Name: Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay (Video) | JoVE Journal
Uploaded: 2010-03-23T17:30:00.000+00:00
Duration: 17 min 3 s
Description: Learn a single-molecule DNA stretching assay for real-time observation of DNA replication using lambda DNA and widefield optical microscopy. This method enables precise measurement of replication rates and strand dynamics.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

The development of the DNA stretching assay was aided by Paul Blainey, Jong-Bong Lee, and Samir Hamdan. This work is supported by the National Institutes of Health grants to Charles Richardson (GM54397), and Antoine van Oijen (GM077248).

1. DNA Replication Template
DNA for the reaction is a linearized λ DNA modified by annealing of oligonucleotides to form a replication fork.  Additionally, biotin is attached to the end of one strand of the λ DNA, and a digoxigenin moiety is attached to the other end of the same strand1.
Materials: Bacteriophage λ DNA, Oligonucleotides: biotinylated fork arm (A: 5'-biotin-AAAAAAAAAAAAAAAAGAGTACTGTACGATCTAGCATCAATCACAGGGTCAGGTTCGTTATTGTCCAACTTGCTGTCC-3'), λ-complementary fork arm (B: 5'-GGGCGGCGACCTGGACAGCAAGTTG GACAATCTCGTTCTATCACTAATTCACTAATGCAGGGAGGATTTCAGATATGGCA-3'), fork primer (C: 5'-TGCCATATCTGAAATCCTCCCTGC-3'), λ-complementary digoxigenin end (D: 5'-AGGTCG CCGCCCAAAAAAAAAAAA-digoxigenin-3'), T4 DNA Ligase, T4 polynucleotide Kinase, Heat block.
<ol>
 <li>Phosphorylate the 5' ends of oligonucleotides B and D using T4 Polynucleotide Kinase.</li>
 <li>Anneal oligonucleotides A, B, and C to the λ DNA in one step by adding a 10-fold excess of oligonucleotides A and B, and a 100-fold excess of oligonucleotide C in T4 DNA ligase buffer.</li>
 <li>Heat the mixture to 65 °C in the heat block. Once heated, turn the heat block off and allow slow cooling to properly anneal oligonucleotides.</li>
 <li>Add T4 DNA ligase to the mixture and incubate at room temperature for 2 hours.  T4 DNA Ligase will catalyze the correct joining of oligonucleotides A and B, and λ DNA.</li>
 <li>Finally, anneal the oligonucleotide D to the DNA replication template by adding 100-fold excess of oligonucleotide D with respect to l DNA in T4 DNA ligase buffer.</li>
 <li>Incubate the mixture at 45 °C for 30 min in the heat block, and cool to room temperature slowly by turning heat block off.</li>
 <li>The final DNA replication template is now ready for use.  We store the template at a concentration of 1.4 nM at 4 °C for several weeks.</li>
</ol>
2. Beads
Beads are functionalized with a Fab fragment with specificity for digoxigenin. They can be then attached to the DNA replication template2.
Materials: Tosyl activated beads, α-digoxigenin Fab fragment, Buffer A: 0.1 M H3BO3 pH 9.5, Buffer B: 0.1 M PBS pH 7.4, 0.1% w/v BSA, Buffer C: 0.2 M Tris-HCl pH 8.5 (25 °C), 0.1% w/v BSA, Magnetic Separator, Rotator.
<ol>
	<li>Resuspend the stock solution of beads and transfer a small aliquot into the eppendorf tube. Place the tube into a slot of the magnetic separator and incubate until solution clears, then remove supernatant by pipetting.</li>
	<li>Add buffer A, which will activate tosyl groups for antibody coupling. Mix gently by pipetting and remove buffer with the magnetic separator.</li>
	<li>Add Fab fragment and resuspend beads again in buffer A, mix thoroughly, and incubate 16-24 hours at 37 °C using rotator. After incubation, separate beads using the magnetic separator and remove buffer.</li>
	<li>Wash beads by adding buffer B and incubate at 4 °C for 5 min. Remove the buffer using magnetic separator.  Repeat washing twice.</li>
	<li>Add buffer C and incubate at 37 °C for 4 hours to block free tosyl groups. Separate beads using magnetic separator and remove buffer.</li>
	<li>Wash twice in buffer B and aliquot for use. Beads can be stored at 4 °C for 1 year or longer without substantial loss of quality (our stock solution contains 1- 2x109 beads/ml).</li>
</ol>
3. Functionalized Coverslips
To allow attachment of the DNA to the glass coverslip, the glass is first functionalized with an aminosilane, which is then coupled to biotinylated PEG molecules. This coating helps to reduce the nonspecific interactions of DNA and replication proteins with the surface3,4.
Materials: Glass coverslips, Staining jars, 3-aminopropyltriethoxysilane, Methoxy-PEG5k-NHS ester, Biotin-PEG5k-NHSester, Acetone, 1M KOH, Ethanol, Oven, Bath sonicator
<ol>
	<li>Thoroughly clean the glass coverslips by placing them in staining jars and filling the jars with ethanol. Sonicate for 30 minutes, rinse out the jars and fill with 1 M KOH. Repeat both washes.</li>
	<li>For the first functionalization reaction, all traces of water need to be removed. Fill the jars with acetone and sonicate for 10 min. Empty and fill again with acetone.</li>
	<li>Prepare a 2 % v/v solution of the silane reagent in acetone. Add to the staining jars and agitate for 2 minutes. This reaction couples the alkoxy group of the aminosilane to the glass, leaving a reactive amine for the next coupling step.  Quench the reaction with a large excess of water.</li>
	<li>Dry the coverslips by baking them at 110 °C in the oven for 30 minutes.</li>
	<li>Prepare a 50:1 methoxy:biotin PEG mixture in 100 mM NaHCO3 pH 8.2. Aim for around 0.2 % w/v biotinylated PEG.</li>
	<li>Pipette 100 μL of the PEG mixture onto a dry silanized coverslip and place another coverslip on top. Including a glass coverslip spacer will allow separation of the coverslips.</li>
	<li>Incubate the coverslips in the PEG solution for 3 hours, then separate each pair of coverslips and wash extensively with water. Be careful to keep the coverslips functionalized side up as only once side will be coated with PEG.</li>
	<li>Dry the coverslips with air and store under vacuum in desiccator. The surfaces remain stable for at least a month, so dozens of coverslips can be made in a batch and used as needed.</li>
</ol>
4. Flow Chamber Preparation
The experiment is performed using a simple flow chamber constructed with a functionalized coverslip, double-sided tape, a quartz slide and tubing. One flow chamber is prepared for each single-molecule experiment2,4.
Materials: Double-sided tape, razor blade, quartz slide with holes for tubing, quick-dry epoxy, Functionalized coverslip, streptavidin solution (25 μL of 1 mg/mL in PBS), tubing, blocking buffer (5X: 20 mM Tris pH 7.5, 2 mM EDTA, 50 mM NaCl, 0.2 mg/mL BSA, 0.005% Tween-20), working buffer (1X: 20 mM Tris-HCl pH 7.5, 2 mM EDTA, 50 mM NaCl).
<ol>
	<li>Begin by mixing and placing 5 mL of blocking buffer and 20 ml of working buffer in a desiccator to remove any air bubbles for later steps.</li>
	<li>Take a PEG-functionalized coverslip and spread 125 of PBS-diluted streptavidin solution over the surface. Leave this to incubate for 20 minutes at room temperature while preparing other parts of the chamber, allowing streptavidin to bind surface biotins.</li>
	<li>Cut a piece of double-sided tape to match the size of the quartz slide. Mark the position of the tubing holes on the tape so that an outline of the flow chamber can be drawn on the tape.</li>
	<li>Make a 3 mm-wide center channel and rectangles containing both holes. We use flow chambers with two inlet and two outlet Y-shaped channels.</li>
	<li>Cut along the drawn outline, making straight, clean cuts to make sure no adhesive protrudes into the channel.</li>
	<li>Clean the quartz thoroughly using acetone or ethanol to remove adhesive from the previous flow cell construction.</li>
	<li>Find the best alignment of the channel outline, remove one side of the adhesive backing and carefully place the tape onto the quartz slide. Be careful to align the tape properly, as the inlet and outlet holes need to remain unblocked.</li>
	<li>Cut lengths of tubing for the inlet and outlet of the flow cell. It helps to cut the end of the tube at about a 30° angle so that the tube will not press flat against the chamber bottom. Place the tubes on some sort of support (e.g. tube racks) to suspend them for easy attachment to the flow cell in the next steps.</li>
	<li>Rinse the streptavidin-coated coverslip thoroughly with water and dry using compressed air. Remember that only one side is functionalized. Remove the other side of the tape backing and place the quartz slide onto the coverslip.</li>
	<li>Lightly press on the coverslip to push out any air trapped in the adhesive. This will help avoid any air bubbles getting into the flow channel.</li>
	<li>Seal the sides of the chamber with epoxy. Insert the cut tubing into the holes of the quartz and seal in place with epoxy. This needs to dry for a few minutes.</li>
	<li>Once dry, begin blocking the surface by pulling some of the degassed blocking buffer through one of tubes. A 21-gauge needle fits perfectly inside the 0.76 mm tubing. Flush out a few times to remove air bubbles, and allow the chamber to incubate for at least half an hour.</li>
</ol>
5. Single-molecule Replication Experiment
Once the DNA template and functionalized beads have been prepared, and the flow chamber is ready, a single-molecule experiment can be performed.
Materials: Prepared flow chamber, Blocking buffer (5X : 20 mM Tris-HCl pH 7.5, 2 mM EDTA, 50 mM NaCl, 1 mg/mL BSA, 0.025% Tween-20), Working buffer (1X: 20 mM Tris-HCl pH 7.5, 2 mM EDTA, 50 mM NaCl), T7 replication buffers with or without 10mM MgCl2 (1X: 40 mM Tris-HCl pH 7.5, 50 mM K-glutamate, 2 mM EDTA, 100 μg/ml BSA, 10 mM DTT, 600 μM dNTPs), replication proteins, inverted optical microscope with 10X objective, CCD camera, permanent rare-earth magnet, syringe pump, airspring, fiber illuminator, computer with image acquisition software.
<ol>
	<li>After the flow cell has been blocked, it is ready to begin the experiment.</li>
	<li>Take the flow cell and place it on the microscope stage. Hold the chamber in place with stage clips and be sure that the flow channel is positioned in alignment with CCD camera.</li>
	<li>Connect the flow cell outlet tubes to the airspring using a larger diameter connector tubing or a needle. The airspring is used to stabilize any flow irregularities. A 50 ml plastic tube is filled with 45ml of water. The lid of the tube is sealed with epoxy. Three holes are pierced in the lid, and three pieces of tubing are inserted into the tube. Using epoxy, the tubes are then sealed to the lid, preventing any air from entering or escaping. The airspring is connected to the syringe pump, and to the outlet tubes of the flow cell.</li>
	<li>Place the inlet tubes of the flow cell in blocking buffer and pull back on the syringe to remove any air in the tube. A gentle flick of the outlet tube will help clear any air bubbles trapped in the flow cell.</li>
	<li>Once all air bubbles have been removed, block one of the inlet tubes with a needle, and one of the outlet tubes by bending it by 1800 and securing the tube with adhesive tape.</li>
	<li>Dilute the stock DNA template to 10 pM in 1 ml of degassed blocking buffer. Flow into the chamber at moderate flow rate to allow good surface coverage of DNA (0.01-0.05 ml/min for 20 minutes works well). This can be varied based on how many DNA molecules are on the surface for each batch of coverslips or how many are desired for the experiment.</li>
	<li>Dilute the stock bead solution to 2-4x106 beads/ml in 1 ml of degassed blocking buffer. Flow into the chamber at 0.01-0.05 ml/min for 15 minutes.</li>
	<li>Once beads are added, turn the flow off and allow chamber to reach equilibrium. Then close both outlet tubes. Any changes to the tubes without the chamber closed will cause pressure fluctuations that will exert a strong force on the beads and shear the tethered DNA molecules.</li>
	<li>Block the inlet tube that was used for loading beads with a needle, and begin washing the flow cell using the second inlet with degassed 1X solution of blocking buffer in working buffer. Wash extensively at the rate of 0.01-0.05 ml/min. Agitate manually the stage by tapping to remove any beads nonspecifically stuck to the surface (<a href="https://www.jove.com/files/ftp_upload/1689/Tapping.avi">Tapping</a>).</li>
	<li>Once free beads are sufficiently removed, turn the flow off and allow chamber to reach equilibrium. Close the open outlet tube and switch the inlet reservoir to protein solution, slowly opening the outlet to avoid rapid pressure changes</li>
	<li>You can check if beads are tethered to DNA by changing direction of the flow (<a href="https://www.jove.com/files/ftp_upload/1689/DNA.avi">DNA</a>).</li>
	<li>Now, the enzymatic reaction can be performed. For leading-strand synthesis experiments make 20nM solution of gp4 helicase and 20nM solution of gp5 polymerase (purified as a complex with its processivity factor thioredoxin) in degassed T7 replication buffer that does not contain MgCl2.</li>
	<li>Flow the protein solution into the chamber at moderate flow rate to allow efficient binding to DNA.  We use 0.037 ml/min for 8 minutes, and then 0.012 ml/min for 7 minutes.</li>
	<li>Wash the chamber with degassed T7 replication buffer without MgCl2 to remove free proteins. The rate of 0.037 ml/min for 3-10 minutes works fine.</li>
	<li>After washing, flow T7 replication buffer with MgCl2 and begin data acquisition. Use a flow rate of 0.012 ml/min corresponding to 3 pN drag force on the DNA tethers under conditions described in this protocol.</li>
	<li>Place a rare-earth permanent magnet above the flow cell before imaging to prevent nonspecific interactions between beads and surface.</li>
	<li>View field with a 10X objective and CCD camera. Focus using a tethered bead.</li>
	<li>Position a fiber illuminator at an incidence angle between 10 degrees and parallel to the microscope stage near the microscope. Dark-field illumination is used to increase the contrast in the bead imaging.</li>
	<li>Acquire data for 20 30 min at a slow frame rate (typically 2-4 Hz).</li>
</ol>
6. Representative Results
In a successful experiment you should be able to observe more than 100 beads simultaneously (<a href="https://www.jove.com/files/ftp_upload/1689/Leading_strand_synthesis.avi">Leading strand synthesis</a>). The experiment should yield numerous traces displaying leading strand DNA synthesis.
Data Analysis:
In order to measure rates and processivities of DNA unwinding and polymerization, the precise positions of beads must be determined. You can achieve it by fitting these positions with 2-dimensional Gaussian functions. Trajectories can then be extracted by tracking bead position at each frame using tracking software (e.g. DiaTrack). Now you are ready to visualize trajectories by plotting bead position as a function of time using any graphic software (e.g. Origin). To obtain rate data, fit the plots with a linear regression and calculate the slope. For processivity, determine the total length of the DNA from start to end of a shortening event (Figure 3). Both of these numbers will need to be converted to basepairs. To convert bead movement to basepairs, first you need to measure the length of a stretched λ DNA molecule at the reaction flow rate. Since the length of the λ DNA is known (48,502 bp) you can calibrate the number of base pairs/pixel at experimental force. For increased accuracy, subtract from the traces of interest a baseline trace of a bead tether that is not enzymatically altered. Combine all single measurements and plot rate and processivity distributions. Fit the data using Gaussian and single-exponential functions, respectively (Figure 3).
<img src="/files/ftp_upload/1689/1689fig1.jpg" alt="DNA stretching experiment; bead-DNA setup; force-extension curve; microscope objective; molecular analysis." data-altupdatedat="1788235205000" data-alt="Figure 1"> Figure 1. Single-molecule experimental setup. (a) Duplex λ DNA (48.5 kb) is attached to the surface of the flow cell via the 5' end of one strand using a biotin-streptavidin interaction, and the 3' end of the same strand is attached to a bead using a digoxigenin anti-digoxigenin interaction. A primed replication fork is formed at the end opposite the bead to allow loading of the polymerase. (b) Bead-DNA assemblies are stretched using laminar flow of buffer and imaged using wide-field optical microscopy. By tracking the positions of the beads over time, while maintaining a constant stretching force, the lengths of the DNA constructs can be monitored. (c) Extension profile of ssDNA (filled circle) and dsDNA (open circle) under low forces. Dashed line shows crystallographic length of fully ds-λ DNA, 16.3 μm. The large difference in length between ssDNA and dsDNA at forces around 3 pN allows a direct observation of conversions between ss- and dsDNA by monitoring changes in the DNA length. The simultaneous visualization of large numbers of DNA-coupled beads allows for the study of many individual replisomes in one experiment.
<img src="/files/ftp_upload/1689/1689fig2.jpg" alt="DNA replication diagram with phage DNA and polymerase complex, indicating relative bead position." data-altupdatedat="1788235205000" data-alt="Figure 2"> Figure 2. Bacteriophage T7 replication proteins: DNA polymerase (complex of gp5 and thioredoxin) and DNA helicase (gp4) synthesize DNA leading strand in the presence of deoxyribonucleotides and magnesium. This process is accompanied by shortening of DNA lagging strand due to coiling. Conversion of dsDNA into ssDNA changes position of the bead. Measuring position of the bead allows precise determination of the rate and processivity of DNA replication.
<img src="/files/ftp_upload/1689/1689fig3.jpg" alt="DNA replication processivity vs. time graph with rate histogram; kinetic analysis." data-altupdatedat="1788235205000" data-alt="Figure 3"> Figure 3. Example of typical data from a single-molecule leading-strand synthesis experiment. Processivity of DNA replication is equal to a total length of the DNA from start to end of a shortening event. The rate of DNA replication is obtained by fitting the plot with a linear regression and calculating the slope. The inset shows rate and processivity distributions that were obtained by combining data from a number of measurements. Data were fitted using Gaussian and single-exponential functions, respectively.

<ol><li>Lee, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+primase+acts+as+a+molecular+brake+in+DNA+replication%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">DNA primase acts as a molecular brake in DNA replication.</a> Nature. 439, 621-624 (2006).</li>
<li>Tanner, N. A., van Oijen, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Single-molecule+observation+of+prokaryotic+DNA+replication%5BTitle%5D)+AND+%22Methods+Mol+Biol%22%5BJournal%5D)">Single-molecule observation of prokaryotic DNA replication.</a> Methods Mol Biol. 521, 397-410 (2009).</li>
<li>Sofia, S. J., Premnath, V. V., Merrill, E. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Poly%28ethylene+oxide%29+Grafted+to+Silicon+Surfaces%3A+Grafting+Density+and+Protein+Adsorption%5BTitle%5D)+AND+%22Macromolecules%22%5BJournal%5D)">Poly(ethylene oxide) Grafted to Silicon Surfaces: Grafting Density and Protein Adsorption.</a> Macromolecules. 31, 5059-5070 (1998).</li>
<li>Tanner, N. A., Loparo, J. J., van Oijen, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Visualizing+single-molecule+DNA+replication+with+fluorescence+microscopy%5BTitle%5D)+AND+%22J+Vis+Exp%22%5BJournal%5D)">Visualizing single-molecule DNA replication with fluorescence microscopy.</a> J Vis Exp. , (2009).</li>
<li>Hamdan, S. M., Loparo, J. J., Takahashi, M., Richardson, C. C., van Oijen, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Dynamics+of+DNA+replication+loops+reveal+temporal+control+of+lagging-strand+synthesis%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Dynamics of DNA replication loops reveal temporal control of lagging-strand synthesis.</a> Nature. 457, 336-339 (2009).</li>
<li>van Oijen, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Single-molecule+kinetics+of+lambda+exonuclease+reveal+base+dependence+and+dynamic+disorder%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Single-molecule kinetics of lambda exonuclease reveal base dependence and dynamic disorder.</a> Science. 301, 1235-1238 (2003).</li>
</ol>

It is important to ensure that the drag force exerted on beads by laminar flow doesn't influence enzymatic activities of the replication proteins. For instance, a 3 pN force that corresponds to a flow rate of 0.012 ml/min does not affect replication of the DNA leading strand. It does however affect enzymatic activities that take place during coordinated DNA synthesis, and it therefore has to be reduced to 1.5 pN. The drag force can be easily controlled by changing the flow rate or a width of the flow channel5....

<table><tbody><tr><td>Bacteriophage &amp;#955; DNA</td><td>New England Biolabs</td><td>N3011L</td><td></td></tr><tr><td>DNA Oligonucleotides</td><td>Integrated DNA Technologies</td><td></td><td></td></tr><tr><td>T4 DNA Ligase</td><td>New England Biolabs</td><td>M0202L</td><td></td></tr><tr><td>T4 Polynucleotide Kinase</td><td>New England Biolabs</td><td>M0201L</td><td></td></tr><tr><td>&amp;alpha;-digoxigenin Fab</td><td>Roche Group</td><td>11214667001</td><td></td></tr><tr><td>Tosyl Activated Beads</td><td>Invitrogen</td><td>142-03</td><td></td></tr><tr><td>Magnetic Separator</td><td>Invitrogen</td><td>Dynal MPC</td><td></td></tr><tr><td>3-aminopropyl-triethoxysilane</td><td>Sigma-Aldrich</td><td>A3648</td><td>Other aminosilanes can be used or mixed with non-amine reactive silanes for sparser surfaces</td></tr><tr><td>Succinimidyl propionate PEG</td><td>Nektar</td><td></td><td>Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.</td></tr><tr><td>Biotin-PEG-NHS</td><td>Nektar</td><td></td><td>Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.</td></tr><tr><td>Double-sided tape</td><td>Grace Bio-Lab Inc.</td><td>SA-S-1L</td><td>100 &amp;#x03BC;m thickness</td></tr><tr><td>Quartz slide</td><td>Technical Glass</td><td>20 mm (W)x 50 mm (L)x 1mm (H)</td><td>Size to fit on coverslips. Drill holes with diamond-tip drill bits (DiamondBurs.net)</td></tr><tr><td>Polyethylene tubing</td><td>BD Biosciences</td><td>427416</td><td>0.76 mm ID, 1.22 OD&lt;br/&gt;Other size tubing can be substituted.</td></tr><tr><td>Streptavidin</td><td>Sigma-Aldrich</td><td>S4762</td><td>Make 1 mg/mL solution, 25 &amp;#x03BC;L aliquots in PBS pH 7.3</td></tr><tr><td>Deoxyribonucleotide triphosphate solution mix</td><td>New England Biolabs</td><td>N0447</td><td></td></tr><tr><td>Inverted Optical Microscope with 10X Objective</td><td>Olympus Corporation</td><td>Olympus IX-51</td><td></td></tr><tr><td>Permament rare-earth magnet</td><td>National Imports</td><td>www.rare-earth-magnets.com</td><td></td></tr><tr><td>CCD Camera</td><td>QImaging</td><td>Rolera-XR Fast 139</td><td></td></tr><tr><td>Syringe Pump</td><td>Harvard Apparatus</td><td>11 Plus</td><td>Operate in refill mode to facilitate solution changes</td></tr><tr><td>Fiber Illuminator</td><td>Thorlabs Inc.</td><td>OSL1</td><td></td></tr></tbody></table>

direct observation of enzymes replicating dna using a single-molecule dna stretching assay

Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system. Linearized &lambda; DNA is modified to have a biotin on the end of one strand, and a digoxigenin moiety on the other end of the same strand. The biotinylated end is attached to a functionalized glass coverslip and the digoxigeninated end to a small bead. The assembly of these DNA-bead tethers on the surface of a flow cell allows a laminar flow to be applied to exert a drag force on the bead. As a result, the DNA is stretched close to and parallel to the surface of the coverslip at a force that is determined by the flow rate (Figure 1). The length of the DNA is measured by monitoring the position of the bead. Length differences between single- and double-stranded DNA are utilized to obtain real-time information on the activity of the replication proteins at the fork. Measuring the position of the bead allows precise determination of the rates and processivities of DNA unwinding and polymerization (Figure 2).

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system.

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system. ...

This video demonstrates a protocol for visualizing DNA replication by widefield optical microscopy linearized and chemically modified lambda. DNA is attached to a functionalized glass cover slip. The free end of the DNA is bead labeled and the DNA is stretched by laminar flow.When replication is initiated, the leading strand begins to lengthen and the lagging strand shortens due to coiling. The large difference in length between double stranded and single stranded DNA at low forces allows a direct observation of DNA conversions during replication. The length of the DNA construct is monitored by tracking the position of the bead, which allows precise determination of the rate and process of DNA replication.Hi, I'm Ari Ulrich from Laboratories of Anto one Vanian and Charles Richardson in the Department of Biological Chemistry and Molecular Pharmacology at Harvard Medical School. Today we are going to show you a procedure for imaging DNA replication at single molecular level. We use this procedure in our laboratories to study enzymatic activities that take place during DNA synthesis.So let's get started At the start of this procedure. Linearized bacteria phage Lambda DNA is modified by a kneeling oligonucleotides to form a replication fork, a lambda complementary fork arm, biotinylated fork arm, and a fork primer. The biotinylated fork forearm contains a biotin t attached to its five prime end, which allows tethering of the DNA template to the surface of the flow cell.The lambda DNA is further modified by annealing, another oligonucleotide that contains a diggen and moiety serving as a high affinity immuno tag for attachment of a bead. To generate the replication fork, obtain lambda DNA in addition to several oligonucleotides whose sequences can be found in the written protocol accompanying this video. These oligonucleotides include a biotinylated fork arm, a lambda complementary fork arm, a fork primer, and a lambda complementary diggen and end phosphorylate the five prime ends of the lambda complementary fork arm and the lambda complementary digo genin end using T four polynucleotide kinase.Next mix the phosphorylated lambda complementary fork arm, the biotinylated fork arm, the fork primer, and the lambda DNA in the molar ratio of 10 to 10 to 100 to one. In T four DNA Ligase buffer heat the mixture at 65 degrees Celsius for five minutes and slowly cool to room temperature by turning off the heat block to allow proper annealing of the oligonucleotides and T four DNA ligase to the mixture and incubate for two hours. At room temperature, T four DNA Ligase will catalyze sealing of the nicks between the oligonucleotides and the lambda.DNA finally anil the lambda complementary diggen and end to the DNA replication template by adding the phosphorylated lambda complementary diggen and end in T four Ligase buffer incubate the mixture for 30 minutes at 45 degrees Celsius and again, slowly cool to room temperature by turning off the heat block ligate the phosphorylated Lambda complementary dig oxygen and end to the DNA replication template by adding T four DNA ligase to the mixture and incubate for two hours at room temperature. The final DNA replication template is now ready for use. In order to attach the tassel activated magnetic beads to the DNA replication template, they must be functionalized with an FAB fragment specific for digo genin.To begin this process, resuspend the stock solution of beads and transfer 400 microliters into an einor tube. Place the tube into a magnetic separator and incubate until the solution clears. Then remove the supernatant by pipetting To activate the toal groups for antibody coupling, add one milliliter of boid buffer and mix gently by pipetting.Again, remove the supernatant with the aid of a magnetic separator. Next, add 240 microliters of FAB fragment and resuspend the beads in 400 microliters of borate buffer. Mix thoroughly and allow incubation on a rotator for 16 to 24 hours at 37 degrees Celsius.After incubation, separate the beads using the magnetic separator and remove the supernatant. Wash the beads with one milliliter of washing buffer and incubate for five minutes at four degrees Celsius, remove the buffer using the magnetic separator. This wash is repeated twice.To block the free tosil groups, add one milliliter of BSA containing tris buffer and incubate for four hours at 37 degrees Celsius. Following incubation, remove the buffer from the beads using a magnetic separator wash twice with buffer and aliquot. For use, the DNA to be replicated is attached to glass cover slips functionalized with Amil lane.The oxy group of the Amil lane binds to the glass leaving an amin available for binding to biotinylated peg molecules. This coating helps reduce non-specific binding to the surface. To thoroughly clean the glass cover slips, place them in staining jars and fill the jars with ethanol sonicate.For 30 minutes, rinse out the jars and fill with one molar potassium hydroxide sonicate for 30 minutes and repeat both washes. For the first functionalization reaction, all traces of water need to be removed. Fill the staining jars with acetone and sonicate for 10 minutes.Empty the jars and fill again with acetone. Proceed to add the sine reagent to the jars and agitate for two minutes. Then quench with a large excess of water.Then dry the cover slips by baking them at 110 degrees Celsius in the oven for 30 minutes. Next, prepare the peg mixture at about 0.2%weight per volume. Biotinylated peg, including a glass cover slip spacer, will allow separation of the cover slips, pipette 100 microliters onto a dry siloized cover slip.Place a second cover slip on top. Incubate the cover slips in the PEG solution for three hours. Then separate each pair of cover slips and wash extensively with water.Be careful to keep the cover slips functionalized side up as only one side will be coated with peg. Finally, dry the cover slips with compressed air and store them under vacuum In a desiccate, the surfaces remain stable for at least a month. So dozens of cover slips can be made in a batch and used as needed.Now that the cover slips are ready, one can assemble the flow chamber for the single molecule experiment. The single molecule experiment is performed using a simple flow chamber constructed with a functionalized cover slip, double-sided tape, a quart slide and tubing. One flow chamber is prepared for each single molecule experiment.Begin by mixing five milliliters of blocking buffer and 20 milliliters of working buffer and placing the mixture in a desiccate to remove any air bubbles for later steps. Next, spread 100 microliters of a working solution of strp din in PBS over the surface of the peg functionalized Cover slip incubate for 20 minutes at room temperature to allow strp din to bind surface biotin. Meanwhile, cut a piece of double-sided tape to match the size of the quartz slide mark the position of the tubing holes on the tape.Outline the flow chamber by drawing a three millimeter wide center channel and rectangles containing both holes. Flow chambers can be designed with two inlet and two outlet y shaped channels. Now cut the marked tape along the drawn outline, making straight clean cuts to be sure no adhesive protrudes into the channel.Clean the quartz slide thoroughly using acetone to remove adhesive from flow cell construction used in previous experiments. Find the best alignment of the channel outline. Remove one side of the adhesive backing and carefully place the tape onto the court slide.Be careful to align the tape properly as the inlet and outlet holes need to remain unblocked. Next, prepare the tubing cut lengths of 0.76 millimeter inner diameter tubing for the inlet and outlet of the flow cell. Cut the end of the tube at about a 30 degree angle so that the tube will not press flat against the chamber bottom.Suspend the tubing on test tube racks for easy attachment to the flow cell in the next steps. By now, the cover slip incubation should be finished. Rinse the cover, slip thoroughly with water and dry it using compressed air.Be careful not to turn the cover slip over as only one side is functionalized with peg. Complete the assembly of the flow chamber by removing the other side of the tape backing and placing the quartz slide onto the cover slip Lightly press on the cover slip to push out any air trapped in the adhesive. This will help prevent any air bubbles getting into the flow channel.Seal the sides of the chamber with epoxy. Insert the cut tubing into the holes of the quartz and seal in place with the epoxy. Let dry for a few minutes.Once dry, use a 21 gauge needle to pull some of the DGAs blocking buffer through one of the tubes in order to block the chamber surface. Flush out a few times to remove air bubbles and allow the chamber to incubate for at least 30 minutes before moving onto the single molecule replication experiment. Once the DNA template functionalized beads and the flow chamber have been prepared, a single molecule experiment can be performed.To begin, place the flow cell on the microscope stage. Hold the chamber in place with stage clips and be sure that the flow channel is positioned in alignment with the CCD camera. Connect to previously constructed air springing to the syringe pump and to the outlet tubes of the flow cell.Using larger diameter connector tubing, place the inlet tubes of the flow cell in blocking buffer and pull back on the syringe to remove any air bubbles from the tubes, gently flick the outlet tubes to clear any air bubbles trapped in the flow cell. Once all air bubbles have been removed, plug one of the inlet tubes with a needle and seal one of the outlet tubes by bending it 180 degrees and securing with adhesive tape Prior to adding DNA to the cell, dilute the stock DNA template to 10 picomolar in one milliliter of DGAs one x blocking buffer. Flow the template into the chamber at a moderate flow rate to allow good surface coverage of the DNA.Dilute the stock bead solution to between two and four times 10 of the sixth beads per milliliter. In one milliliter of DGAs one x blocking buffer. Then vortex the mixture and sonicate for 20 seconds.Flow the diluted bead solution into the chamber. Once beads are added, turn the flow off and allow the chamber to reach equilibrium. Then close both outlet tubes.Any changes to the tubes without the chamber closed will cause pressure fluctuations that will exert a strong force on the beads and shear the tethered DNA molecules. Plug the inlet tube that was used for loading the beads with a needle using the second inlet tube. Begin washing the flow cell with DGAs one x solution of blocking buffer wash extensively.Agitate the stage by tapping to remove any beads that are non-specifically stuck to the surface to check it. The beads are tethered to the DNA. Try changing direction of the flow.Once free beads are sufficiently removed, turn the flow off and allow the chamber to reach equilibrium. Prepare fresh reaction mixture containing replication proteins as indicated in the text protocol. Close the open outlet tube and switch the inlet reservoir to the freshly prepared reaction mixture.Slowly opening the outlet to avoid rapid pressure changes to proceed with the enzymatic reaction. First, flow the protein solution into the chamber at a moderate flow rate to allow efficient binding to the DNA. Turn off the flow and allow the chamber to reach equilibrium.Close the outlet tubes and replace the tube containing the reaction mixture. With the tube consisting of DGAs washing buffer, wash the chamber to remove free proteins after washing. Again, turn off the flow and allow the chamber to reach equilibrium.Close the outlet tubes and replace the tube containing washing buffer. With the tube containing the T seven replication buffer, the T seven replication buffer contains magnesium chloride that triggers the start of the replication reaction. Use a flow rate of 0.012 milliliters per minute that corresponds to three pico Newin drag force on the DNA tethers using conditions described in this protocol.Place a rare earth permanent magnet above the flow cell before imaging to prevent non-specific interactions between the beads and surface. Position a fiber illuminator at an incidence angle between 10 degrees and parallel to the microscope stage near the microscope view field with a 10 x objective and CCD camera. Dark field illumination is used to increase the contrast in the bead imaging focus using a tethered bead.Begin data acquisition acquire for 20 to 30 minutes at a slow frame rate. In a successful experiment, 100 beads can be simultaneously observed. The experiment should yield numerous traces displaying leading strand DNA synthesis.In order to measure rates and processive of DNA unwinding and polymerization, the precise positions of beads must be determined to achieve this. Fit these positions with two dimensional Gaussian functions. Visualize the trajectory by tracking the bead position in each frame using tracking software.Then plot bead position as a function of time using any graphic software to obtain rate data. Fit the plots with a linear regression and calculate the slope for processive. Determine the total length of the DNA from start to end of a shortening event.Combine all single measurements and plot rate and productivity distributions fit the data using Gaussian and single exponential functions respectively. We've just shown you how to measure rates and processive of DNA replication on a single molecule level. When doing this procedure, it's important to make sure that the force and certain of bets by the lamina flow doesn't affect enzymatic activities of the replication proteins.So that's it. Thanks for watching and have fun on your experiments.

direct-observation-enzymes-replicating-dna-using-single-molecule-dna

Research

JoVE Journal

Biology

This protocol demonstrates a simple single-molecule fluorescence microscopy technique for visualizing DNA replication by individual replisomes in real time.

Visualizing Single-molecule DNA Replication with Fluorescence Microscopy

DT40, a model vertebrate genetic system, provides a powerful tool to analyze protein function. Here we describe a simple method that allows qualitative analysis of parameters that influence DNA synthesis during the S-phase in DT40 cells at the single molecule level.

Visualization of DNA Replication in the Vertebrate Model System DT40 using the DNA Fiber Technique

This study presents a detailed experimental procedure to measure looping dynamics of double-stranded DNA using single-molecule Fluorescence Resonance Energy Transfer (FRET). The protocol also describes how to extract the looping probability density called the J factor.

Studying DNA Looping by Single-Molecule FRET

This protocol demonstrates a simple, robust and high throughput single molecule flow-stretching assay for studying one-dimensional (1D) diffusion of molecules along DNA.

A Simple, Robust, and High Throughput Single Molecule Flow Stretching Assay Implementation for Studying Transport of Molecules Along DNA

This protocol describes the characterization of DNA polymerase synthesis of modified DNA through observation of changes to near-infrared fluorescently labeled DNA using gel electrophoresis and gel imaging. Acrylamide gels are used for high resolution imaging of the separation of short nucleic acids, which migrate at different rates depending on size.

DNA Polymerase Activity Assay Using Near-infrared Fluorescent Labeled DNA Visualized by Acrylamide Gel Electrophoresis

A highly parallel method for measuring the site-specific cleavage of DNA at the single molecule level is described. This protocol demonstrates the technique using the restriction endonuclease NdeI. The method can easily be modified to study any process that results in site-specific DNA cleavage.

Parallel High Throughput Single Molecule Kinetic Assay for Site-Specific DNA Cleavage

Using quantum-dot-labeled DNA and total internal reflection fluorescence microscopy, we can investigate the reaction mechanism of restriction endonucleases while using unlabeled protein. This single-molecule technique allows for massively multiplexed observation of individual protein-DNA interactions, and data can be pooled to generate well-populated dwell-time distributions.

Single-Molecule Dwell-Time Analysis of Restriction Endonuclease-Mediated DNA Cleavage

The methodology assists in the analysis of variation in DNA replication dynamics in the presence of nanoparticles. Different methodologies can be adopted based on the cytotoxicity level of the material of interest. In addition, a description of the image analysis is provided to help in DNA fiber analysis.

Demonstration of the DNA Fiber Assay for Investigating DNA Damage and Repair Dynamics Induced by Nanoparticles

Enrichment and sequencing of protein-associated nascent DNA (eSPAN) was developed to detect the relative abundance of a chromatin-associated protein on two replicating DNA strands, thereby revealing molecular insight into chromatin replication and its coupled processes. This protocol describes eSPAN procedures in yeast and mouse embryonic stem (ES) cells.

Strand-Specific Analysis of Proteins at Replicating DNA Strands by Enrichment and Sequencing of Protein-Associated Nascent DNA Method

This protocol demonstrates performing a single-molecule assay for live visualization of DNA unwinding by CMG helicase. It describes (1) preparing a DNA substrate, (2) purifying fluorescently labeled Drosophila melanogaster CMG helicase, (3) preparing a microfluidic flow cell for total internal reflection fluorescence (TIRF) microscopy, and (4) the single-molecule DNA unwinding assay.

Single-Molecule Real-Time Visualization of DNA Unwinding by CMG Helicase

This protocol outlines a fluorescence microscopy-based single-molecule DNA replication assay, enabling real-time visualization of interactions between DNA polymerases and obstacles such as G-quadruplex structures.

Single-Molecule Fluorescence Visualization of DNA Polymerase Dynamics at G-Quadruplexes

Learn a single-molecule DNA stretching assay for real-time observation of DNA replication using lambda DNA and widefield optical microscopy. This method enables precise measurement of replication rates and strand dynamics.

Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay

Explore More Videos