enzymatic reactions like PCR. By adding PMA before qPCR, researchers can selectively prevent amplification from dead microorganisms, allowing differentiation between viable and non-viable populations. This overcomes a major limitation of standard qPCR methodology.
Q7: How can qPCR quantify total bacterial communities in environmental samples?
Rather than targeting individual bacterial species, scientists design qPCR primers against highly conserved genes found in all bacteria. This approach quantifies the total bacterial community present in samples such as food, agricultural, or fecal samples. By measuring the combined DNA from all bacteria, researchers obtain an overall assessment of bacterial content without identifying specific species.