Name: Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus (Video) | JoVE Journal
Uploaded: 2022-03-09T15:00:00.000+00:00
Duration: 6 min 54 s
Description: Learn a soaking method for RNA interference in the pinewood nematode Bursaphelenchus xylophilus to study gene function. This technique enables large-scale screening and supports biological control strategies.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

This research was funded by the National Natural Science Foundation of China (31870637, 31200487) and jointly funded by the Zhejiang Key Research Plan (2019C02024, LGN22C160004).

The study was approved by the council for animal experimentation of Zhejiang Agricultural &#38; Forestry University. The B. xylophilus isolate NXY61 was originally extracted from a diseased Pinus massoniana in the Ningbo area of Zhejiang province, China11.
1. Gene cloning
NOTE: See the Table of Materials for details about the primers used in this protocol.
<ol>
	<li>Collect nematodes.
	<ol>
		<li>Culture the B. xylophilus strain on the mycelia of Botrytis cinerea on Potato Dextrose Agar (PDA) plates at 25 &#176;C for 3-5 days.</li>
		<li>Collect the nematodes using the Bellman funnel method14.
		<ol>
			<li>Place a clamped rubber tube below a funnel and place two layers of filter paper in the mouth of the funnel. Transfer the fungal cultures to the funnel and add water to immerse the fungal mat. Wait for 2 h, then collect the nematodes.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Extract the total RNA from the nematodes using a total RNA extraction reagent (see the Table of Materials)11 according to the following steps.
	<ol>
		<li>Add 500 &#181;L of extraction reagent and 100 &#181;L of magnetic beads to a 2 mL centrifuge tube. Aspirate 20 &#181;L of the nematodes and transfer the sample to a grinder for grinding at 9,000 &#215; g for 30 s. Incubate for 5 min and then centrifuge for 10 min at 12,000 &#215; g and 4 &#176;C.</li>
		<li>Transfer the supernatant to a new centrifuge tube. Add 100 &#181;L of chloroform, cap the tube, and mix by inverting the tube several times. Incubate for 3 min and then centrifuge for 10 min at 12,000 &#215; g at 4 &#176;C.</li>
		<li>Transfer the supernatant to a new centrifuge tube. Add 250 &#181;L of isopropyl alcohol and vortex vigorously. Centrifuge at 12,000 &#215; g for 10 min.&#160;</li>
		<li>Discard the supernatant. Add 500 &#181;L of 75% ethanol to wash the RNA and then vortex the sample. Centrifuge it for 5 min at 12,000 &#215; g and 4 &#176;C.</li>
		<li>Air-dry the RNA pellet for 5 min.</li>
		<li>Resuspend the pellet in 30 &#181;L of RNase-free water.</li>
		<li>Calculate the RNA concentration using the formula: A260 &#215; dilution &#215; 40 = &#181;g RNA/mL. Calculate the A260/A280 ratio. 
		&#8203;NOTE: A ratio of ~2 is considered pure.</li>
	</ol>
	</li>
	<li>Perform reverse transcription of good quality RNA to obtain the cDNA template.
	<ol>
		<li>Design and use a pair of specific primers, ppm-1-F/R (see the Table of Materials), to amplify the partial coding sequence of the Bx-ppm-1 gene in B. xylophilus (GenBank accession number QTZ96795).</li>
		<li>Clone the ppm-1 gene sequences into the pGEM-Teasy vector containing the T7 promoter following a standard cloning protocol11.
		<ol>
			<li>Set up the PCR reactions as follows: 2 &#181;L of cDNA, 25 &#181;L of 2x Ex Taq Polymerase Premix, 2 &#181;L of each primer (10 pmol/l), and sterile distilled water to a final volume of 50 &#181;L.</li>
			<li>Perform the amplification procedure as follows: 5 min at 94 &#176;C; followed by 35 cycles of 30 s at 94 &#176;C, 30 s at 55 &#176;C, and 1 min at 72 &#176;C; and a final extension step at 72 &#176;C for 5 min.</li>
			<li>Clone the amplified products into a pGEM-T Easy vector for sequencing.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>
2. Synthesis of dsRNA
<ol>
	<li>Prepare the DNA template for dsRNA synthesis using PCR with primers designed to add T7 promoter sites at both ends. Add the T7 promoter sequence to the 5&#39; end of the primers.</li>
	<li>Use the plasmid containing the ppm-1 gene fragment (894 bp) as the template for PCR and recover the fragment containing the T7 promoter11. Use the PCR procedure and system described above.</li>
	<li>Use an in vitro transcription kit to synthesize dsRNA11.
	<ol>
		<li>Thaw the frozen reagents on ice.</li>
		<li>Add 2 &#181;L of 10x reaction buffer, 2 &#181;L of enzyme mix, and 1 &#181;g of DNA to a centrifuge tube. Add nuclease-free water to produce a standard 4 &#181;L reaction. Then, mix equal volumes of the four ribonucleotide solutions (ATP, CTP, GTP, and UTP) together and add 8 &#181;L of the mixture to the tube. Mix thoroughly and incubate at 37 &#176;C for 4 h.</li>
		<li>Add 1 &#181;L of DNase, mix well, and incubate for 15 min at 37 &#176;C.</li>
		<li>Stop the reaction and add 30 &#181;L of nuclease-free water and 30 &#181;L of LiCl precipitation solution to precipitate the RNA. Mix thoroughly. Incubate at -20 &#176;C overnight.</li>
		<li>Centrifuge for 15 min at 12,000 &#215; g and 4 &#176;C. Discard the supernatant.</li>
		<li>Add 1 mL of 75% ethanol to wash the RNA. Vortex the sample and centrifuge it for 10 min at 12,000 &#215; g and 4 &#176;C.</li>
		<li>Air-dry the RNA pellet for 3 min.</li>
		<li>Resuspend the pellet in 30 &#181;L of RNase-free water.</li>
		<li>Analyze the quality of the dsRNA using a spectrophotometer. Pipette 1 &#181;L of the dsRNA sample onto the measurement pedestal and set the wavelength to 340 nm. Visualize the products on a 1.0% agarose gel.</li>
	</ol>
	</li>
</ol>
3. RNAi by soaking
<ol>
	<li>Mix 4 &#181;L of 5x soaking buffer (0.05% gelatin, 5.5 mM KH2PO4, 2.1 mM NaCl, 4.7 mM NH4Cl, 3 mM spermidine) with the dsRNA and ddH2O to produce a total volume of 20 &#181;L and a final RNA concentration of 0.8 &#181;g/&#956;L.</li>
	<li>Acquire J2 larvae.
	<ol>
		<li>Collect the nematodes from the fungal cultures and transfer them to a glass Petri dish 6 cm in diameter. Add 10 mL of water to the dish to ensure that the nematodes can swim freely. Keep the nematodes in the dish for 30 min and wait for the eggs to adhere to the bottom.</li>
		<li>Remove the water and nematodes carefully, making sure not to disturb the eggs. Repeat the steps until all the larvae and adults are removed, leaving only the eggs in the dish.</li>
		<li>Hatch the collected eggs for 24 h in the dark at 25 &#176;C to obtain J2 larvae. Collect the J2 larvae, place them in a tube, and wash them three times with ddH2O for the RNAi experiment15.</li>
		<li>Transfer the J2 larvae to the 2 mL tube containing the dsRNA solution and add resorcinol solution (wrapped in tinfoil and dissolved in water) to produce a final concentration of 1.0%. Incubate the larvae with centrifugation at 15&#160;&#215;&#160;g on a shaking table for 24 h at 25 &#176;C to ensure that the larvae effectively absorb the dsRNA.</li>
		<li>Soak the same quantity of nematodes in the soaking buffer without the dsRNA probe or with a GFP dsRNA probe as a control. Use the GFP gene (gfp, M62653.1) as a nonendogenous control and synthesize the dsRNA of gfp using gene-specific primers T7-GFP-F/R.</li>
	</ol>
	</li>
</ol>
4. qPCR detection
<ol>
	<li>Clean the J2 larvae with ddH2O, including those with target gene interference, GFP gene interference, and the undisturbed control group. Extract the total RNAs from each group using the method described above.</li>
	<li>Start the qPCR.
	<ol>
		<li>Design the q-ppm-1-F/R primers using the desired software (see the Table of Materials).</li>
		<li>Set up the qPCR reaction in 12 &#181;L containing 1 &#181;L of cDNA, 6 &#181;L of fluorescent premix, 0.4 &#181;L of each primer (10 pmol/l), and sterile distilled water.</li>
		<li>Perform qPCR as follows: 2 min at 95 &#176;C; followed by 40 cycles of 10 s at 95 &#176;C, 30 s at 55 &#176;C, and 1 min at 72 &#176;C.</li>
		<li>Use the actb gene (GenBank accession number EU100952) and tbb-2 gene (GenBank accession number MT769316),&#160;or other genes, as internal reference genes to evaluate the changes in gene expression level after RNAi15.</li>
	</ol>
	</li>
	<li>According to the cycle threshold (Ct) value and the dissolution curve, use the 2-&#916;&#916;Ct method to estimate the relative expression level of the target gene and verify the interference efficiency.
	<ol>
		<li>Subtract the Ct value of the internal reference gene of each sample from the Ct value of the target gene to obtain the &#916;Ct value. Then, subtract the &#916;Ct value of the interference group from the &#916;Ct value of the control group to obtain the &#916;&#916;Ct value. 
		&#8203;NOTE: A &#916;&#916;Ct value greater than 0 indicates that the interference is effective.</li>
	</ol>
	</li>
</ol>
5. Evaluate the body length of nematode adults following RNAi
<ol>
	<li>After RNAi, culture the J2 larvae until adulthood on B. cinerea lawns in PDA plates for 60 h at 25 &#176;C15.</li>
	<li>Collect the adults using the Bellman funnel method (see step 1.1.2.1)14.</li>
	<li>Acquire images of the adult nematodes under a microscope and use ImageJ software (or other measurement software) to measure the body lengths.
	<ol>
		<li>Measure the length using ImageJ by selecting Analyze | Set Scale. If the distance is known, enter the length value of the drawn straight line. Enter the unit of length.</li>
		<li>Check the Global check box (use this standard for all pictures), and click OK to select the length to be measured with a straight line on the image to be measured.</li>
		<li>Use the command Ctrl+M (measurement) to display the results and record them in the results window.</li>
	</ol>
	</li>
	<li>Take measurements of 50 male and 50 female nematodes for statistical analysis12.</li>
	<li>Analyze the data by calculating the mean and standard deviation for each sample. Compare the means of the samples from the different groups using the Student&#39;s t-test.</li>
</ol>

<ol><li>Nicol, J. M., et al. Current nematode threats to world agriculture. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aNicol%2C+JM+%22Genomics+and+Molecular+Genetics+of+Plant-Nematode+Interactions%22">Genomics and Molecular Genetics of Plant-Nematode Interactions</a>. Jones, J., Gheysen, G., Fenoll, C. , Springer. Dordrecht. 21-43 (2011).</li>
<li>Jones, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Top+10+plant-parasitic+nematodes+in+molecular+plant+pathology%5BTitle%5D)+AND+%22Molecular+Plant+Pathology%22%5BJournal%5D)">Top 10 plant-parasitic nematodes in molecular plant pathology.</a> Molecular Plant Pathology. 14 (9), 946-961 (2013).</li>
<li>Kikuchi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genomic+insights+into+the+origin+of+parasitism+in+the+emerging+plant+pathogen+Bursaphelenchus+xylophilus%5BTitle%5D)+AND+%22PLoS+Pathogens%22%5BJournal%5D)">Genomic insights into the origin of parasitism in the emerging plant pathogen Bursaphelenchus xylophilus.</a> PLoS Pathogens. 7 (9), 1002219(2011).</li>
<li>Megen, H. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+phylogenetic+tree+of+nematodes+based+on+about+1200+full-length+small+subunit+ribosomal+DNA+sequences%5BTitle%5D)+AND+%22Nematology%22%5BJournal%5D)">A phylogenetic tree of nematodes based on about 1200 full-length small subunit ribosomal DNA sequences.</a> Nematology. 11 (6), 927-950 (2009).</li>
<li>Niu, J. H., Jian, H., Xu, J. M., Guo, Y. D., Liu, Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((RNAi+technology+extends+its+reach%3A+Engineering+plant+resistance+against+harmful+eukaryotes%5BTitle%5D)+AND+%22African+Journal+of+Biotechnology%22%5BJournal%5D)">RNAi technology extends its reach: Engineering plant resistance against harmful eukaryotes.</a> African Journal of Biotechnology. 9 (45), 7573-7582 (2010).</li>
<li>Fire, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Potent+and+specific+genetic+interference+by+double-stranded+RNA+in+Caenorhabditis+elegans%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.</a> Nature. 91 (6669), 806-811 (1998).</li>
<li>Shahid, M., Imran, A., Mazhar, H., Yusuf, Z., Rob, W. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Engineering+novel+traits+in+plants+through+RNA+interference%5BTitle%5D)+AND+%22Trends+in+Plant+Science%22%5BJournal%5D)">Engineering novel traits in plants through RNA interference.</a> Trends in Plant Science. 11 (11), 559-565 (2006).</li>
<li>Marmonier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((In+vitro+acquisition+of+specific+small+interfering+RNAs+inhibits+the+expression+of+some+target+genes+in+the+plant+ectoparasite+Xiphinema+index%5BTitle%5D)+AND+%22International+Journal+of+Molecular+Sciences%22%5BJournal%5D)">In vitro acquisition of specific small interfering RNAs inhibits the expression of some target genes in the plant ectoparasite Xiphinema index.</a> International Journal of Molecular Sciences. 20 (13), 3266(2019).</li>
<li>Iqbal, S., Fosu-Nyarko, J., Jones, M. G. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Attempt+to+silence+genes+of+the+RNAi+pathways+of+the+root-knot+nematode%2C+Meloidogyne+incognita+results+in+diverse+responses+including+increase+and+no+change+in+expression+of+some+genes%5BTitle%5D)+AND+%22Frontiers+in+Plant+Science%22%5BJournal%5D)">Attempt to silence genes of the RNAi pathways of the root-knot nematode, Meloidogyne incognita results in diverse responses including increase and no change in expression of some genes.</a> Frontiers in Plant Science. 11, 328(2020).</li>
<li>Zhou, L. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Molecular+characterization+and+functional+analysis+of+akt-1+in+pinewood+nematode%2C+Bursaphelenchus+xylophilus%5BTitle%5D)+AND+%22Forest+Pathology%22%5BJournal%5D)">Molecular characterization and functional analysis of akt-1 in pinewood nematode, Bursaphelenchus xylophilus.</a> Forest Pathology. 51 (1), 12647(2021).</li>
<li>Zhou, L. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+role+of+mab-3+in+spermatogenesis+and+ontogenesis+of+pinewood+nematode%2C+Bursaphelenchus+xylophilus%5BTitle%5D)+AND+%22Pest+Management+Science%22%5BJournal%5D)">The role of mab-3 in spermatogenesis and ontogenesis of pinewood nematode, Bursaphelenchus xylophilus.</a> Pest Management Science. 77 (1), 138-147 (2021).</li>
<li>Tang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Bxy-fuca+encoding+%CE%B1-L-fucosidase+plays+crucial+roles+in+development+and+reproduction+of+the+pathogenic+pinewood+nematode%2C+Bursaphelenchus+xylophilus%5BTitle%5D)+AND+%22Pest+Management+Science%22%5BJournal%5D)">Bxy-fuca encoding α-L-fucosidase plays crucial roles in development and reproduction of the pathogenic pinewood nematode, Bursaphelenchus xylophilus.</a> Pest Management Science. 76 (1), 205-214 (2020).</li>
<li>Wang, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Molecular+characterization+and+functional+analysis+of+daf-8+in+the+pinewood+nematode%2C+Bursaphelenchus+xylophilus%5BTitle%5D)+AND+%22Journal+of+Forestry+Research%22%5BJournal%5D)">Molecular characterization and functional analysis of daf-8 in the pinewood nematode, Bursaphelenchus xylophilus.</a> Journal of Forestry Research. , (2021).</li>
<li>Viglierchio, D. R., Schmitt, R. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((On+the+methodology+of+nematode+extraction+from+field+samples%3A+Baermann+funnel+modifications%5BTitle%5D)+AND+%22Journal+of+Nematology%22%5BJournal%5D)">On the methodology of nematode extraction from field samples: Baermann funnel modifications.</a> Journal of Nematology. 15 (3), 438-444 (1983).</li>
<li>Zhu, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Observation+and+quantification+of+mating+behavior+in+the+pinewood+nematode%2C+Bursaphelenchus+xylophilus%5BTitle%5D)+AND+%22Journal+of+Visualized+Experiments%3A+JoVE%22%5BJournal%5D)">Observation and quantification of mating behavior in the pinewood nematode, Bursaphelenchus xylophilus.</a> Journal of Visualized Experiments: JoVE. (118), e54842(2016).</li>
<li>Zhou, L. F., Chen, F. M., Ye, J. R., Pan, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Selection+of+reliable+reference+genes+for+RT-qPCR+analysis+of+Bursaphelenchus+mucronatus+gene+expression+from+different+habitats+and+developmental+stages%5BTitle%5D)+AND+%22Frontiers+in+Genetics%22%5BJournal%5D)">Selection of reliable reference genes for RT-qPCR analysis of Bursaphelenchus mucronatus gene expression from different habitats and developmental stages.</a> Frontiers in Genetics. 9, 269-279 (2018).</li>
<li>Wang, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Double-stranded+RNA-mediated+interference+of+dumpy+genes+in+Bursaphelenchus+xylophilus+by+feeding+on+filamentous+fungal+transformants%5BTitle%5D)+AND+%22International+Journal+for+Parasitology%22%5BJournal%5D)">Double-stranded RNA-mediated interference of dumpy genes in Bursaphelenchus xylophilus by feeding on filamentous fungal transformants.</a> International Journal for Parasitology. 46 (5-6), 351-360 (2016).</li>
<li>Ma, H. B., Lu, Q., Liang, J., Zhang, X. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Functional+analysis+of+the+cellulose+gene+of+the+pine+wood+nematode%2C+Bursaphelenchus+xylophilus%2C+using+RNA+interference%5BTitle%5D)+AND+%22Genetics+and+Molecular+Research%3A+GMR%22%5BJournal%5D)">Functional analysis of the cellulose gene of the pine wood nematode, Bursaphelenchus xylophilus, using RNA interference.</a> Genetics and Molecular Research: GMR. 10 (3), 1931-1941 (2011).</li>
<li>Cheng, X. Y., Dai, S. M., Xiao, L., Xie, B. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Influence+of+cellulase+gene+knock+down+by+dsRNA+interference+on+the+development+and+reproduction+of+the+pine+wood+nematode%2C+Bursaphelenchus+xylophilus%5BTitle%5D)+AND+%22Nematology%22%5BJournal%5D)">Influence of cellulase gene knock down by dsRNA interference on the development and reproduction of the pine wood nematode, Bursaphelenchus xylophilus.</a> Nematology. 12 (12), 225-233 (2010).</li>
<li>Xue, Q., Wu, X. Q., Zhang, W. J., Deng, L. N., Wu, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cathepsin+L-like+cysteine+proteinase+genes+are+associated+with+the+development+and+pathogenicity+of+pine+wood+nematode%2C+Bursaphelenchus+xylophilus%5BTitle%5D)+AND+%22International+Journal+of+Molecular+Sciences%22%5BJournal%5D)">Cathepsin L-like cysteine proteinase genes are associated with the development and pathogenicity of pine wood nematode, Bursaphelenchus xylophilus.</a> International Journal of Molecular Sciences. 20 (1), 215(2019).</li>
<li>Tabara, H., Grishok, A., Mello, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((RNAi+in+C.+elegans%3A+Soaking+in+the+genome+sequence%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">RNAi in C. elegans: Soaking in the genome sequence.</a> Science. 282 (5388), 430-431 (1998).</li>
<li>Urwin, P. E., Lilley, C. J., Atkinson, H. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Ingestion+of+double-stranded+RNA+by+pre+parasitic+juvenile+cyst+nematodes+leads+to+RNA+interference%5BTitle%5D)+AND+%22Molecular+Plant-Microbe+Interactions%3A+MPMI%22%5BJournal%5D)">Ingestion of double-stranded RNA by pre parasitic juvenile cyst nematodes leads to RNA interference.</a> Molecular Plant-Microbe Interactions: MPMI. 15 (8), 747-752 (2002).</li>
<li>Bakhetia, M., Charlton, W., Atkinson, H. J., McPherson, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((RNA+interference+of+dual+oxidase+in+the+plant+nematode+Meloidogyne+incognita%5BTitle%5D)+AND+%22Molecular+Plant-Microbe+Interactions%3A+MPMI%22%5BJournal%5D)">RNA interference of dual oxidase in the plant nematode Meloidogyne incognita.</a> Molecular Plant-Microbe Interactions: MPMI. 18 (10), 1099-1106 (2005).</li>
<li>Rosso, M. N., Dubrana, M. P., Cimbolini, N., Jaubert, S., Abad, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Application+of+RNA+interference+to+root-knot+nematode+genes+encoding+esophageal+gland+proteins%5BTitle%5D)+AND+%22Molecular+Plant-Microbe+Interactions%3A+MPMI%22%5BJournal%5D)">Application of RNA interference to root-knot nematode genes encoding esophageal gland proteins.</a> Molecular Plant-Microbe Interactions: MPMI. 18 (7), 615-620 (2005).</li>
<li>Chen, Q., Rehman, S., Smant, G., Jones, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Functional+analysis+of+pathogenicity+proteins+of+the+potato+cyst+nematode+Globodera+rostochiensis+using+RNAi%5BTitle%5D)+AND+%22Molecular+Plant-Microbe+Interactions%3A+MPMI%22%5BJournal%5D)">Functional analysis of pathogenicity proteins of the potato cyst nematode Globodera rostochiensis using RNAi.</a> Molecular Plant-Microbe Interactions: MPMI. 18 (7), 621-625 (2005).</li>
<li>Wang, D. D., Li, Y., Li, J., Xie, B. Y., Chen, G. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Molecular+clone+and+its+RNAi+interference+effect+analysis+of+mapk+gene+in+Bursaphelenchus+xylophilus+%28+in+Chinese%29%5BTitle%5D)+AND+%22Acta+Phytopathologica+Sinica%22%5BJournal%5D)">Molecular clone and its RNAi interference effect analysis of mapk gene in Bursaphelenchus xylophilus ( in Chinese).</a> Acta Phytopathologica Sinica. 46 (5), 662-669 (2016).</li>
<li>Qiu, X., Wu, X., Huang, L., Ye, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Influence+of+Bxpel1+gene+silencing+by+dsRNA+interference+on+the+development+and+pathogenicity+of+the+pine+wood+nematode%2C+Bursaphelenchus+xylophilus%5BTitle%5D)+AND+%22International+Journal+of+Molecular+Sciences%22%5BJournal%5D)">Influence of Bxpel1 gene silencing by dsRNA interference on the development and pathogenicity of the pine wood nematode, Bursaphelenchus xylophilus.</a> International Journal of Molecular Sciences. 17 (1), 125(2016).</li>
<li>Dulovic, A., Streit, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((RNAi-mediated+knockdown+of+daf-12+in+the+model+parasitic+nematode+Strongyloides+ratti%5BTitle%5D)+AND+%22PLoS+Pathogens%22%5BJournal%5D)">RNAi-mediated knockdown of daf-12 in the model parasitic nematode Strongyloides ratti.</a> PLoS Pathogens. 15 (3), 1007705(2019).</li>
<li>Li, L., Zhao, H., Cui, Y., Wei, H., Li, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Research+progress+of+gene+editing+technology%5BTitle%5D)+AND+%22Life+Science+Research%22%5BJournal%5D)">Research progress of gene editing technology.</a> Life Science Research. 21 (3), 268-274 (2017).</li>
<li>Bindhya, C. Y., Karuppannan, V., Kuppuswamy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Host-generated+double+stranded+RNA+induces+RNAi+in+plant-parasitic+nematodes+and+protects+the+host+from+infection%5BTitle%5D)+AND+%22Molecular+and+Biochemical+Parasitology%22%5BJournal%5D)">Host-generated double stranded RNA induces RNAi in plant-parasitic nematodes and protects the host from infection.</a> Molecular and Biochemical Parasitology. 148 (2), 219-222 (2006).</li>
<li>Jiang, Z., Sher, A. K., David, G. H., Ralph, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Next-generation+insect-resistant+plants%3A+RNAi-mediated+crop+protection%5BTitle%5D)+AND+%22Trends+in+Biotechnology%22%5BJournal%5D)">Next-generation insect-resistant plants: RNAi-mediated crop protection.</a> Trends in Biotechnology. 35 (9), 871-882 (2017).</li>
</ol>

No conflicts of interest were declared.

Although the life history and parasitic environment of B. xylophilus are different from those of other nematodes, there has been limited research on the molecular pathogenesis of this plant pathogen. Despite great progress made in the application of CRISPR/Cas9 genome editing technology in C. elegans and other nematodes, only RNAi technology applied to B. xylophilus has been published to date17. RNAi is one of the most powerful tools available to study the gene function ...

<a href="https://app.jove.com/t/6669">This corrects</a> the article <a href="https://dx.doi.org/10.3791/63645-v">10.3791/63645-v</a>

An erratum was issued for:&#160;<a href="https://www.jove.com/t/63645">Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus</a>. The Abstract and Protocol section was updated.

Erratum: Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus

Plant-parasitic nematodes (PPNs) are a continuing threat to food security and forest ecosystems. They cause an estimated 100 billion USD in economic losses each year1, the most problematic of which are primarily root-knot nematodes, cyst nematodes, and pinewood nematodes. The pinewood nematode, Bursaphelenchus xylophilus, is a migratory, endoparasitic nematode, which is the causal pathogen of pine wilt disease2. It has caused great harm to pine forests worldwide3. Using the terminology of Van Megen et al.4, B. xylophilus is a member of the Parasitaphelenchidae and belongs to clade 10, whereas most other major plant parasites belong to clade 12.
As an independent and recently evolved plant parasite, B. xylophilus is an attractive model for comparative studies. To date, there has been substantial research on root-knot nematodes and cyst nematodes belonging to clade 12, which are obligate, sedentary endoparasites and are some of the most intensely studied nematodes. However, conducting further research in this important area comes with a major challenge: the function of parasitism genes is a research bottleneck. Functional studies generally include ectopic expression and knockdown/out experiments but rely on effective genetic transformation protocols for the nematode. As a result, reverse genetics in PPNs almost exclusively relies on gene silencing by RNAi.
RNAi, a mechanism widely present in eukaryotic cells, silences gene expression by introducing double-stranded RNA (dsRNA)5. To date, the posttranscriptional gene-silencing mechanism induced by dsRNA has been found in all studied eukaryotes, and RNAi technology, as a tool of functional genomics research and other applications, has developed rapidly in many organisms. Since the discovery of the RNAi machinery in Caenorhabditis elegans in 19986, RNAi techniques have become effective methods for identifying the gene function of nematodes and are proposed as a new way to effectively control pathogenic nematodes7.
RNAi is technically facile-soaking the juveniles in dsRNA can suffice; however, the efficacy and reproducibility of this approach vary widely with the nematode species and the target gene8. The silencing of 20 genes involved in the RNAi pathways of the root-knot nematode, Meloidogyne incognita, was investigated using long dsRNAs as triggers, resulting in diverse responses, including an increase and no change in the expression of some genes9. These results show that target genes may respond to RNAi knockdown differently, necessitating an exhaustive assessment of their suitability as targets for nematode control via RNAi. However, there is currently a paucity of research on the developmental and reproductive biology of B. xylophilus.
As a continuation of previous work10,11,12,13, we describe here a protocol for applying RNAi to study the function of&#160;the ppm-1 gene of B. xylophilus, including the synthesis of dsRNA, synthetic neurostimulant soaking, and quantitative polymerase chain reaction (qPCR) detection. The knowledge gained from this experimental approach will likely contribute markedly to understanding basic biological systems and preventing pine wilt disease.

<table><tbody><tr><td>Baermann funnel</td><td>n/a</td><td>n/a</td><td>to isolate nematodes</td></tr><tr><td>Beacon Designer 7.9</td><td>Shanghai kangyusheng information technology co.</td><td>n/a</td><td>to design qPCR primers</td></tr><tr><td>Botrytis cinerea</td><td>n/a</td><td>n/a</td><td>as food for nematodes</td></tr><tr><td>&lt;em&gt;Bursaphelenchus xylophilus&lt;/em&gt;</td><td>n/a</td><td>n/a</td><td>its number was NXY61 and was it was originally extracted from diseased&lt;br/&gt; Pinus massoniana in Ningbo, Zhejiang province, China.</td></tr><tr><td>constant temperature incubator</td><td>Shanghai Jing Hong Laboratory Instrument Co.</td><td>H1703544</td><td>to cultur nematodes</td></tr><tr><td>Electrophoresis apparatus</td><td>Bio-Rad Laboratories</td><td>1704466</td><td>to achieve electrophoretic analysis</td></tr><tr><td>Ethanol, 75%</td><td>Sinopharm Chemical Reagent Co.</td><td>80176961</td><td>to extract RNA</td></tr><tr><td>Ex Taq Polymerase Premix</td><td>Takara Bio Inc.</td><td>RR030A</td><td>for PCR</td></tr><tr><td>Ex Taq Polymerase Premix</td><td>Takara Bio Inc.</td><td>RR390A</td><td>for PCR</td></tr><tr><td>Gel imager</td><td>LongGene Scientific Instruments Co.</td><td>LG2020</td><td>to make nucleic acid bands visible</td></tr><tr><td>GraphPad Prism 8</td><td>GraphPad Prism</td><td>n/a</td><td>to analyze the data and make figurs</td></tr><tr><td>High Speed Centrifuge</td><td>Hangzhou Allsheng Instruments Co.</td><td>AS0813000</td><td>centrifug</td></tr><tr><td>High-flux tissue grinder</td><td>Bertin</td><td></td><td>to extract RNA</td></tr><tr><td>ImageJ software</td><td>National Institutes of Health</td><td>n/a</td><td>to measure the body lengths</td></tr><tr><td>isopropyl alcohol</td><td>Shanghai Aladdin Biochemical Technology Co.</td><td>L1909022</td><td>to extract RNA</td></tr><tr><td>Leica DM4B microscope</td><td>Leica Microsystems Inc.</td><td></td><td>to observe nematodes</td></tr><tr><td>magnetic beads</td><td>Aoran science technology co.</td><td>150010C</td><td>to extract RNA</td></tr><tr><td>MEGAscript T7 High Yield Transcription Kit</td><td>Thermo Fisher Scientific Inc.</td><td>AM1333</td><td>to synthesize dsRNA in vitro</td></tr><tr><td>NanoDrop ND-2000 spectrophotometer</td><td>Thermo Fisher Scientific Inc.</td><td>NanoDrop 2000/2000C</td><td>to analyze the quality of the dsRNA</td></tr><tr><td>PCR Amplifier</td><td>Bio-Rad Life Medical Products Co.</td><td>1851148</td><td>to amplify nucleic acid sequence</td></tr><tr><td>Petri dishes</td><td>n/a</td><td>n/a</td><td>to cultur nematodes</td></tr><tr><td>pGEM-T Easy vector</td><td>Promega Corporation</td><td>A1360</td><td>for cloning</td></tr><tr><td>Potato Dextrose Agar (Medium)</td><td>n/a</td><td>n/a</td><td>to cultur &lt;em&gt;Botrytis cinerea&lt;/em&gt;</td></tr><tr><td>Prime Script RT reagent Kit with gDNA Eraser</td><td>Takara Bio Inc.</td><td>RR047B</td><td>to synthetic cDNA</td></tr><tr><td>Primer Premier 5.0</td><td>PREMIER Biosoft</td><td>n/a</td><td>to design PCR primers</td></tr><tr><td>primers:ppm-1-F/R</td><td>Tsingke Biotechnology Co.</td><td>n/a</td><td>F: 5&#039;-GATGCGAAGTTGCCAATCATTCT -3&#039;; R: 5&#039;- CCAGATCCAGTCCACCATACACC -3</td></tr><tr><td>q-ppm-1-F/R</td><td>Tsingke Biotechnology Co.</td><td>n/a</td><td>F: 5&#039;-CATCCGAATGGCAATACAG-3&#039;; R: 5&#039;-ACTATCCTCAGCGTTAGC-3&#039;</td></tr><tr><td>Real-time thermal cycler&amp;nbsp;qTOWER 2.2</td><td>Analytique Jena Instruments (Beijing) Co.</td><td></td><td>for qPCR</td></tr><tr><td>shaking table</td><td>Shanghai Zhicheng analytical instrument manufacturing co.</td><td></td><td>to soak nematodes</td></tr><tr><td>stereoscopic microscope</td><td>Chongqing Optec Instrument Co.</td><td>1814120</td><td>to observe nematodes</td></tr><tr><td>T7-GFP-F/R</td><td>Tsingke Biotechnology Co.</td><td>n/a</td><td>F: 5&#039;-TAATACGACTCACTATAGGGAAA&lt;br/&gt; GGAGAAGAACTTTTCAC-3&#039;; R: 5&#039;-TAATACGACTCACTATAGGGCTG&lt;br/&gt; TTACAAACTCAAGAAGG-3&#039;</td></tr><tr><td>&amp;nbsp;T7 promoter</td><td>Tsingke Biotechnology Co.</td><td>n/a</td><td>TAATACGACTCACTATAGGG</td></tr><tr><td>Takara MiniBEST Agarose Gel DNA Extraction Kit</td><td>Takara Bio Inc.</td><td>9762</td><td>to recover DNA</td></tr><tr><td>TaKaRa TB Green Premix Ex Taq (Tli RNaseH Plus)</td><td>Takara Bio Inc.</td><td>RR820A</td><td>for qPCR</td></tr><tr><td>trichloroethane</td><td>Shanghai LingFeng Chemical Reagent Co.</td><td></td><td>to extract RNA</td></tr><tr><td>TRIzol Reagent</td><td>Thermo Fisher Scientific Inc.</td><td>15596026</td><td>total RNA extraction reagent,to extract RNA</td></tr></tbody></table>

application of rna interference in the pinewood nematode, bursaphelenchus xylophilus

Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus

The pinewood nematode, Bursaphelenchus xylophilus, is one of the most destructive invasive species worldwide, causing the wilting and eventual death of pine trees. Despite the recognition of their economic and environmental significance, it has thus far been impossible to study the detailed gene functions of plant-parasitic nematodes (PPNs) using conventional forward genetics and transgenic methods. However, as a reverse genetics technology, RNA interference (RNAi) facilitates the study of the functional genes of nematodes, including B. xylophilus. 
This paper outlines a new protocol for RNAi of the ppm-1 gene in B. xylophilus, which has been reported to play crucial roles in the development and reproduction of other pathogenic nematodes. For RNAi, the T7 promoter was linked to the 5&#8242;-terminal of the target fragment by polymerase chain reaction (PCR), and double-stranded RNA (dsRNA) was synthesized by in vitro transcription. Subsequently, dsRNA delivery was accomplished by soaking the nematodes in a dsRNA solution mixed with synthetic neurostimulants. Synchronized juveniles of B. xylophilus (approximately 20,000 individuals) were washed and soaked in dsRNA (0.8 &#181;g/&#956;L) in the soaking buffer for 24 h in the dark at 25 &#176;C.
The same quantity of nematodes was placed in a soaking buffer without dsRNA as a control. Meanwhile, another identical quantity of nematodes was placed in a soaking buffer with green fluorescent protein (gfp) gene dsRNA as a control. After soaking, the expression level of the target transcripts was determined using real-time quantitative PCR. The effects of RNAi were then confirmed using microscopic observation of the phenotypes and a comparison of the body size of the adults among the groups. The current protocol can help advance research to better understand the functions of the genes of B. xylophilus and other parasitic nematodes toward developing control strategies through genetic engineering.

Analysis of ppm-1 expression of B. xylophilus after RNAi 
The relative expression level of the ppm-1 gene of B. xylophilus soaked with GFP dsRNA and that soaked with target gene dsRNA was 0.92 and 0.52, respectively (the ppm-1 gene expression level of the ddH2O-treated control group was set to 1) (Figure 1). Thus, exogenous dsRNA has no effect on the...

Here, we introduce a detailed soaking method of RNA interference in Bursaphelenchus xylophilus to facilitate the study of gene functions.

The pinewood nematode, Bursaphelenchus xylophilus, is one of the most destructive invasive species worldwide, causing the wilting and eventual death of ...

RNAi has become an effective method for identifying the function of genes in nematodes and are proposed as a new way to effectively control pathogenic nematodes. RNAi is soaking nematodes in dsRNA can suffice for the procedure. To begin, collect the nematodes by the Baermann funnel method.For this, place a clamped rubber tube below a funnel and place two layers of filter paper in the mouth of the funnel. Transfer the Botrytis cinerea fungal cultures to the funnel and add water to immerse the fungal mat. When nematodes are collected, add 500 microliters of extraction reagent and 100 microliters of magnetic beads to a two milliliter centrifuge tube.Aspirate 20 microliters of the nematodes and grind the samples at 9, 000 x g for 30 seconds. Incubate for five minutes and centrifuge at 12, 000 x g for 10 minutes at four degrees Celsius. Transfer the supernatant to a fresh centrifuge tube.Add 100 microliters of chloroform and mix by inverting the tube several times. Incubate for three minutes and then centrifuge at 12, 000 x g for 10 minutes at four degrees Celsius. Again, transfer the supernatant to a fresh centrifuge tube.Add 250 microliters of isopropyl alcohol and vortex vigorously. Centrifuge at 12, 000 x g for 10 minutes and vortex. Discard the supernatant and add 500 microliters of 75%ethanol to wash the RNA.Vortex the sample followed by centrifugation at 12, 000 x g for five minutes at four degrees Celsius. Air dry the RNA pellet for five minutes and resuspend it in 30 microliters of RNase free water. Calculate the RNA concentration using this formula and calculate the A260 to A280 ratio.Next, use a pair of primers to amplify the partial coding sequence of the BX ppm-1 gene from the B.xylophilus. Then clone the ppm-1 one gene sequences into a pGEM-T Easy vector containing the T7 promoter. Recover the 894 base pair long ppm-1 gene fragment by using the cloned plasmid as the template for pcr.Then, use an in vitro transcription kit to synthesize the dsRNA. Analyze the quality of the dsRNA using a spectrophotometer and visualize the products on a 1%agarose gel. Add four microliters of 5X soaking buffer and make up the volume to 20 microliters with double distilled water to get a final RNA concentration of 0.8 micrograms per milliliter.Then place the nematodes in the dish for 30 minutes and wait for the eggs to adhere to the bottom. Carefully remove the water and nematodes without disturbing the eggs until only the eggs remain in the dish. Hatch the collected eggs in the dark at 25 degree Celsius for 24 hours to obtain J2 larvae.Collect the larvae in a tube and wash them three times with double distilled water. Then, transfer the larvae into the tube containing the dsRNA solution. To this, add resorcinol solution to get a 1%solution.Place the larvae on a shaking table to ensure sufficient absorption of dsRNA into the larvae. For controls, soak the same quantity of nematodes in the soaking buffer without the dsRNA probe or with a GFP dsRNA probe. Perform a qPCR using the actB and tbb-2 genes as internal references to evaluate the changes in gene expression level.Use the delta delta Ct method to estimate the relative gene expression level from the dissolution curve and Ct value. After RNAi, culture the J2 larvae until adulthood on Botrytis cinerea lawns on PDA plates. Collect the adults using the Baermann funnel method as shown in section one.Acquire images of the adult nematodes under a microscope and use the ImageJ software to measure the body length of 50 male and 50 female nematodes. Analyze the data by calculating the mean and standard deviation for each sample. Apply Student's t test to compare the means of the samples from the different groups.Relative gene expression analysis after RNAi indicated that the ppm-1 dsRNA can effectively inhibit the expression of the ppm-1 one gene of B.Xylophilus. Whereas exogenous GFP dsRNA had no effect on the ppm-1 expression. After RNAi, the size of the adults markedly decreased despite attaining sexual maturity resulting in the small body size mutant phenotype.The mean body length of the mutant females and males was 544 and 526 micrometers compared to 971 and 912 micrometers for the control group The most important thing is to transfer the nematodes into the double strand RNA solution and add another reagent to stimulate the nematodes to feed. This method is suitable for large scale gene screen and is commonly used in cell research. Studying the gene function of B.Xylophilus by this method has guiding value for the biological control of B.Xylophilus.

application-rna-interference-pinewood-nematode-bursaphelenchus

Research

JoVE Journal

Biology

We demonstrate how to use the RNAi feeding technique to knock down target genes and score body size phenotype in C. elegans. This method could be used for a large scale screen to identify potential genetic components of interest, such as those involved in body size regulation by DBL-1/TGF-β signaling.

Using RNA-mediated Interference Feeding Strategy to Screen for Genes Involved in Body Size Regulation in the Nematode C. elegans

RNA interference (RNAi)-based gene knockdown techniques are at the core of Tribolium research. Here, we provide an overview of our larval RNAi technique in Tribolium castaneum. Larval RNAi is a simple, but powerful technique that provides quick access to loss-of-function phenotypes, allowing researchers to study gene functions in diverse contexts.

Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

RNA interference (RNAi) is an extremely valuable tool for uncovering gene function. However, the ability to target genes using RNAi during pre-adult stages is limited in the major human malaria vector Anopheles gambiae. We describe an RNAi protocol to reduce gene function via direct injection during pupal development.

RNAi Trigger Delivery into Anopheles gambiae Pupae

A protocol for investigating the mating behavior of the pinewood nematode, Bursaphelenchus xylophilus, is presented. Behavioral features of B. xylophilus are described in the mating process.

Observation and Quantification of Mating Behavior in the Pinewood Nematode, Bursaphelenchus xylophilus

Here, we present protocols for rearing an intermediate-germ beetle, Dermestes maculatus (D. maculatus) in the lab. We also share protocols for embryonic and parental RNAi and methods for analyzing embryonic phenotypes to study gene function in this species.

Rearing and Double-stranded RNA-mediated Gene Knockdown in the Hide Beetle, Dermestes maculatus

This article demonstrates novel techniques developed for oral delivery of double-stranded RNA (dsRNA) through the vascular tissues of plants for RNA interference (RNAi) in phloem sap feeding insects.

Double-stranded RNA Oral Delivery Methods to Induce RNA Interference in Phloem and Plant-sap-feeding Hemipteran Insects

Entomopathogenic nematodes live in symbiosis with bacteria and together they successfully infect insects by undermining their innate immune system. To promote research on the genetic basis of nematode infection, methods for maintaining and genetically manipulating entomopathogenic nematodes are described.

Culturing and Genetically Manipulating Entomopathogenic Nematodes

The manipulation of RNA interference (RNAi) presents a formidable challenge in many parasitoid species with diminutive size, such as Trichogramma wasps. This study delineated an efficient RNAi method in Trichogramma denrolimi. The present methodology provides a robust model for investigating gene regulation in Trichogramma wasps.

RNA Interference in the Egg Parasitoid, Trichogramma dendrolimi Matsumura

The protocol describes the in vivo and in vitro pinewood nematode infection of Pinus pinaster and their volatilome analysis through Gas Chromatography (GC) and GC coupled to Mass Spectrometry (GC-MS).

Infection of In Vivo and In Vitro Pines with the Pinewood Nematode Bursaphelenchus xylophilus and Isolation of Induced Volatiles

Presented here is a protocol for chitosan/dsRNA nanoparticle delivery in silkworm Bombyx mori larvae to induce gene silencing through ingestion.

Larval RNA Interference in Silkworm Bombyx mori through Chitosan/dsRNA Nanoparticle Delivery

Learn a soaking method for RNA interference in the pinewood nematode Bursaphelenchus xylophilus to study gene function. This technique enables large-scale screening and supports biological control strategies.

Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus

Explore More Videos