Name: A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells (Video) | JoVE Journal
Uploaded: 2016-03-03T13:00:00.000+00:00
Duration: 8 min 34 s
Description: Learn a quick method to purify endodermal cells from human embryonic stem cells using magnetic bead sorting. This technique removes undifferentiated cells to obtain pure populations for developmental and regenerative research.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

The skillful technical assistance of Jasmin Kresse is gratefully acknowledged.

1. Differentiation of Human ESC towards the Definitive Endoderm
<ol>
	<li>Cultivate human embryonic stem cells (ESCs) in an incubator at 37 &#176;C and 5% CO2.</li>
	<li>Coat a new 6-well cell culture plate with 1 ml of a basement membrane matrix and incubate the culture-ware for at least 30 min at RT. For specific details please turn to the respective manufacturer&#39;s instructions.</li>
	<li>Confirm that the cultured human ESCs have reached 80%-90% confluency under the microscope using a low magnification (e.g., 4X). Aspirate the medium from the cavities by sucking off the medium with a sterile glass Pasteur pipet. Wash the cells once with phosphate buffered saline (PBS) solution. For this, add 2 ml PBS to each well softly shake the plate and suck off the solution to remove dead cells and cell debris.</li>
	<li>Add 1 ml of enzyme-free passaging solution reagent for gentle dissociation of cell clusters. Incubate the cells at 37 &#176;C and 5% CO2 until the cells show clear signs of disruption into small clusters. 
	NOTE: The incubation time depends on the reagent used. For the enzyme-free passaging solution mentioned in the materials section, incubation time is roughly 7 min.</li>
	<li>Add 1 ml DMEM/F-12 medium and disrupt the remaining cell aggregates into single cells by pipetting up and down using a 1 ml pipette tip. Use this to flush the cells from the surface and transfer the cells to a centrifugation tube. To retrieve all cells, wash each well with 1 ml of DMEM/F-12 medium and add the medium to the centrifugation tube.</li>
	<li>Centrifuge the cells for 5 min at 300 x g. Aspirate the supernatant and resuspend the cells in 5 ml ES cell culture medium containing 10 &#181;M Rho-Kinase (ROCK) inhibitor.</li>
	<li>Count the cells under the microscope using a hemocytometer and seed 150,000 - 400,000 cells per 6-well or in another plate layout, depending on the ES cell line used. Use culture medium containing 10 &#181;M ROCK inhibitor to avoid apoptosis and culture the cells in an incubator at 37 &#176;C and 5% CO2.</li>
	<li>Approximately 24 hr after seeding aspirate the medium with a sterile glass Pasteur pipet and add 2 ml of primitive streak induction medium. 
	NOTE: This medium contains final concentrations of 1% glutamine, 0.2% FCS, 5 &#181;M CHIR-99021 and 50 ng/ml activin A in Advanced RPMI-1640 medium. Commonly, use 2 ml of medium for cultivation in 6-well plates.</li>
	<li>48 hr after seeding, replace the medium to endoderm induction medium. Cultivate the cells in this medium for another 48 hr with daily medium change. 
	NOTE: This medium contains 1% glutamine, 0.2% FCS and 50 ng/ml activin A in Advanced RPMI-1640 medium. Cells that are committed towards the definitive endoderm express the surface marker CXCR4. The staining of CXCR4 can be used to quantify the number of DE-committed cells.</li>
</ol>
2. Staining of CXCR4+ Definitive Endoderm Cells for Flow Cytometry Analysis
<ol>
	<li>For the final 24 hr but at least 1 hr before harvesting the cells add 10 &#181;M ROCK inhibitor to the culture medium.</li>
	<li>Coat the cell culture-ware that will be used for re-seeding with a basement membrane matrix, i.e., 12-well plates for qPCR analysis or chamber slides for immunofluorescence staining. Incubate the plates or slides for at least 30 min at RT.</li>
	<li>Aspirate the medium with a sterile glass Pasteur pipet from the wells of the differentiated cells used for staining and/or sorting.</li>
	<li>Add 1 ml of enzyme-free passaging solution reagent for the gentle dissociation of cell clusters. Incubate the cells at 37 &#176;C and 5% CO2 until the cells show clear signs of disruption into small clusters. 
	NOTE: The incubation time depends on the reagent used. For the enzyme-free passaging solution mentioned in the materials section, incubation time is roughly 7 min.</li>
	<li>Add 1 ml DMEM/F-12 medium and disrupt remaining cell aggregates into single cells by pipetting up and down using a 1 ml tip. Use this to flush the cells from the surface and transfer the cells to a centrifugation tube. To retrieve all cells, wash each well with 1 ml of DMEM/F-12 medium w/o FCS and add the medium to the centrifugation tube.</li>
	<li>Count the cells under the microscope using a hemocytometer. Cells from three wells of a 6-well plate should result in 10-15 x 106 cells after three days of differentiation. Centrifuge the cells for 5 min at 300 x g. 
	NOTE: The exact number of obtained cells will depend on the pluripotent cell line used for the differentiation.</li>
	<li>Aspirate the supernatant and resuspend the cells in PEB buffer containing 10 &#181;M ROCK inhibitor. Use 100 &#181;l of this buffer for up to 107 cells. Add the 10 &#181;M ROCK inhibitor on the day of staining. Use this buffer for all downstream applications (referred to as PEB buffer + RI). 
	NOTE: PEB buffer contains 0.5% BSA and 2 mM EDTA in PBS. If more cells are to be stained, adjust the buffer volume accordingly.</li>
	<li>Add 10 &#181;l of a CXCR4-APC antibody per 107 cells in 100 &#181;l, this roughly represents a dilution of 1:10. 
	NOTE: The usage of an APC-linked antibody is not mandatory. Instead it can be substituted depending on the microbeads used. If more cells are to be stained adjust the antibody volume accordingly.</li>
	<li>Mix by gently flipping the tube with the fingers and incubate at 4 &#176;C in a refrigerator for 15 min. Resuspend the cells with 1-2 ml PEB buffer. Centrifuge the cells for 5 min at 300 x g.</li>
	<li>Aspirate the supernatant with a sterile glass Pasteur pipet and resuspend the cell pellet in 80 &#181;l PEB per 107 cells and add 20 &#181;l anti-APC microbeads. 
	NOTE: If more cells are to be stained, adjust the micro-bead volume accordingly.</li>
	<li>Mix by gently flipping the tube with the fingers and incubate at 4 &#176;C in a refrigerator for 15 min. Resuspend the cells with 1-2 ml PEB buffer + RI. Centrifuge the cells for 5 min at 300 x g. Aspirate the buffer. Resuspend in 500 &#181;l PEB buffer + RI.</li>
</ol>
3. Magnetic Separation of CXCR4+ Cells
<ol>
	<li>Place a medium sized magnetic column in a magnetic field as per manufacture instructions. Pre-rinse the column with 500 &#181;l PEB buffer +RI. Apply the entire cell suspension to the column. Collect the flow through as not all cells will bind to the column. Make sure not to disturb the columns for optimal retrieval of CXCR4+ cells.</li>
	<li>Wash the column three times with 500 &#181;l PEB buffer + RI. Collect the first flow through and combine it with the collected cells from Step 3.1. Remove the magnetic column from the magnetic field and place it in a suitable collection tube. Add 1 ml PEB buffer + RI onto the column. To elute the cells firmly press down the plunger into the column.</li>
	<li>Optional: Collect all flow through samples separately and use 20 &#181;l each to analyze the number of CXCR4+ cells using flow cytometry. Their number should decline with every washing step. 
	NOTE: At least 2 x 104 viable, gated cells should be counted for reliable results.</li>
	<li>Repeat Steps 3.1-3.3 with the collected-flow through sample from Step 3.1 and the first flow through sample from step 3.2 using a new column. Do not re-use the previous column. By using the plunger air is pressed into the column, which blocks it.</li>
	<li>Count the cells under the microscope using a hemocytometer. Depending on the efficiency of the differentiation up to 6 x 106 cells can be sorted initially and another 1 x 106 cells by using a second column when using 107 cells for the procedure.</li>
	<li>Centrifuge the cells at 300 x g for 5 min. Aspirate the supernatant and with a sterile glass Pasteur pipet and resuspend the cells in 1 ml endoderm induction medium from Step 1.9 with additional 10 &#181;M ROCK inhibitor.</li>
	<li>Count the cells under the microscope using a hemocytometer. Seed the cells at an appropriate density, i.e., ~ 4 x 105 cells per well of a 12-well plate (app. 3.6 cm2 surface) or ~ 1.5 x 105 cells per well of an 8-well chamber-slide.</li>
</ol>
4. Optional: Analysis of Purified Definitive Endoderm Population
<ol>
	<li>For immunofluorescence staining fix the purified cells from Step 3.7 roughly 24 hr after seeding with 4% paraformaldehyde and stain for definitive endoderm (DE) and/or pluripotency marker proteins. 
	NOTE: Commonly used DE markers include FOXA2 and SOX17, commonly used pluripotency markers include OCT3/4, NANOG and SOX26, 8.</li>
	<li>For RT-qPCR analysis, harvest the purified cells directly or 24 hr after seeding, extract total-RNA and reverse transcribe cDNA from the extracted total-RNA samples. Use 10 ng cDNA as template per RT-qPCR reaction (triplicates) to analyze the expression of DE and pluripotency marker genes6, 8. 
	NOTE: Commonly used marker genes are mentioned in Step 4.1. Cycle conditions are 5 min at 95 &#176;C and 40 cycles of 15 sec at 95 &#176;C and 1 min at 60 &#176;C, followed by melting curve analysis.</li>
</ol>

<ol><li>Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Derivation+of+Highly+Purified+Cardiomyocytes+from+Human+Induced+Pluripotent+Stem+Cells+Using+Small+Molecule-modulated+Differentiation+and+Subsequent+Glucose+Starvation%5BTitle%5D)+AND+%22J+Vis+Exp%22%5BJournal%5D)">Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation.</a> J Vis Exp. (97), (2015).</li>
<li>Sgodda, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Improved+hepatic+differentiation+strategies+for+human+induced+pluripotent+stem+cells%5BTitle%5D)+AND+%22Curr+Mol+Med%22%5BJournal%5D)">Improved hepatic differentiation strategies for human induced pluripotent stem cells.</a> Curr Mol Med. 13 (5), 842-855 (2013).</li>
<li>Naujok, O., Burns, C., Jones, P. M., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Insulin-producing+surrogate+beta-cells+from+embryonic+stem+cells%3A+are+we+there+yet%5BTitle%5D)+AND+%22Mol+Ther%22%5BJournal%5D)">Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet.</a> Mol Ther. 19 (10), 1759-1768 (2011).</li>
<li>Katsirntaki, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Bronchoalveolar+sublineage+specification+of+pluripotent+stem+cells%3A+effect+of+dexamethasone+plus+cAMP-elevating+agents+and+keratinocyte+growth+factor%5BTitle%5D)+AND+%22Tissue+Eng+Part+A%22%5BJournal%5D)">Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor.</a> Tissue Eng Part A. 21 (3-4), 669-682 (2015).</li>
<li>Abranches, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Neural+differentiation+of+embryonic+stem+cells+in+vitro%3A+a+road+map+to+neurogenesis+in+the+embryo%5BTitle%5D)+AND+%22PLoS+One%22%5BJournal%5D)">Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo.</a> PLoS One. 4 (7), e6286(2009).</li>
<li>Naujok, O., Diekmann, U., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+generation+of+definitive+endoderm+from+human+embryonic+stem+cells+is+initially+independent+from+activin+A+but+requires+canonical+Wnt-signaling%5BTitle%5D)+AND+%22Stem+Cell+Rev%22%5BJournal%5D)">The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling.</a> Stem Cell Rev. 10 (4), 480-493 (2014).</li>
<li>D'Amour, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Production+of+pancreatic+hormone-expressing+endocrine+cells+from+human+embryonic+stem+cells%5BTitle%5D)+AND+%22Nat+Biotechnol%22%5BJournal%5D)">Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells.</a> Nat Biotechnol. 24 (11), 1392-1401 (2006).</li>
<li>Diekmann, U., Lenzen, S., Naujok, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+reliable+and+efficient+protocol+for+human+pluripotent+stem+cell+differentiation+into+the+definitive+endoderm+based+on+dispersed+single+cells%5BTitle%5D)+AND+%22Stem+Cells+Dev%22%5BJournal%5D)">A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells.</a> Stem Cells Dev. 24 (2), 190-204 (2015).</li>
<li>Kim, P. T., Ong, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Differentiation+of+definitive+endoderm+from+mouse+embryonic+stem+cells%5BTitle%5D)+AND+%22Results+Probl+Cell+Differ%22%5BJournal%5D)">Differentiation of definitive endoderm from mouse embryonic stem cells.</a> Results Probl Cell Differ. 55, 303-319 (2012).</li>
<li>Katoh, M., Katoh, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Integrative+genomic+analyses+of+CXCR4%3A+transcriptional+regulation+of+CXCR4+based+on+TGFbeta%2C+Nodal%2C+Activin+signaling+and+POU5F1%2C+FOXA2%2C+FOXC2%2C+FOXH1%2C+SOX17%2C+and+GFI1+transcription+factors%5BTitle%5D)+AND+%22Int+J+Oncol%22%5BJournal%5D)">Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors.</a> Int J Oncol. 36 (2), 415-420 (2010).</li>
<li>Nostro, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Stage-specific+signaling+through+TGFbeta+family+members+and+WNT+regulates+patterning+and+pancreatic+specification+of+human+pluripotent+stem+cells%5BTitle%5D)+AND+%22Development%22%5BJournal%5D)">Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells.</a> Development. 138 (5), 861-871 (2011).</li>
<li>Rezania, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Maturation+of+human+embryonic+stem+cell-derived+pancreatic+progenitors+into+functional+islets+capable+of+treating+pre-existing+diabetes+in+mice%5BTitle%5D)+AND+%22Diabetes%22%5BJournal%5D)">Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice.</a> Diabetes. 61 (8), 2016-2029 (2012).</li>
<li>Bruin, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Maturation+and+function+of+human+embryonic+stem+cell-derived+pancreatic+progenitors+in+macroencapsulation+devices+following+transplant+into+mice%5BTitle%5D)+AND+%22Diabetologia%22%5BJournal%5D)">Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice.</a> Diabetologia. 56 (9), 1987-1998 (2013).</li>
<li>Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Residual+undifferentiated+cells+during+differentiation+of+induced+pluripotent+stem+cells+in+vitro+and+in+vivo%5BTitle%5D)+AND+%22Stem+Cells+Dev%22%5BJournal%5D)">Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo.</a> Stem Cells Dev. 21 (4), 521-529 (2012).</li>
<li>Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Teratoma+formation+by+human+embryonic+stem+cells%3A+evaluation+of+essential+parameters+for+future+safety+studies%5BTitle%5D)+AND+%22Stem+Cell+Res%22%5BJournal%5D)">Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies.</a> Stem Cell Res. 2 (3), 198-210 (2009).</li>
<li>Herberts, C. A., Kwa, M. S., Hermsen, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Risk+factors+in+the+development+of+stem+cell+therapy%5BTitle%5D)+AND+%22J+Transl+Med%22%5BJournal%5D)">Risk factors in the development of stem cell therapy.</a> J Transl Med. 9, 29(2011).</li>
<li>Naujok, O., Kaldrack, J., Taivankhuu, T., Jörns, A., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Selective+removal+of+undifferentiated+embryonic+stem+cells+from+differentiation+cultures+through+HSV1+thymidine+kinase+and+ganciclovir+treatment%5BTitle%5D)+AND+%22Stem+Cell+Rev%22%5BJournal%5D)">Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment.</a> Stem Cell Rev. 6 (3), 450-461 (2010).</li>
<li>Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+new+FACS+approach+isolates+hESC+derived+endoderm+using+transcription+factors%5BTitle%5D)+AND+%22PLoS+One%22%5BJournal%5D)">A new FACS approach isolates hESC derived endoderm using transcription factors.</a> PLoS One. 6 (3), 17536(2011).</li>
</ol>

The authors declare that they have no competing financial interests.

Currently used differentiation protocols rarely result in 100% differentiated cells. For reasons that still have to be addressed some cells resist the differentiation process. Depending on the efficiency of the used differentiation protocol and the propensity of the ESC line a certain number of residual pluripotent cells are commonly observed even after differentiation into the definitive endoderm. These residual cells may impair downstream differentiations or further analysis such as transcriptomics, proteomics, and miR...

Pluripotent stem cells such as embryonic stem cells (ESCs) have the capability to differentiate into virtually any cell type of the human body. Thus, in vitro differentiation protocols can be used to generate numerous adult cell types such as cardiomyocytes1, hepatocytes2, beta cells3, lung epithelial4 or neuronal cells5. This makes ESCs a valuable tool for the potential treatment of various degenerative diseases3.
The in vitro differentiation of ESCs towards adult tissues of the lung, liver and pancreas requires a pseudo-gastrulation into cells reminiscent of the definitive endoderm (DE)6. Since downstream differentiation towards the aforementioned somatic cell types is significantly less efficient, an optimal endoderm differentiation is regarded as rate-limiting7. Cells that are committed towards the endoderm lineage undergo characteristic changes in their gene expression profile. Pluripotency master regulator genes are down regulated, whereas the expression of other transcription factors such as FOXA2, SOX17, HNF1B, members of the GATA family and the surface receptor CXCR4 is highly upregulated6, 8, 9. CXCR4 is known to be transactivated by SMAD2/3, downstream of Nodal/TGF-&#946; signaling and SOX17 due to specific binding sites in its promoter region10. Thus it is a very suitable marker used in a number of reports6, 8, 11-13. These expression changes reflects a pseudo-gastrulation event, in which ESCs first acquire characteristics of a primitive streak-like cell population and subsequently commit into the endoderm germ layer6.
However, differentiation protocols are rarely 100% efficient as a few cells may resist the differentiation process or differentiate towards other unintended lineages14. These cells may negatively influence further differentiation. Furthermore, residual undifferentiated cells harbor great risks for later transplantation experiments and may give rise to teratomas15-17.
To remove these unwanted cells early-on the surface marker CXCR4 can be used for the purification of cells that are committed towards the DE18. Here, we describe a method for the positive selection of CXCR4+ cells from DE differentiation cultures. For this, the surface marker CXCR4 is bound by an antibody which then in turn binds to magnetic microbeads. Unlike the harsh conditions during FACS sorting, the magnetically labeled DE-like cells can then easily be purified in a benchtop format using a gentle purification method. This protocol provides a straightforward method for the removal of cell populations that resisted the DE differentiation process.

<table><tbody><tr><td>Hues8 human embryonic stem cell line</td><td>Harvard Department of stem cell &amp;amp; regenerative biology</td><td></td><td>Suitable cell line for endoderm generation</td></tr><tr><td>Hes3 human embryonic stem cell line</td><td>ES Cell International</td><td></td><td>Suitable and robust cell line for endoderm generation</td></tr><tr><td>mTeSR1</td><td>Stemcell Technologies</td><td>5850</td><td>ESC culture medium</td></tr><tr><td>FCS</td><td>Biowest</td><td>S1860</td><td></td></tr><tr><td>Advanced RPMI 1640</td><td>Life Technologies</td><td>12633012</td><td></td></tr><tr><td>CD184 (CXCR4)-APC, human</td><td>Miltenyi Biotec</td><td>130-098-357</td><td></td></tr><tr><td>anti-APC MicroBeads</td><td>Miltenyi Biotec</td><td>130-090-855&amp;nbsp;</td><td></td></tr><tr><td>OctoMACS Separator</td><td>Miltenyi Biotec</td><td>130-042-109</td><td>magnetic field</td></tr><tr><td>Y-27632</td><td>Selleck Chemicals</td><td>S1049</td><td>ROCK inhibitor</td></tr><tr><td>CHIR-99021</td><td>Tocris Bioscience</td><td>4423</td><td></td></tr><tr><td>Activin A</td><td>Peprotech</td><td>120-14</td><td></td></tr><tr><td>Gentle Cell Dissociation Reagent</td><td>Stemcell Technologies</td><td>7174</td><td>Enzyme-free passaging solution, alternative: Trypsin/EDTA</td></tr><tr><td>Matrigel*</td><td>Corning</td><td>354277</td><td>basement membrane matrix&lt;br/&gt; * solve and store in aliquots at -80 &amp;deg;C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12.&lt;br/&gt; Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature.&lt;br/&gt; Remove the matrigel and use immediately. </td></tr><tr><td>MS Columns</td><td>Miltenyi Biotec</td><td>30-042-201</td><td></td></tr><tr><td>MACS Separator</td><td>Miltenyi Biotec</td><td>130-042-302</td><td></td></tr><tr><td>Human FOXA2 FW&lt;br/&gt;gggagcggtgaagatgga</td><td>Life Technologies</td><td>NA</td><td></td></tr><tr><td>Human FOXA2 REV&lt;br/&gt;tcatgttgctcacggaggagta</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human GSC FW&lt;br/&gt;gaggagaaagtggaggtctggtt</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human GSC REV&lt;br/&gt;ctctgatgaggaccgcttctg</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>SOX17 TaqMan assay</td><td>Applied Biosystems</td><td>Hs00751752_s1</td><td></td></tr><tr><td>Human SOX7 FW&lt;br/&gt;gatgctgggaaagtcgtggaagg</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human SOX7 REV&lt;br/&gt;tgcgcggccggtacttgtag</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human POU5F1 FW&lt;br/&gt;cttgctgcagaagtgggtggagg</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human POU5F1 REV&lt;br/&gt;ctgcagtgtgggtttcgggca</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human Nanog FW&lt;br/&gt;ccgagggcagacatcatcc</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human Nanog REV&lt;br/&gt;ccatccactgccacatcttct</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human TBP FW&lt;br/&gt;caa cag cct gcc acc tta cgc tc</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human TBP REV&lt;br/&gt;agg ctg tgg ggt cag tcc agt g</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human TUBA1A FW&lt;br/&gt;ggc agt gtt tgt aga ctt gga acc c</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human TUBA1A REV&lt;br/&gt;tgt gat aag ttg ctc agg gtg gaa g</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human G6PD FW&lt;br/&gt;agg ccg tca cca aga aca ttc a</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human G6PD REV&lt;br/&gt;cga tga tgc ggt tcc agc cta t </td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Anti-SOX2</td><td>Santa Cruz Biotechnology</td><td>sc-17320</td><td></td></tr><tr><td>Anti-FOXA2</td><td>MerckMillipore</td><td>07-633</td><td></td></tr><tr><td>Anti-SOX17</td><td>R&amp;amp;D Systems</td><td>AF1924</td><td></td></tr></tbody></table>

a quick and efficient method for the purification of endoderm cells generated from human embryonic stem cells

A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells

The differentiation capabilities of pluripotent stem cells such as embryonic stem cells (ESCs) allow a potential therapeutic application for cell replacement therapies. Terminally differentiated cell types could be used for the treatment of various degenerative diseases. In vitro differentiation of these cells towards tissues of the lung, liver and pancreas requires as a first step the generation of definitive endodermal cells. This step is rate-limiting for further differentiation towards terminally matured cell types such as insulin-producing beta cells, hepatocytes or other endoderm-derived cell types. Cells that are committed towards the endoderm lineage highly express a multitude of transcription factors such as FOXA2, SOX17, HNF1B, members of the GATA family, and the surface receptor CXCR4. However, differentiation protocols are rarely 100% efficient. Here, we describe a method for the purification of a CXCR4+ cell population after differentiation into the DE by using magnetic microbeads. This purification additionally removes cells of unwanted lineages. The gentle purification method is quick and reliable and might be used to improve downstream applications and differentiations.

Upon differentiation ESCs undergo drastic changes in gene and protein expression. Figure 1 depicts typical marker genes that can be used to verify a successful endoderm differentiation. Prime targets for a gene expression analysis are GSC, FOXA2, and SOX17. In a relative gene expression analysis especially FOXA2 and SOX17 are increased by &gt; 2,000 fold when compared to undifferentiated ESCs. GSC is a...

Here, we describe a method for the purification of differentiated human embryonic stem cells that are committed towards the definitive endoderm for the improvement of downstream applications and further differentiations.

The differentiation capabilities of pluripotent stem cells such as embryonic stem cells (ESCs) allow a potential therapeutic application for cell ...

The overall goal of this method is to purify endodermal cells generated from human embryonic stem or ES cells. This method can help answer key questions in the stem cell field about endodermal differentiation. The main advantage of this technique is that a pure endoderm cell population can be obtained after the removal of undifferentiated cells.Before beginning the procedure, coat six well cell culture plates with one milliliter of basement membrane matrix per well. For at least 30 minutes at room temperature. Then, to harvest the human ES cells, aspirate the medium from an 80 to 90%confluent human embryonic stem cell culture with a sterile glass Pasture pipette.And wash the cells with two milliliters of PBS per well. Shaking the plate and aspirating the saline to remove the dead cells and debris. Next, gently dissociate the cell clusters with one milliliter of enzyme-free passaging solution reagent, at 37 degrees Celsius and 5%carbon dioxide until the cells exhibit clear signs of disruption into smaller clusters.After about seven minutes, add one milliliter of DMMF12 medium to the wells. And pipette up and down a few times with a one milliliter pipette tip to detach the remaining cell aggregates into a single cell suspension. Using the same pipette, transfer the cells into a centrifugation tube and rinse the wells with one milliliter of fresh DMMF12 medium, pooling the washes in the tube.After spinning down the cells, re-suspend the pellet in five milliliters of ES cell culture medium supplemented with ROCK inhibitor. Count the cells and seed 1.5:4 times 10 to the fifth cells per well on the basement membrane matrix coated plates in culture medium supplemented with ROCK inhibitor to prevent apoptosis. Incubate the cells for approximately 24 hours.And then use a sterile, glass Pasteur pipette to replace the medium in each well with 2 milliliters of primitive streak induction medium. After 24 more hours of culture, replace the medium with endoderm induction medium for a 48 hour incubation with daily medium changes. On the last day of culture and at least one hour before harvesting the cells, add fresh ROCK inhibitor to the culture medium.Then use a sterile, glass Pasteur pipette to aspirate the medium from each of the wells and dissociate the cells with enzyme-free passaging solution reagent as just demonstrated. When a single-cell suspension has been achieved, count the cells and centrifuge them. Make sure that from this point on, all medium and buffers contain the ROCK inhibitor to prevent the cells from dying.Otherwise, they will not be attached properly after receding. Re-suspend the pellet in 100 microliters of PEB buffer, supplemented with ROCK inhibitor per 1 times 10 to the seventh cells. Then add CXCR4 APC antibody to the cells.Gently flicking the tube to mix. After 15 minutes at 4 degrees Celsius, wash the cells in one to two milliliters of PEB buffer and use a sterile, glass Pasteur pipette to aspirate the supernatant. Re-suspend the pellet in 80 microliters of PEB buffer per 1 times 10 to the seventh cells and add 20 microliters of anti-APC microbeads to the cells.Mix the sample with gentle flicking. Then incubate the cells at four degrees Celsius for 15 minutes. At the end of the incubation, wash the cells with one to two milliliters of PEB buffer supplemented with ROCK inhibitor.And re-suspend the pellet in 500 microliters of fresh PEB buffer plus inhibitor. To isolate the CXCR4+cells by magnetic bead separation, load a medium sized magnetic column onto an appropriately sized magnet and pre-rinse the column with 500 microliters PEB buffer plus ROCK inhibitor. When all of the wash has drained from the top of the column, apply the entire magnetic bead labeled cell volume to the column, collecting the flow through in a conical tube.Wash the column with three applications of 500 microliters of PEB buffer plus ROCK inhibitor. Then transfer the column from the magnet into a suitable collection tube. And plunge one milliliter of PEB buffer plus ROCK inhibitor through the column to collect the CXCR4+cells.Optionally, all of the flow through samples can be collected separately and 20 microliter aliquots from each sample can be used to determine the percentage of CXCR4+cells in each alouette by flow cytometry. This procedure can be repeated with the first flow through to collect cells that did not bind to the column. Then pool both allouted CXCR4+samples and centrifuge them.Finally, re-suspend the pellet in one milliliter of endoderm induction medium supplemented with ROCK inhibitor And seed the cells at the appropriate density in a basement membrane matrix coated cell culture container. Prior to their differentiation, human ES cells express high levels of the pluripotency marker SOX2. Whereas, the definitive endoderm marker, FOXA2 is not detected.Upon differentiation, the ES cells undergo drastic changes in their gene and protein expression. Indeed, after four days in differentiation medium, SOX17 and FOXA2 are co-expressed uniformly within the nuclei of many of the former ES cells, a hallmark of definitive endoderm commitment. Some cells resist the differentiation process, expressing neither of the two marker proteins.And in fact, retain their pluripotency marker SOX2 expression. In this representative experiment, on day three of differentiation, nearly 60%of the harvested ES cells expressed CXCR4, the purity of which was enriched to over 85%after magnetic bead sorting of the pluripotent and other unwanted lineage cells. After seeding the purified CXCR4+cells, only a few SOX2+cells are detected, with the majority of the seeded cells expressing FOXA2.Once mastered, this technique can be completed within two hours, if performed properly. Following this procedure, other like immune histochemistry or QPCR can be performed to answer additional questions about the differentiation process. After watching this video, you should have a good understanding of how to purify endoderm cells by magnetic bead sorting.

a-quick-efficient-method-for-purification-endoderm-cells-generated

Research

JoVE Journal

Developmental Biology

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of the body suggests that they hold great promise for both medical applications and as a research tool for addressing fundamental questions in development and disease. Here, we provide a concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos by immunosurgical isolation of the inner cell mass.

Derivation of Human Embryonic Stem Cells by Immunosurgery

This article will focus on the generation of human hepatic endoderm from human embryonic stem cell populations.

Robust Generation of Hepatocyte-like Cells from Human Embryonic Stem Cell Populations

Despite ongoing efforts to transition cultures to feeder-free conditions, the derivation and culture of human embryonic stem cells (hESC) remain largely dependent on co-cultures with mouse embryonic feeders (MEFs).  Here, we show a novel methodology for rapidly removing feeders from hESC cultures prior to experimentation.

Rapid Fibroblast Removal from High Density Human Embryonic Stem Cell Cultures

We describe the use of the monoclonal antibodies TG30 (CD9) and GCTM-2 for the combined detection of cell surface antigens via fluorescence activated cell sorting (FACS) for the identification and enrichment of live human embryonic stem cells (hESC) using positive selection and also the use of negative selection to purge hESCs from a mixed cell population.

Enrichment and Purging of Human Embryonic Stem Cells by Detection of Cell Surface Antigens Using the Monoclonal Antibodies TG30 and GCTM-2

This protocol efficiently directs mouse embryonic stem cell-derived definitive endoderm to mature airway epithelial cells. This differentiation technique uses 3-dimensional decellularized lung scaffolds to direct lung lineage specification, in a defined, serum-free culture setting.

Generation of ESC-derived Mouse Airway Epithelial Cells Using Decellularized Lung Scaffolds

Human pluripotent stem cells (hPSCs) have the intrinsic ability to differentiate and self-organize into distinct tissue patterns; although this requires the presentation of spatial environmental gradients. We present stencil micropatterning as a simple and robust method to generate biochemical and mechanical gradients for controlling hPSC differentiation patterns.

Stencil Micropatterning of Human Pluripotent Stem Cells for Probing Spatial Organization of Differentiation Fates

Presented here is a protocol for the generation of a single-cell culture of human embryonic stem cells and their subsequent differentiation into neural progenitor cells. The protocol is simple, robust, scalable, and suitable for drug screening and regenerative medicine applications.

Efficient Neural Differentiation using Single-Cell Culture of Human Embryonic Stem Cells

This manuscript describes a detailed protocol for differentiation of human embryonic stem cells (hESCs) into functional hepatocyte-like cells (HLCs) by continuously supplementing Activin A and CHIR99021 during hESC differentiation into definitive endoderm (DE).

An Efficient Method for Directed Hepatocyte-Like Cell Induction from Human Embryonic Stem Cells

To avoid the limitations associated with the enzymatic or mechanical passaging of human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs) cultured on feeder cells, we have established a fast, effective, cost-efficient, high-yield method for harvesting hESC or hiPSC colonies maintained on a feeder cell layer of human foreskin fibroblasts using EDTA-mediated dis-adhesion.

Rapid, Cost-Efficient, Enzyme-Free Passaging of Human Pluripotent Stem Cells on Feeder Cells by Ethylenediaminetetraacetic Acid-Mediated Dis-Adhesion

The present protocol shows how to differentiate CD3−/CD45+CD56+ cells with mild cytotoxicity from human expanded potential stem cells (hEPSCs) under both 3D and 2D culture conditions. This allows for routine phenotypical validation without the destruction of the complex microenvironment.

Generation of Natural Killer Cells from Human Expanded Potential Stem Cells

This protocol describes the generation of fast and reproducible endodermal hepatic organoids (eHEPOs). With this protocol, eHEPOs can be produced within 2 weeks and expand long-term (more than 1 year) without losing their differentiation and functionality.

Generation of Functional Endodermal Hepatic Organoids

Learn a quick method to purify endodermal cells from human embryonic stem cells using magnetic bead sorting. This technique removes undifferentiated cells to obtain pure populations for developmental and regenerative research.

A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells

Explore More Videos