Name: Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients (Video) | JoVE Journal
Uploaded: 2011-06-11T15:00:00.000+00:00
Duration: 13 min 50 s
Description: Learn bacterial DNA sequencing methods to detect translocating microflora in peripheral blood of HIV-infected patients. This technique reveals how gut microbiota influences systemic immune activation and disease progression.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

We are grateful to Gianni Scimone for excellent assistance with video making.

Handling of HIV infected blood samples requires some important recommendations.
 
 All specimens of blood must be transported in robust leak-proof containers. Care must be taken when collecting the specimen to avoid contamination of the container’s exterior and of 
 any paperwork accompanying the specimen.
 
 All persons processing infected blood must wear gloves. Gloves must be changed and hands washed after completion of specimen processing.
 
 Processing of HIV-infected blood samples must be done in a class II biohazard cabinet hood. 
 
 Mechanical pipetting aids should be used. 
 
 Use of needles or other sharps (including glass e.g. pipettes or capillary tubes) must be limited to situations in which there is no alternative.
 
 Laboratory surfaces must be decontaminated with an appropriate chemical disinfectant after a spill of blood and when work activities are completed.
 
 Contaminated materials used must be decontaminated before reuse or must be disposed of correctly via the clinical waste route.
 
 Every incident of occupational exposure to potentially infectious blood or fluids (i.e., those requiring universal precautions) 
 should be treated as a medical emergency as interventions must be initiated promptly to be effective.
 
 The protocol requires 5 days for its completion. The timeframe is detailed in Figure 1.
 
 Bacterial species are identified using the methods described in Figure 2.

1. Sample Collection
<ol>
 <li>9 ml of whole blood is drawn into EDTA containing tubes.</li>
 <li>Tubes are centrifuged at 2000 rpm for 10 minutes at RT to obtain plasma.</li>
 <li>Plasma is collected in a sterile 2 ml Eppendorf-tube.</li>
</ol>
2. DNA Extraction from Plasma Samples
<ol>
 <li>Adequately disinfect hood, pipettes and material needed for the experiment in order to guarantee sterility.</li>
 <li>Position all materials under UV lights for at least 30 minutes.</li>
 <li>Wipe gloves with a disinfectant.</li>
 <li>Soak a few paper towels in ethanol and place them under the hood. Every time a tip is discarded wipe the pipette on the wet paper towels.</li>
</ol>
DNA is extracted using a commercial kit following manufacturer’s instructions (Easy-DNA Kit, Invitrogen, Carlsbad CA, USA).
<ol start="5">
 <li>350 μL of plasma are placed in a sterile 2ml eppendorf tube.</li>
 <li>350 μL of filtered ultrapure water are used as negative control.</li>
 <li>Add 10 μL of lysozyme (1mg/ml) to the samples.</li>
 <li>Incubate for 30 minutes at 37°C.</li>
 <li>Add 500 μL of Lysis Solution and mix gently to the samples.</li>
 <li>Incubate for 7 minutes at 65°C.</li>
 <li>Add 900 μL of chloroform to the samples.</li>
 <li>Vortex vigorously until the samples are uniformly viscous.</li>
 <li>Add 200 μL of Precipitation Solution and vortex vigorously.</li>
 <li>Centrifuge samples at 10500 rpm for 10 minutes at RT to separate the phases and form the interface.</li>
 <li>Transfer the upper aqueous phase to a fresh microcentrifuge tube containing 1 ml of ethanol 100%.</li>
 <li>Centrifuge samples at 10500 rpm for 10 minutes at 4°C.</li>
 <li>Remove ethanol.</li>
 <li>Add 1ml of ethanol 70%.</li>
 <li>Centrifuge samples at maximum speed for 10 minutes at 4°C.</li>
 <li>Remove ethanol. The residual ethanol should be removed with a pipettator.</li>
 <li>Resuspend the pellet in 50 μL of ultrapure water.</li>
 <li>Read DNA concentration with a spectrophotometer.</li>
</ol>
3. 16S rRNA Gene PCR
 PCR amplification is performed as previously described 9.
<ol>
 <li>Amplify DNA in a 100 μL reaction mixture consisting of 10 μL of 10X PCR buffer, 5 μL of 25 mM MgCl2, 5 μL of 2 mM total dNTPs, 
 1 μL of 50 μM primer RW01 (AACTGGAGGAAGGTGGGGAT), 1 μL of 50 μM primer DG74 (AGGAGGTGATCCAACCGCA), 34 μL of H20 and 0.5 
 μL of Taq polymerase (AmpliTaq Gold, Applied Biosystem, Foster City, CA, USA).</li>
 <li>Transfer the PCR mix in filters in order to avoid possible contamination by bacterial Taq polymerase.</li>
 <li>Centrifuge filters (Microcon, Millipore, Billerica, MA, USA) for 30 minutes at 500 rcf at 4°C.</li>
 <li>Aliquot the PCR mix according to the number of samples which need to be amplified (positive and negative PCR controls, 
 samples and extracted water).</li>
 <li>Use the following thermal cycler conditions: 94°C for 10 minutes; 40 times for 1 minute each time at 94°C, 55°C and 72°C, 
 and 10 min at 72°C.</li>
 <li>Visualize the PCR product on a 2% agarose gel. Use 100 bp DNA ladder. PCR product size is about 360 bp (Figure 3).</li>
</ol>
4. PCR Product Purification
Only PCR positive samples should be purified. Purification is performed using a commercial kit following manufacturer’s instructions (PureLink PCR microkit, Invitrogen, Carlsbad CA, USA). 
<ol>
 <li>Add 4 volumes of Binding Buffer containing isopropanol per 1 volume of PCR product.</li>
 <li>Transfer PCR product with Binding Buffer to a column.</li>
 <li>Centrifuge for 1 minute at 10000 rcf at RT.</li>
 <li>Wash column with Wash Buffer containing ethanol.</li>
 <li>Centrifuge for 1 minute at 10000 rcf at RT.</li>
 <li>Centrifuge at maximum speed for 1 minute at RT to dry the silica membrane and remove any residual Wash Buffer with ethanol.</li>
 <li>Add 10 μL of ultrapure water.</li>
 <li>Incubate for 1 minute at RT.</li>
 <li>Centrifuge at maximum speed for 2 minutes at RT to collect the purified DNA.</li>
</ol>
5. Cloning
Lysogeny Broth (LB) Plate Preparation
<ol>
 <li>Dissolve 25 gr of LB mix in approximately 800 ml of water.</li>
 <li>Bring the final volume to 1 L.</li>
 <li>Add 15 gr of Bactoagar.</li>
 <li>Autoclave for 20 minutes.</li>
 <li>After autoclaving, vigorously swirl the solution in the flask to mix molten agar.</li>
 <li>Cool the solution to 50°C.</li>
 <li>Add Ampicillin (50 μg/ml) and swirl until it dissolves.</li>
 <li>Pour plates to a depth of approximately 3mm.</li>
 <li>Leave the plates out at room temperature.</li>
 <li>Spread X-Gal (40mg/ml) and IPTG (100 mM) on each LB plate and incubate at 37°C until ready for use.</li>
</ol>
Competent Cells Transformation
Transformation is performed using a commercial kit following manufacturer’s instructions (Topo TA cloning kit, Invitrogen, Carlsbad CA, USA).
<ol>
 <li>Prepare the cloning reaction mix (1-4 μL of fresh PCR product, 1 μL of salt solution, 1 μL of vector and water if necessary).</li>
 <li>Mix reaction gently and incubate for 5-10 minutes at RT.</li>
 <li>Place the reaction on ice.</li>
 <li>Add 2 μL of the cloning reaction into a vial of competent cells and mix gently.</li>
 <li>Incubate on ice for 30 minutes.</li>
 <li>Heat-shock the cells for 30 seconds at 42°C.</li>
 <li>Immediately transfer the tube into ice.</li>
 <li>Add 250 μL of medium.</li>
 <li>Cap the tube tighly and shake the tube horizontally at 37°C for 1 hour.</li>
 <li>Spread 50 μL from each transformation on a prewarmed selective plate.</li>
 <li>Incubate overnight at 37°C.</li>
</ol>
Following incubation, white and blue colonies develop on plates. White colonies are positive for PCR product insertion and blue colonies are negative for PCR product insertion.
6. Sequencing Analysis
Sequencing Reaction
<ol>
 <li>A mix is made using these reagents: 2,5 μl DNA, 1 μl primer (5pmol/ μl) 1,1 μl BigDye (Applied Biosystem, Foster City, CA, USA ).</li>
 <li>Thermal cycler conditions: 96°C for 1 minutes; 25 times for 96°C for 10 sec, 55°C for 15 sec and 60°C for 4 min.</li>
</ol>
Column Purification
<ol>
 <li>For each reaction, prepare one MicroSpin Column (Qiagen, , Milan, Italy).</li>
 <li>Invert column and vortex to mix resin.</li>
 <li>Snap off the bottom of column, loosen lid ¼ turn, and place column in a microcentrifuge tube.</li>
 <li>Centrifuge 3200 rpm for 1 minute.</li>
 <li>Transfer column to a clean microcentrifuge tube.</li>
 <li>Carefully pipet the entire PCR sequencing reaction into the center of the column.</li>
 <li>Centrifuge 3200 rpm for 1 minute.</li>
 <li>Purified DNA will eluite into tube (20 μl of ultrapure water).</li>
</ol>
Sequencing Analysis
<ol>
 <li>Load the purified sample (20 μl) into 96-multiwell plate.</li>
 <li>Load the plate into the sequencer. Automated DNA Sequencers generate a four-color chromatogram showing the results of the sequencing 
 run.</li>
 <li>Input the nucleotide sequence as a query against the public sequence databases. The search is performed on the NCBI databases and 
 servers, with Basic Local Alignment Search Tool (BLAST).</li>
 <li>Consider only bacteria with 98-100% homologies.</li>
</ol>
7. Representative Results
<img src="/files/ftp_upload/2830/2830fig1.jpg" alt="Molecular cloning timeline: DNA extraction, PCR, cloning, incubation, sequencing. Diagram of process." data-altupdatedat="1788235205000" data-alt="Figure 1"> 
 Figure 1. Timeline of the procedure.
<img src="/files/ftp_upload/2830/2830fig2.jpg" alt="Workflow of DNA extraction and cloning; diagram showing steps from blood collection to BLAST analysis." data-altupdatedat="1788235205000" data-alt="Figure 2"> 
 Figure 2. Flow charts of the entire bacterial identification procedure.
<img src="/files/ftp_upload/2830/2830fig3.jpg" alt="Gel electrophoresis result, DNA bands at 300 bp and 400 bp, indicating fragment size separation." data-altupdatedat="1788235205000" data-alt="Figure 3"> 
 Figure 3. 2% agarose gel showing broad range 16S rRNA gene PCR products. Lane 1 contains a 100bp DNA ladder, lane 2 contains 
 the PCR positive control, lane 3 shows the negative PCR control. Lane 4 shows samples from an HIV-positive patient, and lane 5 contains water.
 Lane 6 shows samples from a healthy individual and a negative PCR reaction; lane 7 contains water. Only HIV positive patients displays a 
 positive PCR amplification. Ultrapure water used as a negative control during the extraction step, indicates that no contamination occurred.
<img src="/files/ftp_upload/2830/2830fig4.jpg" alt="DNA electrophoresis gel; molecular weight markers; lanes with DNA bands; genetic analysis results." data-altupdatedat="1788235205000" data-alt="Figure 4"> 
 Figure 4. 0.7% agarose gel showing plasmid extracted with miniprep procedure. Lane 1 contains a 1 Kilobase DNA ladder, lane 2 
 contains the blue control colony, lanes 3 through 12 contain white colonies. The plasmid from the blue colony does not contain the PCR product
 insert. All 10 white colonies contain plasmid with the correct insert.
<img src="/files/ftp_upload/2830/2830fig5.jpg" alt="Bacterial species identification chart; colony types, species, and 100% homology results." data-altupdatedat="1788235205000" data-alt="Figure 5"> 
 Figure 5. Shows an example of bacterial sequencing analysis in plasma from one HIV-positive individual. Our results show that microbial translocation in HIV disease involves a polimicrobic flora, which is not seen in HIV-negative subjects, suggesting substantial failure of gut immunity in controlling bacteria translocation.

<ol><li>Hooper, L. V., Macpherson, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Immune+adaptations+that+maintain+homeostasis+with+the+intestinal+microbiota%5BTitle%5D)+AND+%22Nat+Rev+Immunol%22%5BJournal%5D)">Immune adaptations that maintain homeostasis with the intestinal microbiota.</a> Nat Rev Immunol. 10, 159-169 (2010).</li>
<li>Macpherson, A. J., Harris, N. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Interactions+between+commensal+intestinal+bacteria+and+the+immune+system%5BTitle%5D)+AND+%22Nat+Rev+Immunol%22%5BJournal%5D)">Interactions between commensal intestinal bacteria and the immune system.</a> Nat Rev Immunol. 4, 478-485 (2004).</li>
<li>Kanauchi, O., Mitsuyama, K., Araki, Y., Andoh, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Modification+of+intestinal+flora+in+the+treatment+of+inflammatory+bowel+disease%5BTitle%5D)+AND+%22Curr+Pharm+Des%22%5BJournal%5D)">Modification of intestinal flora in the treatment of inflammatory bowel disease.</a> Curr Pharm Des. 9, 333-346 (2003).</li>
<li>Brenchley, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Microbial+translocation+is+a+cause+of+systemic+immune+activation+in+chronic+HIV+infection%5BTitle%5D)+AND+%22Nat+Med%22%5BJournal%5D)">Microbial translocation is a cause of systemic immune activation in chronic HIV infection.</a> Nat Med. 12, 1365-1371 (2006).</li>
<li>Brenchley, J. M., Price, D. A., Douek, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((HIV+disease%3A+fallout+from+a+mucosal+catastrophe%5BTitle%5D)+AND+%22Nat+Immunol%22%5BJournal%5D)">HIV disease: fallout from a mucosal catastrophe.</a> Nat Immunol. 7, 235-239 (2006).</li>
<li>Jiang, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Plasma+levels+of+bacterial+DNA+correlate+with+immune+activation+and+the+magnitude+of+immune+restoration+in+persons+with+antiretroviral-treated+HIV+infection%5BTitle%5D)+AND+%22J+Infect+Dis%22%5BJournal%5D)">Plasma levels of bacterial DNA correlate with immune activation and the magnitude of immune restoration in persons with antiretroviral-treated HIV infection.</a> J Infect Dis. 199, 1177-1185 (2009).</li>
<li>Marchetti, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Microbial+translocation+is+associated+with+sustained+failure+in+CD4%2B+T-cell+reconstitution+in+HIV-infected+patients+on+long-term+highly+active+antiretroviral+therapy%5BTitle%5D)+AND+%22AIDS%22%5BJournal%5D)">Microbial translocation is associated with sustained failure in CD4+ T-cell reconstitution in HIV-infected patients on long-term highly active antiretroviral therapy.</a> AIDS. 22, 2035-2038 (2008).</li>
<li>Marchetti, G. Role of Microbial Translocation and Immune Hyperactivation in Disease Progression of HIV+ Patients with Preserved CD4 Count in the Absence of ART. The 17th Conference on Reteroviruses and Opportunistic Infections (CROI), San Francisco, CA, USA, , (2010).</li>
<li>Greisen, K., Loeffelholz, M., Purohit, A., Leong, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((PCR+primers+and+probes+for+the+16S+rRNA+gene+of+most+species+of+pathogenic+bacteria%2C+including+bacteria+found+in+cerebrospinal+fluid%5BTitle%5D)+AND+%22J+Clin+Microbiol%22%5BJournal%5D)">PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid.</a> J Clin Microbiol. 32, 335-351 (1994).</li>
</ol>

No conflicts of interest declared.

We hereby show a PCR/sequencing protocol to characterise the translocation of bacteria in peripheral blood of HIV-infected individuals.
Most reliable results are obtained when using plasma collected in EDTA-containing tubes. After blood sampling, plasma should be separated by 
	centrifugation within 2/3 hours, to avoid haemolysis and DNA fragment degradation. Samples are stored first at -20&deg;C for 
	approximately 5 days and then at -80&deg;C. Multiple freeze and thaw cycles which may cause...

<table><tbody><tr><td>Easty-DNA Kit</td><td>Invitrogen</td><td>K 180001</td><td></td></tr><tr><td>Chloroform</td><td>Sigma-Aldrich</td><td>C2432</td><td></td></tr><tr><td>Ethanol</td><td>Sigma-Aldrich</td><td>E7203</td><td></td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>UltraPure Waer</td><td>Invitrogen</td><td>10977049</td><td></td></tr><tr><td>Lysozyme</td><td>Fluka</td><td>62970</td><td>10 &amp;#x03BC;g/mL in Distillated Water</td></tr><tr><td>AmpliTaq Gold</td><td>Applied Biosystems</td><td>26478701</td><td></td></tr><tr><td>Microcon 100</td><td>EMD Millipore</td><td>42413</td><td></td></tr><tr><td>PCR primers</td><td>Invitrogen</td><td></td><td></td></tr><tr><td>Agarose</td><td>Eppendorf</td><td>C1343</td><td></td></tr><tr><td>DNA ladder</td><td>Invitrogen</td><td>15628019</td><td></td></tr><tr><td>Purelink PCR micro kit</td><td>Invitrogen</td><td>K310050</td><td></td></tr><tr><td>LB Agar, powder</td><td>Invitrogen</td><td>22700025</td><td></td></tr><tr><td>Bactoagar</td><td>Invitrogen</td><td></td><td></td></tr><tr><td>Ampicillin</td><td>Invitrogen</td><td>11593027</td><td>10 mg/mL in Distillated Water</td></tr><tr><td>X-gal</td><td>Invitrogen</td><td>15520034</td><td>40mg/mL in DMF</td></tr><tr><td>IPTG</td><td>Invitrogen</td><td>15529019</td><td>100mM in Distillated water</td></tr><tr><td>Topo TA cloning kit</td><td>Invitrogen</td><td>K450002</td><td></td></tr><tr><td>Purelink Quick Plasmid Miniprep kit</td><td>Invitrogen</td><td>K210010</td><td></td></tr><tr><td>Big dye</td><td>Applied Biosystems</td><td>4337455</td><td></td></tr><tr><td>DyeEx 2.0 spin kit</td><td>Qiagen</td><td>63204</td><td></td></tr></tbody></table>

sequencing of bacterial microflora in peripheral blood: our experience with hiv-infected patients

Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients

The healthy gastrointestinal tract is physiologically colonized by a large variety of commensal microbes that influence the development 
	of the humoral and cellular mucosal immune system1,2. 
 Microbiota is shielded from the immune system via a strong mucosal barrier. Infections and antibiotics are known to alter both the normal 
	gastrointestinal tract barrier and the composition of resident bacteria, which may result in possible immune abnormalities3.
HIV causes a breach in the gastrointestinal barrier with progressive failure of mucosal immunity and leakage into the systemic circulation of bacterial bioproducts, such as lipopolysaccharide and 
	bacterial DNA fragments, which contribute to systemic immune activation4-7. Microbial translocation is implicated in HIV/AIDS immunopathogenesis and response to therapy 4,8.
We aimed to characterise the composition of bacteria translocating in peripheral blood of HIV-infected patients. To pursue our aim we set up a PCR reaction for the panbacteric 16S ribosomial gene 
	followed by a sequencing analysis.
Briefly, whole blood from both HIV-infected and healthy subjects is used. Given that healthy individuals present normal intestinal homeostasis no translocation of microflora is expected in 
	these patients. Following whole blood collection by venipuncture and plasma separation, DNA is extracted from plasma and used to perform a broad range PCR reaction for the panbacteric 
	16S ribosomial gene9. Following PCR product purification, cloning and sequencing analyses are performed.

Our experiment will show how to perform a sequencing analysis of bacterial species translocating in peripheral blood of HIV positive patients.

The healthy gastrointestinal tract is physiologically colonized by a large variety of commensal microbes that influence the development 
	of the humoral ...

Sequencing of bacterial microflora, translocating in peripheral blood. Our experience with HIV infected patients, I am junior Marti, and I work as assistant professor at the Clinic of Infectious Diseases and Tropical Medicine at the University of Milan in Italy. And we will now show you experiments on how to detect and sequence bacterial DNA from peripheral blood of HIV infected patients.The healthy gastrointestinal tract is colonized by a large variety of commensal microbes that influence the development of the humeral and cellular cusal immune system. Microbiota is shielded from the immune system via a strong mucosal barrier following several clinical conditions such as infections, antibiotic treatment, postoperative complications, as well as in patients with carcinoma, pancreatitis, and malnutrition. An alteration of the gastrointestinal tract occurs.HIV infection causes a breach of the gastrointestinal barrier with progressive failure of mucosal immunity and leakage into the systemic circulation of bacterial bioproducts, such as lipopolysaccharide and bacterial DNA fragments, which contribute to systemic immune activation, demonstrating the experimental phases of the detection and sequencing of bacterial DNA. Present in peripheral blood of HIV infected patients will be Camilla ti, an infectious disease fellow Esther, me, a PhD student and ju MariaI, a postdoctoral fellow all attending the clinic of Infectious Diseases and the tropical medicine at the University of Milan. Our experiment aims to identify bacterial species and peripheral blood samples from HIV infected patients.We're going to use whole blood from both HIV infected and healthy subjects, given that healthy individuals present normal intestinal homeostasis. We do not expect to see translocating microflora in these patients. Whole blood will be collected from patients followed by plasma separation.DNA will be then extracted in order to perform a broad range PCR reaction for the PCIC 16 s ribosomal gene. Following PCR product, purification, cloning and sequencing analysis will be performed. The first step of our experiment is blood collection by venipuncture, followed by plasma separation.Whole blood, approximately nine mils is drawn into EDTA containing tubes. Tubes are placed in a centrifuge at 2000 RPM for 10 minutes. At room temperature centrifugation allows for plasma separation.DNA will now be extracted from our plasma samples Adequately disinfect hood, peppes, and material needed for the experiment in order to guarantee sterility position all material under UV lights for at least 30 minutes. Turn off UV lights, wipe gloves with a disinfectant, soak a few paper towels in ethanol, and place them under the hood every time a tip is discarded. During the DNA extraction procedure, wipe the pipet on the wet paper towels.You are now ready for DNA extraction. DNA is extracted using a commercial kit, following manufacturing instructions. In brief, 350 microliters of plasma is placed in a two mil eend orph tube.Ultra pure water is used as negative control. 10 microliters of lysosome at a final concentration of one mg per mil is added to the samples. Samples are then incubated for 30 minutes.At 37 degrees Celsius solution A, chloroform and solution B are then added to the samples according to instructions following centrifugation. Three distinct phases will appear. The supernatant is collected and added to ethanol fault, allowing for DNA precipitation, DNA concentration is read with a spectrophotometer.The next step is a broad range of PCR reaction amplifying for the PRIC 16 s ribosomal gene PCR is performed in a dedicated room. A PCR mix Is made using these reagents. The PCR mix is filtered for 30 minutes at 500 G at four degrees Celsius in order to avoid possible contamination by bacterial tap polymerase.The PCR mix is then divided into aliquots. According to the number of samples which need to be amplified. Remember to consider aliquots for negative and positive reaction controls.THERMOCYCLING is programmed at the following conditions, 94 degrees Celsius for five minutes. 94 degrees Celsius, 55 degrees Celsius, 72 degrees Celsius for one minute for 40 cycles, 72 degrees Celsius for 10 minutes. Average duration is three hours.PCR products are visualized on a 2%AGROS gel. This is a 2%agros gel showing PCR products. The first lane contains a 100 base pair ladder.The second lane, A PCR positive control. The third lane contains a negative PCR control. The fourth lane shows samples from an HIV positive patient and the fifth lane contains water lane.Six shows samples from a healthy individual and a negative PCR reaction. Lane seven contains water. PCR IFICATION is the following step.PCR products are purified using a commercial kit, following manufacturer's instructions. Many columns containing filters are used for this step. PCR results are recorded on a working sheet.We are now going to proceed with cloning by using the blue white screen. A molecular technique that allows for the detection of successful DNA lation into a vector. The vector is transformed into competent cells.Bacteria.The competent cells are grown in the presence of xal. If the lation is successful, the bacterial colony will be white. If not the colony will be blue.Xal is used to indicate whether a cell expresses the beta galacto aase enzyme and to visualize the transformation of e coli colonies, IPTG induces the expression of beta galacto. Aase Xal and IPTG are swirled onto ampicillin containing plates. A cloning mix containing PCR products, SALT and a cloning vector is prepared following manufacturer's instructions.E coli cells are thought on ice. The cloning mix is then added to the cells, which are later following thermal shock plates are incubated overnight at 37 degrees Celsius. Following incubation, white and blue colonies develop on plates.White colonies are positive for PCR products. Insertion and blue colonies are negative for PCR product insertion. 10 white colonies and one blue colony are selected.Each colony is placed into two mils of liquid LB growth. Medium with the addition of ampicillin colonies are incubated overnight at 37 degrees Celsius. Following incubation colonies O grown overnight are used for plasmid extraction with a commercial mini prep kit.Mini columns containing filters are used for the step Following plasmid extraction plasmid are visualized on a 0.7%AROS gel. This is a 0.7%AROS gel showing mini prep products. The first lane contains a one kilo base ladder.The second lane contains the blue control colony. Lanes three through 12 contain white colonies. Results are recorded with a working sheet sequencing Step follows, plasmids are amplified.A mix is made using these reagents. The PCR mix is divided into aliquots according to the number of samples which need to be amplified. Thermocycling is programmed at the following conditions, 96 degrees Celsius for one minute, 96 degrees Celsius for 10 seconds, 50 degrees Celsius for five seconds, 60 degrees Celsius for four minutes.For 25 cycles. Average duration is approximately one hour. Following amplification, PCR products are purified using filter containing columns.Purified products are loaded on a plate, which is then placed into a sequencer. Once a sequenced sequence is obtained, it is launched in blast and bacterial species from each colony are identified. Colony displaying a 98%to 100%homology sequence are considered positive.This is an example of bacterial sequencing in plasma from one HIV positive individual. Our results show that microbial translocation in HIV disease involves a polymicrobial flora. We have hereby shown that HIV infected patients present a high polymicrobial microbic microflora in the systemic circulation.Bacterial DNA in peripheral blood was under detection limit for our HIV negative healthy individuals possibly reflecting the integrity of the gastrointestinal tract. Our research is now focused on understanding and investigating the possible role of microflora in peripheral blood, in conditioning, HIV Immunopathogenesis, and possibly the response to therapy.

sequencing-bacterial-microflora-peripheral-blood-our-experience-with

Research

JoVE Journal

Medicine

HIV tropism can be inferred from the V3 region of the viral envelope. V3 is PCR amplified in triplicate using nested RT-PCR, sequenced, and interpreted using bioinformatic software. Samples with with 1 or more sequence(s) with low g2P scores are classified as non-R5 virus.

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

We have developed an in vitro malaria-HIV-1 co-infection model to study the impact of Plasmodium falciparum on the HIV-1 replicative cycle in human primary monocyte-derived macrophages. This versatile system can easily be adapted to other primary cell types susceptible to HIV-1 infection.

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

Using the cystic fibrosis airway as an example, the manuscript presents a comprehensive workflow comprising a combination of metagenomic and metatranscriptomic approaches to characterize the microbial and viral communities in animal-associated samples.

Purifying the Impure: Sequencing Metagenomes and Metatranscriptomes from Complex Animal-associated Samples

Human co-infection is difficult to replicate in vitro. However, human malaria parasites can readily be cultured in vitro, as can freshly isolated human peripheral blood mononuclear cells naturally infected with HIV. This provides an excellent model for studying early immune responses to malaria parasites in the context of HIV co-infection.

An In Vitro Model for Measuring Immune Responses to Malaria in the Context of HIV Co-infection

Techniques describing a gradient procedure to separate exosomes from human immunodeficiency virus (HIV) particles are described. This procedure was used to isolate exosomes away from HIV particles in human plasma from HIV-infected individuals. The isolated exosomes were analyzed for cytokine/chemokine content.

Isolation of Exosomes from the Plasma of HIV-1 Positive Individuals

Infection of human tissues with human immunodeficiency virus (HIV) ex vivo provides a valuable 3D model of virus pathogenesis. Here, we describe a protocol to process and infect tissue specimens from human tonsils and female genital mucosae with HIV-1 and maintain them in culture at the liquid-air interface.

Ex Vivo Infection of Human Lymphoid Tissue and Female Genital Mucosa with Human Immunodeficiency Virus 1 and Histoculture

Full-length individual proviral sequencing (FLIPS) provides an efficient and high-throughput method for the amplification and sequencing of single, near full-length (intact and defective) HIV-1 proviruses and allows for determination of their potential replication-competency. FLIPS overcomes limitations of previous assays designed to sequence the latent HIV-1 reservoir.

Amplification of Near Full-length HIV-1 Proviruses for Next-Generation Sequencing

We describe a method for processing bronchoalveolar lavage fluid and matched peripheral blood from chronically HIV-infected individuals on antiretroviral therapy to assess pulmonary HIV reservoirs. These methods result in the acquisition of highly pure CD4 T cells and alveolar macrophages that may subsequently be used for immunophenotyping and HIV DNA/RNA quantifications by ultrasensitive polymerase chain reaction.

Processing of Bronchoalveolar Lavage Fluid and Matched Blood for Alveolar Macrophage and CD4+ T-cell Immunophenotyping and HIV Reservoir Assessment

Presented here is an optimized protocol for isolating, culturing, transfecting, and differentiating human primary monocytes from HIV-infected individuals and healthy controls.

Isolation, Transfection, and Culture of Primary Human Monocytes

Breast milk transmits human immunodeficiency virus (HIV), though only ~15% of infants breastfed by HIV-infected mothers become infected. Breastfed infants ingest ~105−108 maternal leukocytes daily, though these cells are understudied. Here we describe the isolation of breast milk leukocytes and an analysis of their phagocytic capacity.

Isolation of Leukocytes from Human Breast Milk for Use in an Antibody-dependent Cellular Phagocytosis Assay of HIV Targets

Learn bacterial DNA sequencing methods to detect translocating microflora in peripheral blood of HIV-infected patients. This technique reveals how gut microbiota influences systemic immune activation and disease progression.

Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients

Explore More Videos