Name: Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes (Video) | JoVE Journal
Uploaded: 2016-10-31T15:00:00.000+00:00
Duration: 9 min 11 s
Description: Learn techniques for imaging prometaphase and metaphase of meiosis I in fixed Drosophila oocytes. This protocol enables visualization of spindle assembly and chromosome orientation using immunofluorescence.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

We thank Christian Lehner for providing the CENP-C antibody and Eric Joyce for recommendations on FISH. Work in the McKim lab was funded by a grant from NIH (GM101955).

Note: Procedures are performed at room temperature unless otherwise noted. Temperature-controlled incubators are used to maintain temperatures for fly rearing and crosses unless otherwise noted.
1. Preparations
<ol>
	<li>Prepare Flies.
	<ol>
		<li>Prometaphase-enriched oocyte collections.
		<ol>
			<li>Clear adult flies from healthy, young stock or cross cultures. Age bottles for two days at 25 &#176;C. 
			&#8203;NOTE: Generally two healthy bottles will suffice, although more may be needed for some cross cultures.</li>
			<li>After two days, collect ~100 to 300 females (who are 0 to 2 days old at this point) from the bottles. The females do not need to be virgins. Add a dab of yeast paste to the side of a vial and place 30 females and 10 to 15 males each into the yeasted vials. Age vials for two days at 25 &#176;C.</li>
		</ol>
		</li>
		<li>Metaphase-enriched Oocyte Collections.
		<ol>
			<li>Collect ~100 to 300 females from stock or cross cultures. Add a dab of yeast paste to the side of a vial and place 30 females each (with no males added) into the yeasted vials. Age vials for three to five days at 25 &#176;C.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Prepare Solutions. 
	&#8203;Note: Solutions may be stored indefinitely at room temperature, unless otherwise noted.
	<ol>
		<li>Prepare Modified Robb&#39;s Buffer (5x): 500 mM HEPES, 500 mM sucrose, 275 mM sodium acetate, 200 mM potassium acetate, 50 mM glucose, 6 mM magnesium chloride, and 5 mM calcium chloride. Use 10 N 11:8 sodium hydroxide:potassium hydroxide to bring pH to 7.4. Sterilize by filtration; do not autoclave. Store at -20 &#176;C. Thaw as needed to prepare ~200 ml of 1x Robb&#39;s per oocyte prep.</li>
		<li>Fixation Solutions.
		<ol>
			<li>Option #1: Prepare formaldehyde/heptane fixation. Prepare Fixation Buffer: 1x phosphate-buffered saline (PBS) plus 150 mM sucrose. To use, make fresh with 687.5 &#181;l Fixation Buffer and 312.5 &#181;l 16% formaldehyde per oocyte prep. 
			CAUTION: Wear gloves while using formaldehyde solutions in a fume hood. Dispose of waste according to institutional guidelines.</li>
			<li>Option #2: Prepare formaldehyde/cacodylate fixation. Prepare Fix Mix: 250 mM sucrose, 100 mM potassium acetate (pH 7.5), 25 mM sodium acetate (pH 7.0), and 25 mM EGTA (pH 8.0). To use, make fresh with 400 &#181;l Fix Mix, 100 &#181;l potassium cacodylate (1 M, pH 7.2), and 500 &#181;l 16% formaldehyde per oocyte prep. 
			&#8203;CAUTION: Potassium cacodylate contains Arsenic.</li>
		</ol>
		</li>
		<li>Prepare PBS/Triton X-100: 1x PBS plus 1% or 0.05% Triton X-100. Store at 4 &#176;C.</li>
		<li>Prepare PBS-Tween 20-Bovine Serum Albumin (BSA) (PTB): 1x PBS, 0.5% BSA (w/v), and 0.1% Tween-20. May be stored at 4 &#176;C for one week.</li>
		<li>Fluorescence In Situ Hybridization (FISH) Solutions.
		<ol>
			<li>Prepare 20X Sodium chloride-Sodium Citrate (SSC): 3 M sodium chloride and 0.3 M sodium citrate.</li>
			<li>Prepare 2x SSC-Tween-20 (SSCT): 2x SSC plus 0.1% Tween-20. Make fresh, ~20 ml per oocyte prep.</li>
			<li>Prepare formamide solutions: 2x SSC, 0.1% Tween-20, plus formamide. Make fresh, 1 ml 20% formamide, 0.5 ml 40% formamide, and 2 ml 50% formamide per oocyte prep. 
			CAUTION: Wear gloves while using formamide solutions in a fume hood. Dispose of waste according to institutional guidelines.</li>
			<li>Prepare hybridization solution: 2x SSC, 50% formamide, and 10% dextran sulfate (w/v). Store at 4 &#176;C.</li>
		</ol>
		</li>
		<li>FISH Probes.
		<ol>
			<li>Order oligonucleotides (see Table 1 for sequences) with HPLC purification and desired 5&#39; fluorescent modification (e.g., Cy3 or Cy5). Resuspend in Tris-EDTA (TE) at 50 ng/&#181;l. 
			&#8203;NOTE: Protect oligos from light exposure at all times.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>
2. Collection of Late-stage Drosophila Oocytes
<ol>
	<li>As Drosophila oocytes with membranes intact will stick to plastic and glass, pre-coat the inside of one 5 ml tube and one Pasteur pipet per oocyte prep with PTB.</li>
	<li>Anesthetize all ~100 to 300 yeasted flies with carbon dioxide and add to a blender containing ~100 ml 1x Robb&#39;s Buffer. Pulse three times (~1 sec each). Keep oocytes in Robb&#39;s for &#60;20 min to avoid activation. 
	NOTE: Alternatively, oocytes may be hand-dissected from females. The advantage of this method is that it requires less females. However, care must be taken to limit exposure to carbon dioxide to only a few minutes to avoid artifacts associated with hypoxia7.</li>
	<li>Filter through large mesh (~1,500 &#181;m) into 250 ml beaker to remove large body parts. If many intact abdomens remain on mesh, re-grind material using additional Robb&#39;s Buffer, and filter again. Let settle ~2 min, then aspirate off top layer, removing as many of the large body parts as possible.</li>
	<li>Filter through small mesh (~300 &#181;m) into a 250 ml beaker. Rinse remaining oocytes out of first beaker using additional Robb&#39;s and coated Pasteur pipet. Let settle ~3 min; oocytes will settle out. Aspirate off all but ~10 ml.</li>
	<li>Pour as much of the 10 ml as will fit into coated 5 ml tube. Let settle, remove liquid, and repeat with remainder. Rinse remaining oocytes out of beaker using additional Robb&#39;s and coated Pasteur pipet. Let settle in 5 ml tube for ~3-5 min.</li>
</ol>
3. Drug Treatments (Optional)
<ol>
	<li>Coat a second 5 ml tube with PTB for each oocyte prep. Add appropriate solvent (control) or drug to 1 ml Robb&#39;s each for each oocyte prep (Table 2).</li>
	<li>Split oocytes into second coated 5 ml tube. Let settle, remove liquid, and add 1 ml Robb&#39;s plus solvent into one tube and 1 ml Robb&#39;s plus drug into second tube. Nutate for appropriate amount of time for drug treatment (Table 2). Let settle.</li>
</ol>
4. Fixation
<ol>
	<li>Aspirate off all liquid and immediately add 1 ml Fix.</li>
	<li>Option #1: Formaldehyde/heptane fixation (Fixation Buffer plus 5% formaldehyde).
	<ol>
		<li>Fix for 2.5 min on a nutator. Add 1 ml heptane and vortex 1 min. Let settle ~1 min.</li>
		<li>Remove all liquid, and then add 1 ml 1x PBS. Vortex 30 sec. Let settle ~1 min.</li>
		<li>Remove all liquid, and then fill tube with 1x PBS. 
		NOTE: Oocytes may be used immediately or kept on the nutator for several hours at room temperature.</li>
	</ol>
	</li>
	<li>Option #2: Formaldehyde/cacodylate fixation (Fix Mix plus 8% formaldehyde and 100 mM cacodylate).
	<ol>
		<li>Fix for 6 min on a nutator. Let settle 2 min. Remove liquid, and then fill tube with 1x PBS. 
		&#8203;NOTE: Oocytes may be used immediately or kept on the nutator for several hours at room temperature.</li>
	</ol>
	</li>
</ol>
5. Removing Membranes (&#34;Rolling&#34;)
<ol>
	<li>Using coated Pasteur pipet, add ~500 to 1,000 oocytes to the frosted (sand-blasted) part of a glass slide. Remove all body parts and extraneous material using forceps. Do not let oocytes dry out; add 1x PBS as necessary.</li>
	<li>Place a coverslip on top of the oocytes and gently &#34;roll&#34; oocytes until all membranes are removed (dragging the edge of the coverslip across the oocytes works best.) Periodically check progress under the microscope, adding more 1x PBS as necessary. Take care as too much pressure will destroy the oocytes. 
	&#8203;NOTE: For immunofluorescence only, continue with Step 6. For FISH (with or without immunofluorescence), continue with Step 7.</li>
</ol>
6. Antibody Staining of Drosophila Oocytes
<ol>
	<li>Extraction and Blocking
	<ol>
		<li>Rinse rolled oocytes into a 15 ml conical tube containing ~15 ml PBS/1% Triton X-100. Nutate oocytes in this solution for no less than 1.5 hr and no more than 2 hr. This step allows antibody penetration.</li>
		<li>Let oocytes settle ~2 min. Remove liquid along with as many membranes as possible, then add PBS/0.05% Triton X-100. 
		&#8203;NOTE: Membranes will settle slower than rolled oocytes.</li>
		<li>Let oocytes settle ~2 min, then remove all but ~1 ml liquid. Transfer oocytes to graduated 1.5 ml tube and remove remaining liquid. Add 1 ml PTB for blocking and nutate for 1 hr.</li>
	</ol>
	</li>
	<li>Antibody Staining
	<ol>
		<li>Pre-absorption of secondary antibodies against embryos. 
		&#8203;NOTE: This step eliminates background staining from non-specific antibody interactions with Drosophila proteins.
		<ol>
			<li>Collect and fix Drosophila embryos (~25 &#181;l) per typical procedure8. Store in methanol at -20 &#176;C.</li>
			<li>Remove methanol from embryos, add 800 &#181;l methanol plus 200 &#181;l 1x PBS, and nutate for 15 min. Remove 500 &#181;l of supernatant and replace with 500 &#181;l 1x PBS. Then nutate for 15 min. Repeat twice (for a total of ~1 hr of washes), and then finish in PTB. 
			&#8203;NOTE: Embryos may be used immediately or kept on the nutator for several hr at room temperature.</li>
			<li>Remove liquid, fill with PTB to 200 &#181;l per oocyte prep, and add fluorescently-labeled secondary antibodies at appropriate dilutions (keeping in mind that the final volume will be 300 &#181;l; see step 7.4.) Nutate at 4 &#176;C overnight (preferable) or at room temperature for 3 to 4 hr. 
			NOTE: The pre-absorbed antibodies will be used in Step 6.2.4. 
			&#8203;NOTE: Keep samples in the dark as much as possible once fluorescent antibodies have been added.</li>
		</ol>
		</li>
		<li>Remove liquid from oocytes, fill with PTB to 300 &#181;l, and add primary antibodies at appropriate dilutions. Nutate at 4 &#176;C overnight (preferable) or at room temperature for 3 to 4 hr.</li>
		<li>Wash oocytes four times for 15 min each with 1 ml PTB.</li>
		<li>Remove liquid from oocytes, add 200 &#181;l of supernatant from embryos (pre-absorbed secondary antibodies). Then fill with PTB to 300 &#181;l. Nutate at room temperature for 3 to 4 hr (preferable) or at 4 &#176;C overnight.</li>
		<li>Wash oocytes once for 15 min with 1 ml PTB, remove liquid. Then add 0.5 &#181;l Hoechst 33342 and 500 &#181;l PTB and nutate for 7 min.</li>
		<li>Wash oocytes twice for 15 min each with 1 ml PTB. 
		&#8203;NOTE: Oocytes may be mounted on a slide immediately or may be stored in PTB at 4 &#176;C until ready for imaging.</li>
	</ol>
	</li>
</ol>
7. FISH (Continue from Step 5 Above)
<ol>
	<li>Rinse rolled oocytes into a 15 ml conical tube containing ~15 ml 2x SSCT. Let oocytes settle ~2 min. Remove all but ~0.5 ml liquid along with as many membranes as possible. 
	NOTE: Membranes will settle slower than rolled oocytes.</li>
	<li>Transfer oocytes to 0.5 ml tube and remove remaining liquid. Successively add and remove 500 &#181;l 20%, 40%, and 50% formamide solutions, nutating for 10 min in each solution. 
	NOTE: Oocytes will settle slower with higher percentages of formamide.</li>
	<li>Remove liquid, then add 500 &#181;l 50% formamide solution, and nutate at 37 &#176;C for 1 to 5 hr. 
	NOTE: Longer incubations result in better probe penetration.</li>
	<li>Remove liquid, leaving behind no more than ~100 &#181;l oocytes, and add 36 &#181;l hybridization solution plus 2 &#181;l of probe (50 ng/&#181;l) and 2 &#181;l of water or 2 &#181;l of a 2nd probe (Table 1).</li>
	<li>Incubate at 91 &#176;C for 3 min (FISH only) or 80 &#176;C for 20 min (FISH plus immunofluorescence), followed by incubation in a 37 &#176;C water bath overnight. 
	NOTE: These steps may be performed in a thermocycler.</li>
	<li>Do not remove liquid. Add 500 &#181;l 50% formamide solution and nutate at 37 &#176;C for 1 hr.</li>
	<li>Let settle, remove liquid, add 500 &#181;l 50% formamide solution, and nutate at 37 &#176;C for 1 hr.</li>
	<li>Let settle, remove liquid, add 500 &#181;l 20% formamide solution, and nutate at room temperature for 10 min.</li>
	<li>Perform three quick washes in 500 &#181;l 2x SSCT (let settle, remove then add liquid, invert several times, repeat.) Let settle, remove liquid, then add 500 &#181;l PTB and nutate for 4 hr.</li>
</ol>
8. Antibody Staining after FISH
<ol>
	<li>Remove liquid from oocytes, fill with PTB to 300 &#181;l, and add 10 &#181;l anti-&#945;-tubulin antibody conjugated to FITC. Alternatively, other antibodies can be used, following above protocol. Nutate at room temperature overnight.</li>
	<li>Wash oocytes once for 15 min with 500 &#181;l PTB, remove liquid, then add 0.5 &#181;l Hoechst 33342 and 500 &#181;l PTB and nutate for 7 min.</li>
	<li>Wash oocytes twice for 15 min each with 500 &#181;l PTB. 
	NOTE: Oocytes may be mounted on a slide immediately or may be stored in PTB at 4 &#176;C until ready for imaging. Keep oocytes in the dark as much as possible once fluorescent antibodies have been added.</li>
</ol>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td fo:width="1in">Repeat Name</td>
			<td fo:width="1in">Chromosome</td>
			<td>Oligo Sequence*</td>
		</tr>
		<tr>
			<td>359</td>
			<td>X</td>
			<td>GGGATCGTTAGCACTGGTAATTAGCTGC</td>
		</tr>
		<tr>
			<td>AACAC</td>
			<td>2</td>
			<td>AACACAACACAACACAACACAACACAACACAACACAACAC</td>
		</tr>
		<tr>
			<td>dodeca</td>
			<td>3</td>
			<td>CCCGTACTGGTCCCGTACTCGGTCCCGTACTCGGT</td>
		</tr>
		<tr>
			<td>1.686</td>
			<td>2+3</td>
			<td>AATAACATAGAATAACATAGAATAACATAG</td>
		</tr>
		<tr>
			<td>AATAT</td>
			<td>4(+Y)</td>
			<td>AATATAATATAATATAATATAATATAATAT</td>
		</tr>
		<tr>
			<td colspan="3">*359 sequence from Eric Joyce, personal communication, other sequences from Sullivan et al.8</td>
		</tr>
	</tbody>
</table>
Table 1: FISH probes for Drosophila centromeric repeats.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Drug</td>
			<td>Solvent</td>
			<td>Stock concentration</td>
			<td>Final concentration</td>
			<td>Time of treatment</td>
			<td>Effect</td>
		</tr>
		<tr>
			<td>colchicine</td>
			<td>ethanol</td>
			<td>125 mM</td>
			<td>150 &#181;M</td>
			<td>10 min or 30 min</td>
			<td>destabilize non-kinetochore (10 min)9 or all (30 min) microtubules</td>
		</tr>
		<tr>
			<td>paclitaxel</td>
			<td>DMSO</td>
			<td>10 mM</td>
			<td>10 &#181;M</td>
			<td>10 min</td>
			<td>stabilize microtubules</td>
		</tr>
		<tr>
			<td>Binucleine 2</td>
			<td>DMSO</td>
			<td>25 mM</td>
			<td>25 &#181;M</td>
			<td>20 min</td>
			<td>inhibit Aurora B kinase10</td>
		</tr>
	</tbody>
</table>
Table 2: Drug treatment.

<ol><li>Bridges, C. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Non-disjunction+as+proof+of+the+chromosome+theory+of+heredity%5BTitle%5D)+AND+%22Genetics%22%5BJournal%5D)">Non-disjunction as proof of the chromosome theory of heredity.</a> Genetics. 1 (1), 1-52 (1916).</li>
<li>Hassold, T., Hunt, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((To+err+%28meiotically%29+is+human%3A+the+genesis+of+human+aneuploidy%5BTitle%5D)+AND+%22Nat+Rev+Genet%22%5BJournal%5D)">To err (meiotically) is human: the genesis of human aneuploidy.</a> Nat Rev Genet. 2 (4), 280-291 (2001).</li>
<li>Theurkauf, W. E., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Meiotic+spindle+assembly+in+Drosophila+females%3A+behavior+of+nonexchange+chromosomes+and+the+effects+of+mutations+in+the+nod+kinesin-like+protein%5BTitle%5D)+AND+%22J+Cell+Biol%22%5BJournal%5D)">Meiotic spindle assembly in Drosophila females: behavior of nonexchange chromosomes and the effects of mutations in the nod kinesin-like protein.</a> J Cell Biol. 116 (5), 1167-1180 (1992).</li>
<li>Zou, J., Hallen, M. A., Yankel, C. D., Endow, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+microtubule-destabilizing+kinesin+motor+regulates+spindle+length+and+anchoring+in+oocytes%5BTitle%5D)+AND+%22J+Cell+Biol%22%5BJournal%5D)">A microtubule-destabilizing kinesin motor regulates spindle length and anchoring in oocytes.</a> J Cell Biol. 180 (3), 459-466 (2008).</li>
<li>Dernburg, A. F., Sedat, J. W., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Direct+evidence+of+a+role+for+heterochromatin+in+meiotic+chromosome+segregation%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Direct evidence of a role for heterochromatin in meiotic chromosome segregation.</a> Cell. 86 (1), 135-146 (1996).</li>
<li>Gilliland, W. D., Hughes, S. F., Vietti, D. R., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Congression+of+achiasmate+chromosomes+to+the+metaphase+plate+in+Drosophila+melanogaster+oocytes%5BTitle%5D)+AND+%22Dev+Biol%22%5BJournal%5D)">Congression of achiasmate chromosomes to the metaphase plate in Drosophila melanogaster oocytes.</a> Dev Biol. 325 (1), 122-128 (2009).</li>
<li>Gilliland, W. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Hypoxia+transiently+sequesters+mps1+and+polo+to+collagenase-sensitive+filaments+in+Drosophila+prometaphase+oocytes%5BTitle%5D)+AND+%22PLoS+One%22%5BJournal%5D)">Hypoxia transiently sequesters mps1 and polo to collagenase-sensitive filaments in Drosophila prometaphase oocytes.</a> PLoS One. 4 (10), e7544(2009).</li>
<li>Sullivan, W., Ashburner, M., Hawley, R. S. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aSullivan%2C+W+%22Drosophila+Protocols%22">Drosophila Protocols</a>. , Cold Spring Harbor Laboratory Press. (2000).</li>
<li>Radford, S. J., Hoang, T. L., Głuszek, A. A., Ohkura, H., McKim, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Lateral+and+End-On+Kinetochore+Attachments+Are+Coordinated+to+Achieve+Bi-orientation+in+Drosophila+Oocytes%5BTitle%5D)+AND+%22PLoS+Genet%22%5BJournal%5D)">Lateral and End-On Kinetochore Attachments Are Coordinated to Achieve Bi-orientation in Drosophila Oocytes.</a> PLoS Genet. 11 (10), e1005605(2015).</li>
<li>Smurnyy, Y., Toms, A. V., Hickson, G. R., Eck, M. J., Eggert, U. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Binucleine+2%2C+an+isoform-specific+inhibitor+of+Drosophila+Aurora+B+kinase%2C+provides+insights+into+the+mechanism+of+cytokinesis%5BTitle%5D)+AND+%22ACS+Chem+Biol%22%5BJournal%5D)">Binucleine 2, an isoform-specific inhibitor of Drosophila Aurora B kinase, provides insights into the mechanism of cytokinesis.</a> ACS Chem Biol. 5 (11), 1015-1020 (2010).</li>
<li>Mahowald, A. P., Goralski, T. J., Caulton, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((In+vitro+activation+of+Drosophila+eggs%5BTitle%5D)+AND+%22Dev+Biol%22%5BJournal%5D)">In vitro activation of Drosophila eggs.</a> Dev Biol. 98 (2), 437-445 (1983).</li>
<li>Page, A. W., Orr-Weaver, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Activation+of+the+meiotic+divisions+in+Drosophila+oocytes%5BTitle%5D)+AND+%22Dev+Biol%22%5BJournal%5D)">Activation of the meiotic divisions in Drosophila oocytes.</a> Dev Biol. 183 (2), 195-207 (1997).</li>
<li>Tavosanis, G., Llamazares, S., Goulielmos, G., Gonzalez, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Essential+role+for+gamma-tubulin+in+the+acentriolar+female+meiotic+spindle+of+Drosophila%5BTitle%5D)+AND+%22EMBO+J%22%5BJournal%5D)">Essential role for gamma-tubulin in the acentriolar female meiotic spindle of Drosophila.</a> EMBO J. 16 (8), 1809-1819 (1997).</li>
<li>Endow, S. A., Komma, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Spindle+dynamics+during+meiosis+in+Drosophila+oocytes%5BTitle%5D)+AND+%22J+Cell+Biol%22%5BJournal%5D)">Spindle dynamics during meiosis in Drosophila oocytes.</a> J Cell Biol. 137 (6), 1321-1336 (1997).</li>
<li>Matthies, H. J., Clarkson, M., Saint, R. B., Namba, R., Hawley, R. S. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aMatthies%2C+HJ+%22Drosophila+Protocols%22">Drosophila Protocols</a>. Sullivan, W., Ashburner, M., Hawley, R. S. , Cold Spring Harbor Laboratory Press. 67-85 (2000).</li>
<li>Colombié, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Dual+roles+of+Incenp+crucial+to+the+assembly+of+the+acentrosomal+metaphase+spindle+in+female+meiosis%5BTitle%5D)+AND+%22Development%22%5BJournal%5D)">Dual roles of Incenp crucial to the assembly of the acentrosomal metaphase spindle in female meiosis.</a> Development. 135 (19), 3239-3246 (2008).</li>
</ol>

The authors have nothing to disclose.

Staging Drosophila Oocytes
Although an elongated karyosome is often seen in prometaphase oocytes, using karyosome shape to distinguish prometaphase from metaphase oocytes can be problematic. During prometaphase, the karyosome begins as a round shape, elongates, and then retracts to a round shape as the oocyte approaches the metaphase arrest. This means that many prometaphase oocytes do not have an elongated karyosome. In addition, if mutant or drug-treated oocytes are...

The study of meiosis is sometimes described as the "genetics of genetics". This is because the fundamental properties of chromosome inheritance and independent assortment are carried out through the segregation of chromosomes during gamete production. An important demonstration of the chromosome theory of inheritance came in 1916 from the work of Calvin Bridges in Drosophila melanogaster1. This and other classical genetics studies in Drosophila contributed greatly to our understanding of genetics. Cytological examination of meiotic chromosomes in Drosophila oocytes, however, has been challenging. This is primarily because immunofluorescence of late-stage Drosophila oocytes, when the spindle assembles and chromosomes are oriented for segregation, is hampered by the presence of membranes that render the oocyte impenetrable to antibodies.
Despite this challenge, Drosophila oocytes remain an attractive model for the study of chromosome behavior and spindle assembly. This is because of the powerful genetic tools available in Drosophila, but also because the oocytes arrest at metaphase I, when the chromosomes are oriented and the spindle is fully formed. This facilitates the collection and examination of large numbers of oocytes at this important stage of cell division. In addition, a simple model organism that is amenable to genetic manipulation for the study of oocyte chromosome segregation can provide an important contribution to our understanding of human reproductive health. Errors in chromosome number are the leading genetic cause of miscarriage and birth defects in humans2. A majority of these errors can be traced to the oocyte and are correlated with increasing maternal age. The average age of mothers in the U.S. has been increasing, making this a major public health concern.
We describe here methods for the cytological examination of Drosophila oocytes, including a demonstration of how to remove the oocyte membranes. These methods are modifications of protocols first described by Theurkauf and Hawley3, Zou et al.4, and Dernburg et al.5. We also include methods for the enrichment of different stages of oocytes, based on a protocol first described by Gilliland et al.6. Finally, we add instructions for the drug treatment of Drosophila oocytes. Together, these methods allow the cytological investigation of oocyte chromosome segregation and spindle assembly in Drosophila.

<table><tbody><tr><td>15 ml conical tubes</td><td>Various</td><td></td><td></td></tr><tr><td>16% formaldehyde</td><td>Ted Pella, Inc.</td><td>18505</td><td>HAZARDOUS; once opened, discard after one month</td></tr><tr><td>250 ml beakers</td><td>Various</td><td></td><td></td></tr><tr><td>5 ml tubes</td><td>Various</td><td></td><td></td></tr><tr><td>active dry yeast</td><td>Various</td><td></td><td>mix with water to make a paste the consistency of peanut butter</td></tr><tr><td>anti-&amp;alpha;-tubulin antibody conjugated to FITC</td><td>Sigma</td><td>F2168</td><td>clone DM1A</td></tr><tr><td>Binucleine 2</td><td>Sigma</td><td>B1186</td><td>HAZARDOUS</td></tr><tr><td>blender</td><td>Various</td><td></td><td></td></tr><tr><td>bovine serum albumin</td><td>Sigma</td><td>A4161</td><td></td></tr><tr><td>calcium chloride</td><td>Various</td><td></td><td></td></tr><tr><td>colchicine</td><td>Sigma</td><td>C-9754</td><td>HAZARDOUS</td></tr><tr><td>coverslips</td><td>VWR</td><td>48366-227</td><td>No. 1 1/2</td></tr><tr><td>dextran sulfate</td><td>Various</td><td></td><td></td></tr><tr><td>DMSO</td><td>Various</td><td></td><td></td></tr><tr><td>EGTA</td><td>Various</td><td></td><td></td></tr><tr><td>ethanol</td><td>Various</td><td></td><td></td></tr><tr><td>forceps</td><td>Ted Pella, Inc.</td><td>5622</td><td>Dumont tweezers high precision grade style 5</td></tr><tr><td>formamide</td><td>Sigma</td><td>47670-250ML-F</td><td></td></tr><tr><td>glass slides</td><td>VWR</td><td>48312-003</td><td></td></tr><tr><td>glucose</td><td>Various</td><td></td><td></td></tr><tr><td>graduated 1.5 ml tubes</td><td>Various</td><td></td><td></td></tr><tr><td>HEPES</td><td>VWR</td><td>EM-5330</td><td>available from several venders</td></tr><tr><td>Hoechst 33342</td><td>Various</td><td></td><td></td></tr><tr><td>magnesium chloride</td><td>Various</td><td></td><td></td></tr><tr><td>methanol</td><td>Various</td><td></td><td></td></tr><tr><td>large mesh (~1,500 &amp;micro;m)</td><td>VWR</td><td>AA43657-NK</td><td>variety of formats and other suppliers, 12 or 14 mesh</td></tr><tr><td>small mesh (~300 &amp;micro;m)</td><td>Spectrum labs</td><td>146 424</td><td>variety of formats, &lt;em&gt;e.g.&lt;/em&gt;, 146 422 or 146 486</td></tr><tr><td>nutator</td><td>Various</td><td></td><td></td></tr><tr><td>Pasteur pipets</td><td>Various</td><td></td><td></td></tr><tr><td>potassium acetate</td><td>Various</td><td></td><td></td></tr><tr><td>Cacodylic acid</td><td>Sigma</td><td>C0125</td><td>HAZARDOUS; alternatively, sodium cacodylate may be substituted</td></tr><tr><td>potassium hydroxide</td><td>Various</td><td></td><td></td></tr><tr><td>sodium acetate</td><td>Various</td><td></td><td></td></tr><tr><td>sodium chloride</td><td>Various</td><td></td><td></td></tr><tr><td>sodium citrate</td><td>Various</td><td></td><td></td></tr><tr><td>sodium hydroxide</td><td>Various</td><td></td><td></td></tr><tr><td>sucrose</td><td>Various</td><td></td><td></td></tr><tr><td>taxol (paclitaxel)</td><td>Sigma</td><td>T1912</td><td>HAZARDOUS</td></tr><tr><td>Triton X-100</td><td>Fisher</td><td>PI-28314</td><td></td></tr><tr><td>Tween 20</td><td>Fisher</td><td>PI-28320</td><td></td></tr><tr><td>vortex</td><td>Various</td><td></td><td></td></tr></tbody></table>

techniques for imaging prometaphase and metaphase of meiosis i in fixed drosophila oocytes

Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes

Chromosome segregation in human oocytes is error prone, resulting in aneuploidy, which is the leading genetic cause of miscarriage and birth defects. The study of chromosome behavior in oocytes from model organisms holds much promise to uncover the molecular basis of the susceptibility of human oocytes to aneuploidy. Drosophila melanogaster is amenable to genetic manipulation, with over 100 years of research, community, and technique development. Visualizing chromosome behavior and spindle assembly in Drosophila oocytes has particular challenges, however, due primarily to the presence of membranes surrounding the oocyte that are impenetrable to antibodies. We describe here protocols for the collection, preparation, and imaging of meiosis I spindle assembly and chromosome behavior in Drosophila oocytes, which allow the molecular dissection of chromosome segregation in this important model organism.

The methods we have described here will result in the collection of late-stage Drosophila oocytes representing three stages of meiosis (Figure 1). Oocytes in prophase are distinguished by the presence of the nuclear envelope, which is visible by the lack of tubulin signal in the region surrounding the karyosome (Figure 1A). Prometaphase is the period after nuclear envelope breakdown during which the spindle assembles. During prometaphase, the kar...

We present protocols for the collection, preparation, and imaging of mature Drosophila oocytes. These methods allow the visualization of chromosome behavior and spindle assembly and function during meiosis.

Chromosome segregation in human oocytes is error prone, resulting in aneuploidy, which is the leading genetic cause of miscarriage and birth defects. The ...

The overall goal of this procedure is to prepare Drosophila oocytes for the cytological examination of spindle assembly and chromosome orientation during meiosis I.This method can help answer key questions in the meiosis field, such as how spindle bipolarity is established and how chromosomes become bi-oriented in the absence of centrosomes. The main advantage of this technique is that the oocyte membranes that block antibody penetration are effectively removed, which allows immunofluorescence. To begin pre-coat the inside of a five-millimeter tube and pasture pipette with PTB to prevent oocytes sticking to the surfaces.Add 100 milliliters of ROB's buffer to a blender and then add 100 to 300 anesthetized flies and pulse three times for one second. Filter the resulted slurry into a 250-milliliter beaker through a large mesh with pores of around 1, 500 micrometers. Let the filtrate settle for around two minutes and then aspirate the top layer, removing as many large body parts as possible.Filter the slurry again into a 250-milliliter beaker, through a smaller mesh with the pore size of 300 micrometers. Rinse the first beaker using additional buffer in the coated pipette to collect the remaining oocytes. Let the slurry settle for three minutes and then aspirate all but the bottom 10 milliliters.Pour as much of the 10 milliliters as possible into the coated five-milliliter tube. Let the slurry settle for around two minutes and then carefully remove the liquid. Add the remainder of the 10 milliliters of slurry and let the mix settle again before removing the liquid.Rinse any remaining oocytes out of the beaker using additional buffer in the coated pipette. Let the rinse settle in the five-milliliter tube for three to five minutes. To fix the ovaries, first aspirate off all liquid from the tissues and immediately add one milliliter of Fix Mix.Place the tissues on a nutator for 2 1/2 minutes. Next, add one milliliter of heptane, vortex the tube for one minute, and then allow the oocytes to settle for a further minute. Remove all liquid from the settled tissue, then add one milliliter of 1x PBS.Vortex the tube for 30 seconds and then allow the oocytes to settle for one minute. After that, remove all liquid from the tube and fill it with five milliliters of 1x PBS. Using the coated pipette, add roughly 500 to 1, 000 oocytes to a frosted glass slide.Remove any extraneous body parts or material using forceps. Place a cover slip on top of the tissue and gently roll the oocytes until all membranes are removed. Dragging the edge of the coverslip across the oocytes works well.Check the progress of membrane removal under a microscope periodically. Too much pressure will destroy the oocytes. The most effective oocyte membrane removal is achieved by combining the maximum amount of oocyte movement with the minimum amount of pressure.Use a light touch and quick movements to drag the edge of the coverslip across the oocytes. To begin extraction and blocking, add 15 milliliters of PBS 1%Triton X-100 to a 50-milliliter tube. Rinse the rolled oocytes into this tube and nutate for 1 1/2 to two hours.After allowing the oocytes to settle for two minutes, remove the liquid along with as many membranes as possible and add 50 milliliters of PBS 0.05%Triton X-100. Let the oocytes settle for a further two minutes, and then remove all but around one milliliter of liquid. Transfer the oocytes to a graduated 1.5 milliliter tube and remove the remaining liquid.Add one milliliter of PTB for blocking and nutate for one hour. Remove the liquid from the oocytes and then add 300 microliters of PTB. Next, add the primary antibody of interest at the appropriate dilution, taking care to protect the samples treated with fluorescent antibody from light.Nutute overnight at four degrees Celsius. Wash the oocytes and one milliliter of PTB four times for 15 minutes each. Remove the liquid, and add 200 microliters of supernatant from the secondary antibody-treated embryos.Filter the 300-microliter mark with PTB and then nutate for three to four hours at room temperature. Wash the oocytes once for 15 minutes with one milliliter of PTB. Next, remove the liquid and add 0.5 microliters of Hoechst 33342 and 500 microliters of PTB.Set to nutate for seven minutes. Use one milliliter of PTB to wash the oocytes two times for 15 minutes each. The samples can now be mounted and imaged immediately using standard confocal microscopy techniques, or stored in PTB at four degrees Celsius until needed.Images of late-stage oocytes generated using the demonstrated technique are shown here, capturing three different stages of meiosis. Oocytes in prophase are distinguished by the presence of the nuclear envelope which is visible due to the lack of tubulin signal in the regions surrounding the karyosome. The distinctive elongation of the karyosome in the prometaphase was also observed, and the fourth chromosomes are seen apart from the karyosome mass.Metaphase was also captured and the karyosome is seen retracted into a round shape. Here immunostaining with different antibodies highlights the spindle, centromeres, and central spindle in oocytes fixed with formaldehyde and heptane. Oocytes treated with the drug Colchicine showed non-standard phenotypes with the elimination of most non-kinetic or microtubules, resulting in all microtubules contacting the DNA at centromere labeled Phocyde.Treatment with Paclitaxel resulted in oocytes with excessive microtubules in the cytoplasm. Finally oocytes treated with Binucleine 2 to inhibit Aurora B kinase, showed complete loss of spindle microtubules. While attempting this procedure, it's important to remember not to rush during oocyte membrane removal, because the success of the protocol depends on this step.Generally individuals new to this method will struggle, because the removal of the membranes requires patience and practice. This technique is therefore best learned by watching someone perform it successfully. Once mastered, rolling the oocytes can be done in five to 10 minutes.But it's possible to take up to 30 minutes without affecting the quality of the results. After watching this video, you should have a good understanding of how to prepare late-stage Drosophila oocytes for imaging biotic spindle assembly, spindle organization, chromosome movements, and chromosome bi-orientation. Thanks for watching, and good luck with your experiments.

techniques-for-imaging-prometaphase-metaphase-meiosis-i-fixed

Research

JoVE Journal

Biology

Oocytes are prone to aneuploidy due to errors in chromosome segregation during meiotic maturation.  Aneuploid eggs can cause infertility, miscarriages or developmental disorders like Down syndrome.  Here, we describe methods to introduce materials of choice into oocytes and methods to study meiotic maturation and assess ploidy.

Mouse Oocyte Microinjection, Maturation and Ploidy Assessment

The kinetochore is where the SAC initiates its signal monitoring the mitotic segregation of the sister chromatids. A method is described to visualize the recruitment and turnover of one of the kinetochore proteins and its coordination with the chromosome motion in Drosophila embryos using a Leica laser scanning confocal system.

Studying Mitotic Checkpoint by Illustrating Dynamic Kinetochore Protein Behavior and Chromosome Motion in Living Drosophila Syncytial Embryos

Immunostaining of Drosophila late-stage oocytes can prove challenging due to the oocytes' surrounding membranes. This video describes a high-throughput method for obtaining oocytes, their fixation, and membranes' removal for immunostaining. The featured protocol demonstrates these techniques with late-stage oocytes used to visualize different stages of meiosis.

Preparation of Fixed Drosophila Oocytes for Immunostaining: A High-Throughput Method to Fix and Remove the Outer Membrane

This video describes a method to mechanically remove the chorion and vitelline membranes from previously fixed mature Drosophila oocytes. The featured protocol shows a detailed demonstration of the procedure yielding oocytes compatible with fluorescent in situ hybridization assays.

Chorion and Vitelline Membrane Mechanical Removal: A Method to Prepare Drosophila Oocytes for Direct Observation

A protocol for live imaging of GFP-tagged proteins or autofluorescent structures in individual Drosophila oocytes is described.

Live Imaging of GFP-labeled Proteins in Drosophila Oocytes

This manuscript presents a detailed method for generating X-chromosome arm probes and performing fluorescence in situ hybridization (FISH) to examine the state of sister chromatid cohesion in prometaphase and metaphase I arrested Drosophila oocytes. This protocol is suitable for determining whether meiotic arm cohesion is intact or disrupted in different genotypes.

Using Fluorescence In Situ Hybridization (FISH) to Monitor the State of Arm Cohesion in Prometaphase and Metaphase I Drosophila Oocytes

As the genetic variants associated with human disease begin to become uncovered, it is becoming increasingly important to develop systems with which to rapidly evaluate the biological significance of those identified variants. This protocol describes methods for evaluating human gene function during female meiosis I using mouse oocytes.

Using Mouse Oocytes to Assess Human Gene Function During Meiosis I

In Drosophila, the oocyte nucleus undergoes microtubule-dependent migration during oogenesis. Here, we describe a protocol that was developed to follow the migration by performing live imaging on egg chambers ex-vivo. Our procedure maintains egg chambers alive for 12 h to acquire multi-position 3D time-lapse movies using spinning-disk confocal microscopy.

Nuclear Migration in the Drosophila Oocyte

Figure 1: End-to-end framework. The figure illustrates end-to-end framework for multimodal knowledge Graph VISHAM-KG. Please click here to view a larger version of this figure.

Preparation of Meiotic Chromosome Spreads from Mouse Oocytes for Assessment of Synapsis and Recombination

This protocol describes the use of microinjection and high resolution imaging in the Drosophila melanogaster syncytial embryo to study mitosis.

Microinjection Techniques for Studying Mitosis in the Drosophila melanogaster Syncytial Embryo

Learn techniques for imaging prometaphase and metaphase of meiosis I in fixed Drosophila oocytes. This protocol enables visualization of spindle assembly and chromosome orientation using immunofluorescence.

Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes

Explore More Videos