This protocol combines in situ hybridization with immunofluorescence to identify olfactory and vomeronasal receptor genes expressed in olfactory sensory neurons after activation by chemical stimuli in the mouse.
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
This protocol combines in situ hybridization with immunofluorescence to identify olfactory and vomeronasal receptor genes expressed in olfactory sensory neurons after activation by chemical stimuli in the mouse.
Animals rely on chemical communication to convey and perceive relevant environmental information, ranging from assessment of food quality to detection of available mating partners or threats. In mice, this task is executed primarily by the olfactory system and its underlying subsystems, including the main and accessory olfactory systems. Both have peripheral organs populated by sensory neurons expressing G-protein coupled receptors able to bind chemical cues that reach the nasal cavity. Even though the molecular characteristics of these receptors is well understood, little is known about their cognate specific ligands. The method described here combines in situ hybridization detection of olfactory or vomeronasal receptors with immunodetection of phosphorylated ribosomal protein S6 (pS6) - a marker of neuronal activation. This protocol was devised to identify neurons activated after a single event of exposure to purified or complex chemical stimuli detected by the olfactory organs. Importantly, this technique allows the investigation of neurons triggered in biologically relevant contexts. Ideally, this method should be used to probe the molecular biology of the olfactory system and to study olfactory behaviors.
Chemosignaling is the most widespread form of communication in animals. In mammals, detection of chemical cues is mediated mainly through olfaction and is paramount for finding food, locating possible mating partners, and avoiding potential predators1,2,3. The mouse olfactory system is further divided into different subsystems, each with their own anatomical, physiological and molecular properties4. Among these, the main olfactory system (MOS) and accessory olfactory system (AOS) are the most widely studied and better characterized.
Access restricted. Please log in or start a trial to view this content.
Animal procedures were carried out in accordance with Animal Protocol #1883-1, approved by the University of Campinas (Institute of Biology's Institutional Animal Care and Use Committee - Committee for Ethics in Animal Use in Research), which follows the guidelines established by the federal National Council for Animal Experimentation Control (CONCEA).
1. Material preparation
Access restricted. Please log in or start a trial to view this content.
The current protocol aims at obtaining microscopy images in which the experimenter's gene of interest and the neuronal activity marker pS6 are fluorescently labeled. The described method involves Tyramide Signal Amplification, which produces clear and strong labeling with little to no background. pS6 immunostaining appears as cytoplasmic fluorescent signal that usually fills the entire neuronal cell body, whereas in situ hybridization signal for olfactory receptor neurons shows as cytoplasmic staining. pS6 is a .......
Access restricted. Please log in or start a trial to view this content.
The protocol described here reliably identifies sensory neurons activated by chemical cues in the olfactory system through a combination of in situ detection of OR or VR receptors with immunodetection of pS6, an indirect marker of neuronal activity. The experimenter must take extra caution to maintain histology integrity and perform all steps before hybridization under RNase-free conditions. Failure to do so may cause mRNA degradation and compromise riboprobe labeling. Care must be exercised during dissection of.......
Access restricted. Please log in or start a trial to view this content.
The authors declare they have no competing interests of any kind.
We thank GAG Pereira and JA Yunes for resources, APF Ferreira and WO Bragança for administrative and technical help, and the Life Sciences Core Facility (LaCTAD-UNICAMP) staff for help with confocal microscopy. This work was supported by the Sao Paulo Research Foundation (FAPESP; grant numbers 2009/00473-0 and 2015/50371-0 to F.P.), by PRP/UNICAMP (grant numbers 2969/16, 725/15, 348/14, and 315/12 to F.P.), by FAPESP fellowships to V.M.A.C. (2014/25594-3, 2012/21786-0, 2012/01689-0), T.S.N. (2012/04026-1), and by Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) fellowship to T.S.N.
....Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| 10x phosphate-buffered saline (PBS) | Thermo Fisher Scientific | AM9625 | n/a |
| 20x amplification diluent (reaction buffer from Alexa Fluor 555 Tyramide SuperBoost kit) | Thermo Fisher Scientific | B40923 or B40922 | refered to as Amplification Buffer A in working solutions for tyramide-Alexa 488 or tyramide-Alexa 555 signal amplification |
| 20x SSC | Merck (Calbiochem) | 8310-OP | n/a |
| 30% Bovine Serum Albumin (BSA) | Merck (Sigma-Aldrich) | A9576 | n/a |
| 30% hydrogen peroxyde (H2O2) | Merck (Sigma-Aldrich) | H1009 | n/a |
| Acetic anhydride | Merck (Sigma-Aldrich) | 320102 | n/a |
| Agarose | Merck (Sigma-Aldrich) | A9539 | n/a |
| Amplification diluent (from TSA Biotin kit) | Akoya Biosciences (Perkin Elmer) | SAT700001EA | refered to as Amplification Buffer B in working solution for tyramide-biotin signal amplification |
| Anti-pS6 (Ser 244/247) rabbit polyclonal antibody | Thermo Fisher Scientific | Cat# 44-923G, RRID:AB_2533798 | n/a |
| Blocking buffer 1x (from Alexa Fluor 488 Tyramide SuperBoost kit) | Thermo Fisher Scientific | B40923 or B40922 | refered to as blocking solution B in the tyramide signal development step |
| Blocking reagent (from TSA Biotin kit) | Akoya Biosciences (Perkin Elmer) | SAT700001EA | refered to as blocking reagent A in the formulation for TNB buffer |
| DAPI nuclear stain | Thermo Fisher Scientific | D1306 | n/a |
| Denhardt's solution (50x) | Merck (Sigma-Aldrich) | D9905 | n/a |
| Deoinized formamide | Merck (Sigma-Aldrich) | F9037 | n/a |
| Dextran sulfate solution (50%) | Merck (Chemicon) | S4030 | n/a |
| Ethylene-diamine-tetraacetic acid (EDTA) | Merck (Sigma-Aldrich) | E9884 | n/a |
| Hoechst 33342 nuclear stain | Thermo Fisher Scientific | H1399 | n/a |
| Hydrochloric acid (HCl) | Merck (Sigma-Aldrich) | 320331 | n/a |
| Olfactory stimuli | n/a | Papes et al. (2010), Carvalho et al. (2015), Nakahara er al. (2016), Carvalho et al. (2020) | n/a |
| Paraformaldehyde | Merck (Sigma-Aldrich) | P6148 | n/a |
| Peroxidase-conjugated anti-digoxigenin antibody (Fab fragments) | Merck (Roche) | 11207733910; RRID:AB_514500 | refered to as peroxidase-conjugated anti-DIG antibody |
| Peroxidase-conjugated anti-rabbit secondary antibody (polyHRP-conjugated goat anti-rabbit reagent from Alexa Fluor 488 Tyramide SuperBoost kit) | Thermo Fisher Scientific | B40922 | n/a |
| Peroxidase-conjugated streptavidin (from TSA biotin kit) | Akoya Biosciences (Perkin Elmer) | SAT700001EA | n/a |
| ProLong Gold antifade mountant | Thermo Fisher Scientific | P36934 | refered to as anti-fading mounting medium |
| RNase-free ultrapure water | Thermo Fisher Scientific | 10977015 | n/a |
| Sodium chloride (NaCl) | Merck (Sigma-Aldrich) | S9888 | n/a |
| Sodium dodecyl sulfate (SDS) | Merck (Sigma-Aldrich) | 436143 | n/a |
| Sodium hydroxide (NaOH) | Merck (Sigma-Aldrich) | S8045 | n/a |
| Sucrose | Merck (Sigma-Aldrich) | S0389 | n/a |
| Triethanolamine | Merck (Sigma-Aldrich) | T58300 | n/a |
| Triton X-100 | Merck (Sigma-Aldrich) | X100 | n/a |
| Trizma hydrochloride (Tris-Cl) | Merck (Sigma-Aldrich) | T5941 | n/a |
| Tween-20 | Merck (Sigma-Aldrich) | 822184 | n/a |
| Tyramide-Alexa 488 conjugate (from Alexa Fluor 488 Tyramide SuperBoost kit) | Thermo Fisher Scientific | B40922 | n/a |
| Tyramide-Alexa 555 conjugate (from Alexa Fluor 555 Tyramide SuperBoost kit) | Thermo Fisher Scientific | B40923 | n/a |
| Tyramide-Biotin conjugate (from TSA Biotin kit) | Akoya Biosciences (Perkin Elmer) | SAT700001EA | n/a |
| Yeast tRNA | Merck (Roche) | 10109495001 | n/a |
| Critical Commercial Assays and Animals | |||
| Alexa Fluor 488 Tyramide SuperBoost kit | Thermo Fisher Scientific | B40922 | n/a |
| Alexa Fluor 555 Tyramide SuperBoost kit | Thermo Fisher Scientific | B40923 | n/a |
| DIG RNA Labeling Kit (SP6/T7) | Merck (Roche) | 11175025910 | n/a |
| High Sensitivity RNA ScreenTape Analysis reagents (buffer, ladder, and tape) | Agilent | 5067-5580, 5067-5581, and 5067-5579 | refered to as automated electrophoresis system |
| Mouse: C57BL/6J inbred strain | Jackson Laboratories | Stock No: 000664; RRID:IMSR_JAX:000664) | n/a |
| ProbeQuant G-50 Micro Columns | Cytiva Biosciences | 28903408 | refered to as gel filtration-based purification kit |
| QIAquick gel extraction kit | Qiagen | 28506 | refered to as mini column-based gel-purification kit |
| RNeasy MinElute cleanup kit | Qiagen | 74204 | refered to as mini column-based RNA purification kit |
| TSA Biotin kit | Akoya Biosciences (Perkin Elmer) | SAT700001EA | n/a |
| Oligonucleotides | |||
| 5’ – AAACTTCATCCTTACAGAATGG CAG – 3’ | Integrated DNA Technologies | n/a | Olfr692 |
| 5’ – ACTGGCTTTGGGACAGTGTGAC – 3’ | Integrated DNA Technologies | n/a | |
| 5’- GGTAATATCTCCATTATCCTAGTT TCCC – 3’ | Integrated DNA Technologies | n/a | Olfr124 |
| 5’ – TTGACCCAAAACTCCTTTGTTAG TG – 3’ | Integrated DNA Technologies | n/a | |
| 5’ – ATGGGAGCTCTAAATCAAACAA GAG – 3’ | Integrated DNA Technologies | n/a | Olfr1509 |
| 5’ – TAGAAAACCGATACCACCTTGTC G – 3’ | Integrated DNA Technologies | n/a | |
| 5’ – TACATCCTGACTCAGCTGGGGA ACG – 3’ | Integrated DNA Technologies | n/a | Olfr1512 |
| 5’ – GGGCACATAGTACACAGTAACA ATAGTC – 3’ | Integrated DNA Technologies | n/a | |
| 5’ – GAGGAAGCTCACTTTTGGTTTG G – 3’ | Integrated DNA Technologies | n/a | Olfr78 |
| 5’ – CAGCTTCAATGTCCTTGTCACA G – 3’ | Integrated DNA Technologies | n/a | |
| 5’ – TGGGTTGGAGGCTTATCATACC TG – 3’ | Integrated DNA Technologies | n/a | Olfr691 |
| 5’ – AAGAACAACACAGAGTCTTGAT GTC – 3’ | Integrated DNA Technologies | n/a | |
| 5’ – AGAAGTAACTAACACCACTCAT GGC – 3’ | Integrated DNA Technologies | n/a | Olfr638 |
| 5’ – TTAGTGCACCTTTCTTTGCAAC – 3’ | Integrated DNA Technologies | n/a | |
| 5’ – TAACAGCTCTTCCCATCCCCTG TTC – 3’ | Integrated DNA Technologies | n/a | Olfr569 |
| 5’ – TAGGGTTGAGCATGGGAGGAAC AAGC – 3’ | Integrated DNA Technologies | n/a | |
| 5’ – CACTGGATCAACTCTAGCAGCA CTG – 3’ | Integrated DNA Technologies | n/a | Vmn2r1 |
| 5’ – CTGCCCTTCTTGACATCTGCTG AG – 3’ | Integrated DNA Technologies | n/a | |
| 5’ – ATCGGATCCACTGCTTTAGCATT TCTTACAGGACAG – 3’ | Integrated DNA Technologies | n/a | Vmn2r2 |
| 5’ – ATCCTCGAGTCATGCCTCTCCAT AAGCAAGGAATTCCAC – 3' | Integrated DNA Technologies | n/a | |
| 5’ – TAGGAAGCTATTTGCCTTGTTTC CAC – 3’ | Integrated DNA Technologies | n/a | Vmn2r13 |
| 5’ – AGGAGATTTTACCAACCAGATTC CAG – 3’ | Integrated DNA Technologies | n/a | |
| 5’ – CTCTAAGAACAGCAGTAAAATGG ATCT – 3’ | Integrated DNA Technologies | n/a | Vmn2r89 |
| 5’ – ATGGGAATGACCAACTTAGGTGC A – 3’ | Integrated DNA Technologies | n/a | |
| 5’ – ATCCCATGGCTGAGAACATGTGC TTCTGGAG – 3’ | Integrated DNA Technologies | n/a | Vmn2r118 |
| 5’ – ATCCTCGAGTCAGTCTGCATAAG CCAGATATGTCAC – 3’ | Integrated DNA Technologies | n/a | |
| 5’ – ATCGGATCCGCTGATTTTATTTCT CCCAGATGCTTTTGG – 3’ | Integrated DNA Technologies | n/a | Vmn2r116 |
| 5’ – ATCCTCGAGTCATGGTTCTTCAT AGCTGAGAAATACAAC – 3’ | Integrated DNA Technologies | n/a | |
| 5’ – TGGGTGTCTTCTTTCTCCTCAA GA – 3’ | Integrated DNA Technologies | n/a | Vmn2r28 |
| 5’ – GGTGACCCATATTCTCTGTATAA CTGT – 3’ | Integrated DNA Technologies | n/a | |
| 5’ – GATGTTCATTTTCATGAGAGTCT TCC – 3’ | Integrated DNA Technologies | n/a | Vmn2r41 |
| 5’ – CATTTGTGGATGACATCACAATT TGG – 3’ | Integrated DNA Technologies | n/a | |
| 5’ – TTTATGGCAAATTTCACTGATCCC G – 3’ | Integrated DNA Technologies | n/a | Vmn2r46 |
| 5’ – AGTGGGTCTTTCTTAGAAAGGAG TG – 3’ | Integrated DNA Technologies | n/a | |
| 5’ – ACATGAACCAGAATTTGAAGCAG GC – 3’ | Integrated DNA Technologies | n/a | Vmn2r69 |
| 5’ – GCCAAGAAAGCTACAGTGAAAC C – 3’ | Integrated DNA Technologies | n/a | |
| 5’ – AGGTGAAGAAATGGTATTCTTCC AG – 3’ | Integrated DNA Technologies | n/a | Vmn2r58 |
| ACTGTGGCCTTGAATGCAATAACT – 3’ | Integrated DNA Technologies | n/a | |
| 5’ – TTCCTAAAGAACACCCTACTGA AGCATCG – 3’ | Integrated DNA Technologies | n/a | Vmn2r90 |
| 5’ – CATATTCCACAGAAGAGAAGT TGGAC – 3’ | Integrated DNA Technologies | n/a | |
| 5’ – TTGAGGTGAGAGTCAACAGT TTAGAC – 3’ | Integrated DNA Technologies | n/a | Vmn2r107 |
| 5’ – CCCTTGTTGCACAAAATGAT GATGTGA – 3’ | Integrated DNA Technologies | n/a | |
| 5’ – ATCCCATGGAGTCAGAGTAT CTACTACACCATGATGG – 3’ | Integrated DNA Technologies | n/a | Vmn2r83 |
| 5’ – ATCCTCGAGTCAATCATTAT AGTCCAGAAAGGTGACAG – 3’ | Integrated DNA Technologies | n/a | |
| Recombinant DNA | |||
| pGEM-T-Easy vector | Promega | A1360 | reccommended PCR cloning vector |
| Other materials | |||
| 1mL syringes | Fisher Scientific | 14-829-10F | n/a |
| Conical tubes (15 mL and 50 mL) | Fisher Scientific | 14-432-22, 14-959-49B | n/a |
| Coplin jars | Fisher Scientific | 12-567-099, 07-200-81 | n/a |
| Cryostat | Leica Biosystems | CMS 1850 | n/a |
| Dissecting tools and forceps | Roboz | RS-6802, RS-8124, RS-7110, RS-5111 | n/a |
| Dry bath | n/a | n/a | n/a |
| Electrophoresis equipment | Fisher Scientific | 09-528-110B | n/a |
| Fine point paintbrushes | Winsor & Newton | 10269097 | n/a |
| Fluorescence or confocal microscope | Leica Microsystems | TCS SP5II | n/a |
| Heated plate | Fisher Scientific | HP88850200 | n/a |
| Humidified chamber (if used at higher temperatures, it will need to be sealed inside a plastic Tupperware container) | Thermo Fisher Scientific | 22-045-034 | n/a |
| Lint-free laboratory Kimwipes | Kimberly-Clark | 34120 | refered to as lint-free laboratory tissue paper |
| Microcentrifuge | Eppendorf | 5401000013 | n/a |
| Mouse cages | InnoVive | M-BTM, MVX1 | n/a |
| PCR Thermocycler | Thermo Fisher Scientific | 4375786 | n/a |
| Pipette p1000, p200, and p20 disposable tips | Fisher Scientific | 02-707-408, 02-707-411, 02-707-438 | n/a |
| Plastic histology embedding mold | Thermo Fisher Scientific | 22-19 | n/a |
| Qubit 4 Fluorometer | Thermo Fisher Scientific | Q33238 | refered to as highly sensitive fluorometric method |
| Razor blades or scalpels | Fisher Scientific | 12-640 | n/a |
| RNA tapestation or BioAnalyzer | Agilent | 4200 TapeStation System or 2100 Bioanalyzer Instrument | n/a |
| RNase-free glass or plastic graduated cylinders and beakers | Fisher Scientific | 10-462-833, 02-555-25B, 02-555-25D | n/a |
| Stereomicroscope | Leica Microsystems | M80 | n/a |
| SuperFrost Plus microscope slides | Thermo Fisher Scientific | 12-550-15 | referred to as positively charged microscope slides |
| Parafilm | Bemis Company | PM999 | refered to as thermoplastic laboratory film |
| Water bath | Thermo Fisher Scientific | TSCIR19 | n/a |
Access restricted. Please log in or start a trial to view this content.
This article has been published
Video Coming Soon