A novel and minimally invasive protocol is presented to evaluate the synergistic impact of fuel utilization and circadian rhythms on aging individuals, utilizing peripheral blood mononuclear cells.
Method Article
A novel and minimally invasive protocol is presented to evaluate the synergistic impact of fuel utilization and circadian rhythms on aging individuals, utilizing peripheral blood mononuclear cells.
Aging is associated with multiple physiological changes that contribute synergistically and independently to physical disability and the risk of chronic disease. Although the etiology of age-related physical disability is complex and multifactorial, the decline in mitochondrial function appears to coincide with the progression of functional decline in many older adults. The reason why there is a decrease in mitochondrial function with aging remains elusive, but emerging science indicates that both fuel metabolism and circadian rhythms can influence mitochondrial function.
Recent studies have established that circadian rhythms become disturbed with aging, and that disrupted circadian rhythms have pathological consequences that impact mitochondrial function and overlap with many age-associated chronic diseases. Current quantitative methods for direct assessment of mitochondrial function are invasive and typically require a muscle biopsy, which can pose difficulties with participant recruitment and study adherence, given the perceived levels of potential pain and risk. Thus, an innovative and relatively noninvasive protocol to assess changes in mitochondrial function at the cellular level and circadian patterns in older adults was adapted. Specifically, a real-time metabolic flux analyzer is used to assess the mitochondrial bioenergetic function of white blood cells under differential substrate availability.
The expression of circadian clock genes in white blood cells to cross-correlate with the mitochondrial bioenergetics and circadian rhythm outcomes are also analyzed. It is believed that these innovative methodological approaches will aid future clinical trials by providing minimally invasive methods for studying mitochondrial substrate preference and circadian rhythms in older adults.
Advancements in the past century have led to an increase in life expectancy and the population of aging adults. Looking to the future, the percentage of adults aged 65 years and older is projected to increase by 5% from 2020 to 2050 in the United States1. This increase in life expectancy does not imply an increase in health span-the period of life associated with independent functioning. The reality is that aging is accompanied by countless biological changes that affect cellular metabolism and physiology, producing gradual declines in cognitive and physical functioning2,3. As human life expectancy continues to increase, there is a greater need to preserve functional ability and independence with age4.
It has been long known that the decline in physical function and independence with age is multifactorial, though it is frequently associated with the onset of chronic disease and acute inciting events5. Conversely, it has been shown that these declines in physical performance and muscle characteristics are associated with the development of disability with age with no clear connection to a single disease6. With the difficulties in knowing the exact etiology of chronic disease and physical disability, impairments in mitochondrial function have been thought to coincide with the onset and progression of chronic disease and loss of physical function in aging adults7,8.
The mitochondria provide the majority of adenosine triphosphate (ATP), necessary for many cellular processes9. Highly oxidative tissues rely on mitochondria for adequate energy production; with aging, oxidative capacity and mitochondrial ATP synthesis decline. This decline is due in part to oxidative damage to mitochondrial DNA (mtDNA), which results in an incremental accumulation of mtDNA mutations and deletions10. The accumulation of mtDNA mutations and deletions cause a decrease in the formation of functional electron transport chain proteins, thus causing a reduced ability of cells to produce ATP. The age-associated decline in mitochondrial function is most notable in highly oxidative tissues, such as the heart and skeletal muscle11. Studies have demonstrated that the gastrocnemius muscle mitochondria in older rat samples exhibit an approximately 50% reduction in ATP production and content compared to younger samples12. Furthermore, it has been shown that the capacity of mitochondrial ATP production in human skeletal muscle decreases by approximately 8% per decade of life13. These findings suggest that age-related declines in mitochondrial function may contribute to decreased energy production in organisms.
A key regulator of mitochondrial activity is thought to be peroxisome proliferator-activated receptor γ (PPARγ) coactivator-1 (PGC-1α)14. Deterioration in PGC-1α activity or a decline in its abundance leads to reduced mitochondrial oxidative activity, and consequently, impaired energy production. Furthermore, a decline in mitochondrial quality may affect skeletal muscle quality and subsequently lead to the development or exacerbation of sarcopenia, dynapenia, and functional capacity decline15,16. Evidence for the age-related concurrent decline in mitochondrial function and skeletal muscle quality suggests a connection between mitochondrial impairment and the pathogenesis of functional decline17. Recently, this has been confirmed in functional community-dwelling older adults, showing that reductions in skeletal muscle mitochondria metabolism predict mobility decline in this population18. Though the exact mechanism leading to mitochondrial decline with age is unclear, recent evidence has highlighted a reciprocal interplay between the circadian clock and mitochondrial function, with consequences for mitochondrial fuel utilization and biogenesis19.
Fuel utilization
Mitochondrial function appears to be influenced by fuel metabolism and the type of fuel utilized at the cellular level in skeletal muscle tissue11. During periods of fuel depletion, specifically carbohydrate depletion in humans, the fuel preference for (mitochondrial) energy production changes. At low glucose levels, the fuel preference shifts away from glucose to fatty acids and acid-derived ketone bodies. This metabolic switch is marked by the upregulation of lipid metabolism in adipocytes followed by an increased release of ketones into the blood4. The shift in fuel utilization from glucose to ketones with a ketogenic diet seems to have a beneficial effect on mitochondrial reactive oxygen species production, antioxidant defense, ATP synthesis, and biogenesis20.
The metabolic switch from carbohydrate to lipid metabolism occurs in periods of low environmental nutrient availability and when glycogen stores have been depleted. When this switch is initiated, stored triglycerides are broken down into glycerol, a substrate for gluconeogenesis, and free fatty acids, which are transported to the liver to be oxidized via β-oxidation into acetyl coenzyme A (acetyl CoA). Ketone bodies are synthesized, mainly in the liver, by a two-step condensation of three acetyl CoA molecules to β-hydroxy-β-methylglutaryl-CoA, which are then further processed into ketone bodies, including acetoacetate and 3-βeta hydroxybutyrate21. These ketone bodies are distributed to tissues throughout the body, with the highest consumption occurring in the heart, brain, and skeletal muscle21. With aging, mitochondrial fatty acid oxidation becomes impaired, thus impacting the metabolic switch22. It has been proposed that impairments in mitochondrial fuel utilization lead to further mitochondrial dysfunction, which in turn contributes to age-related disease and functional decline23.
Changes in mitochondrial oxygen consumption of peripheral blood mononuclear cells (PBMCs) have been studied to assess the patterns associated with dysfunction and vascularization. Hartman et al. conducted a study that aimed to determine the correlation between oxygen consumption and diversely mediated dilation, which was found to suggest a link between mitochondrial dysfunction and vascular smooth muscle cell dysfunction24. Concerning other organs, PBMCs have been correlated with higher cognitive and brain functioning, as determined by respirometry25. Thus, PBMC bioenergetics and respiration capacity can serve as potential biomarkers for assessing the functional capacity of organs or tissues throughout the body.
Circadian rhythm
Another important factor affecting mitochondrial health is circadian rhythm. Circadian rhythms are ~24 h oscillations in behavior and physiology that occur in the absence of environmental cues26. These rhythms function in a predictive way to support system and tissue homeostasis. The mechanism that underlies circadian rhythms is a transcription-translation feedback loop called the circadian clock27. It has been demonstrated over the last 15 years that the circadian clock mechanism exists in virtually all cells throughout the body28. In addition to keeping time, the molecular clock mechanism also contributes to a daily program of gene expression, referred to as circadian clock output29. The clock output genes are unique to each tissue type and are functionally associated with pathways important for cell metabolism, autophagy, repair, and homeostasis. Recent evidence has shown that mitochondrial health is dependent on circadian clock function and influences mitochondrial function, including mitochondrial biogenesis, fuel utilization, and mitophagy30.
Emerging evidence in both preclinical and clinical studies has demonstrated that throughout aging, there are disturbances in circadian rhythms31. These include disruptions in normal sleep and wake cycles, a diminished amplitude in core body temperature rhythms, and a delayed ability to adjust to shifts in phase31. One study, for example, challenged the circadian system of adult and old (20+ months) mice by shifting the light schedule by 6 h. It was found that the old mice took longer to re-entrain their activity patterns to the new light schedule32. Consistent with the changes in circadian behavior, analysis of the tissue clocks found that both central and peripheral tissue clocks were impaired in the aging cohort.
More recently, several groups have performed transcriptomic analysis of the circadian clock and clock output across different tissues with age33. The outcomes of these studies highlight that there is large-scale reprogramming of the circadian clock output with age. This means that even though the core clock maintains a timing function, the genes targeted for daily expression are largely different. For example, two studies have collected muscle biopsies from human subjects every 4 h for 24 h, the results determining that the peak and trough of clock gene expression are reversed between nocturnal rodents and diurnal humans34,35,36. This indicates that when clock gene expression is compared based solely on active versus rest phase (and not light vs. dark), the patterns of clock gene expression in the muscles are virtually the same between species. It is proposed that this age-associated change in clock output results in impairments in the regulation of pathways that include the known hallmarks of aging, such as mitochondrial function, DNA damage and repair, and autophagy37.
Study rationale
The connection between mitochondrial function and decline in physical function is well established. However, the underlying cause of mitochondrial dysfunction remains a subject of debate. Recent research suggests that cellular fuel utilization and circadian rhythms may play a role in this process. Traditional methods for evaluating mitochondrial function, such as measuring mitochondrial oxygen consumption in a muscle biopsy sample, are often perceived as painful and invasive, which may discourage participation, particularly in populations with low muscle mass, such as frail and sarcopenic adults38.
Given these limitations, there is a need for a less invasive method for assessing changes in cellular fuel utilization and circadian rhythm in older adults. This study aims to evaluate a novel, minimally invasive protocol that can be used to assess fuel metabolism and circadian rhythm in this population. The results of this study will contribute to a better understanding of age-related changes and the response to medical or behavioral interventions, serving as a model for future studies in this field.
Procedures involving human participants have been approved by the research ethics committee (Florida Ethics Policy 1.0104) and the Institutional Review Board of the University of Florida.
1. Mitochondrial function
2. Circadian clock gene expression
NOTE: Participants' expression of clock genes from PBMCs will be reviewed by isolating RNA using the RNA blood kit (see Table of Materials).
3. Data analysis plan
NOTE: A medical inventory will be used to categorize participants based on medication usage43.
The proposed protocol includes preliminary data that serves as validation for the methodology. The protocol incorporates a real-time metabolic flux analyzer to examine mitochondrial function and cellular fuel utilization, and RNA extraction and qRT-PCR to analyze circadian rhythm genes (e.g., BMAL1, CLOCK, Nfil2, Nr1d1, Dbp, Cry1, Per2).
The oxygen consumption rate (OCR) of isolated human PBMCs from five control participants, 10 days after an initial analysis, is presented in Figure 1. The data is used to compare pre- and post-values and shows the average values for basal respiration, acute response, maximal respiration, and spare capacity following the injection of a control, etomoxir, UK5099, and BPTES. Notably, Figure 1C shows a significant negative acute response following the etomoxir injection, but no significant effects were observed for basal respiration, maximal respiration, or spare capacity.

Figure 1: Oxygen consumption of isolated human peripheral blood mononuclear cells (PBMCs). (A) Real-time oxygen consumption rate (OCR; pmol/(min∙150,000 cells) of PBMCs isolated from a control subject, measured with a Flux Analyzer and assessed with the substrate oxidation assay. Cells were seeded at a density of 150,000 cells/well. The first injection was either media (control) or inhibitor (etomoxir, UK5099, or BPTES; see text for details) and occurred after measuring the basal cellular respiration rate. The acute response to the mitochondrial substrate limitation was determined as the difference of basal OCR before and after inhibitor injection. Oligomycin, the ATP synthase inhibitor, inhibits ATP-production coupled respiration and yields proton leak respiration. FCCP, the uncoupler, induces maximal, uncoupled respiration; rotenone and antimycin A (inhibitors of complex I and III, respectively) inhibit all but non-mitochondrial respiration (see text for details). (B-E) Quantification of cellular respiration (n = 5; data are represented as mean ± SD). (B) Basal OCR before inhibitor injection, (C) acute response to the inhibitor (change in OCR relative to the basal rate before inhibitor injection), (D) maximal OCR, and (E) spare capacity (difference between maximal OCR and basal OCR after the first injection). The acute response (C) to etomoxir injection might suggest a higher dependence of OCR on fatty acid as an energy substrate under basal conditions compared to the other substrate groups, without a noticeable effect on OCR during high energy demand (D). Please click here to view a larger version of this figure.
| Compound | AM (μL) added to compound | Stock (μM) | stock (μL) for working stock | AM (μL) for working stock | Working stock (μM) | Working stock (μL) [port] | Final conc. (μM) |
| Etomoxir | 700 | 160 | 500 | 1500 | 40 | 20 [A] | 4 |
| UK5099 | 700 | 80 | 500 | 1500 | 20 | 20 [A] | 2 |
| BPTES | 700 | 120 | 500 | 1500 | 30 | 20 [A] | 3 |
| oligo | 420 | 150 | 300 | 2700 | 15 | 22 [B] | 1.5 |
| FCCP | 720 | 100 | 600 | 2400 | 20 | 25 [C] | 2 |
| Rot/AA/H | 540 | 50 | 300 | 2700 | 5 | 27 [D] | 0.5 |
Table 1: Preparation of reagents for the substrate oxidation test and concentrations of stock, working, and final solutions. All reagents are part of the cell mito stress test or the substrate oxidation stress test kits. Abbreviations: oligo = oligomycin; FCCP = uncoupler carbonyl cyanide-4 (trifluoromethoxy) phenylhydrazone; Rot/AA/H = rotenone/antimycin A/Hoechst 33342. Etomoxir, UK5099, BTPES: inhibitors of fatty acid, glucose, and glutamine oxidation, respectively.
| Bmal1 | Forward – GCACGACGTTCTTTCTTCTGT |
| Reverse – GCAGAAGCTTTTTCGATCTGCTTTT | |
| Clock | Forward – CGTCTCAGACCCTTCCTCAAC |
| Reverse – GTAAATGCTGCCTGGGTGGA | |
| Cry1 | Forward – ACTGCTATTGCCCTGTTGGT |
| Reverse – GACAGGCAAATAACGCCTGA | |
| Per1 | Forward – ATTCGGGTTACGAAGCTCCC |
| Reverse – GGCAGCCCTTTCATCCACAT | |
| Per2 | Forward – CATGTGCAGTGGAGCAGATTC |
| Reverse – GGGGTGGTAGCGGATTTCAT | |
| Rev-erb α | Forward – ACAGATGTCAGCAATGTCGC |
| Reverse – CGACCAAACCGAACAGCATC |
Table 2: Circadian clock gene primers.
The decline in mitochondrial function and regulation of circadian rhythm with age are increasingly viewed as contributing factors to age-related diseases. Altering circadian rhythms through lifestyle modifications, such as diet and physical activity, represents a potential strategy to promote healthy aging and reduce mobility declines associated with aging. However, current methods for directly evaluating mitochondrial function are invasive and often require a muscle biopsy, which can pose challenges with participant recruitment and retention due to perceived pain and risks.
Assessing markers of circadian and metabolic health through less invasive methods, such as blood collection, would provide valuable outcomes for exploring and testing therapeutic targets in future studies. These minimally invasive methods have the potential to greatly advance the field by providing new insights into the complex interplay between circadian rhythm and metabolic health and their impact on function. The goal of this study is to evaluate the relationship between cellular energy metabolism and circadian rhythm. In particular, bioenergetic flux analysis is used to evaluate mitochondrial function under various substrate availability conditions, along with gene expression monitoring of a group of circadian genes in participants' white blood cells. By employing both arms of the analysis, bioenergetic and gene expression, a comprehensive understanding of the relationship between these two fundamental processes can be achieved.
The statistical analysis of this time series data from a circadian perspective offers insight into the strength, range, and timing of the circadian rhythms. In conclusion, the integration of gene expression analysis, cellular bioenergetics, and metabolic measures at the organism level constitutes a new and innovative approach that will shed light on the interplay between energy metabolism and circadian rhythms in humans.
In a pilot study, we detected an acute response in the OCR of PBMCs to the limitation of fatty acid utilization (following injection of etomoxir, an inhibitor of carnitine palmitoyl transferase 1a). This finding suggests that in PBMCs from this particular group of participants, there might be a dependence on fatty acids as an energy substrate during basal respiration. However, maximal respiration was not impacted, suggesting that alternative energy sources, such as glucose and glutamine, may compensate for the reduced utilization of fatty acids during high energy demand. Future studies should investigate whether a) bioenergetics of PBMCs are reflective of whole-body energetics and b) whether interventions such as time restricted eating could affect energy substrate preferences.
There are several critical steps concerning the flux analysis of PBMCs. First, before experimental samples are assessed, the cell seeding density (cells per well) should be optimized by making sure that there is a continuous uniform distribution of cells within each well and across each plate, the final FCCP concentration should be optimized by running concentrations test runs using the concentrations 0, 0.125, 0.25, 0.5, 1.0, and 2.0 µM, and, if applicable, the Hoechst 33342 staining should be optimized by following the manufacturer's instructions. Second, the normalization of the metabolic data to cellular parameters is critical for the comparability of the data between experiments. In the present protocol, cell count after the conclusion of the flux analyzer assay using Hoechst 33342-stained cells and a cell imaging device is described. If an appropriate device is not available, alternative normalization methods can be applied, such as total cellular protein or nuclear DNA content per well. There is a noted modification that can be utilized within the protocol, compared to those that have been proposed. Specifically, the protocol can be completed utilizing an individual assay kit for each of the three inhibitors, compared to just the two kits proposed here (see Table of Materials).
The use of PBMCs as a surrogate to study the interplay between energy metabolism and circadian rhythms in older adults is limited by the assumption that their response to treatment can accurately reflect the response in other tissues and organs. Although this approach is novel and minimally invasive, it is important to acknowledge that different tissues and organs, such as the brain, liver, and skeletal muscle, may react differently under various conditions. A preclinical study demonstrated that clock gene expression was altered in fed and fasted mice, leading to the partial upregulation of BMAL1-target genes in liver and muscle tissue, but the downregulation of others41. These peripheral tissues and organs are highly representative of metabolic processes and can be influenced by environmental cues that impact clock gene expression mechanisms42. Further research is needed to fully understand the relationship between peripheral tissues, organs, and the central circadian clock.
Another limitation is that participants are not disqualified for taking any prescription, which might pose limitations to statistical analysis. To counteract this limitation, in future research, a medical inventory will be used, which has been validated in populations of older adults who take medications43. Participants will be categorized based on the recommended medications recorded in the protocol's data review section. There are a total of three categories, in terms of medications that have been shown to 1) accelerate functional decline, 2) slow functional decline, and 3) influence skeletal muscle function.
Lastly, human skeletal muscle mitochondrial oxidative capacity does exhibit a day-night rhythm, peaking between 06:00 pm and 11:00 pm and declining between 08:00 am and 11:00 am44. It is not yet clear if this holds for the mitochondrial oxidative capability of PBMCs. However, preliminary data suggest that PBMCs and mitochondrial metabolism are related45. Given that the information on muscle biopsies and the alterations in PBMCs is not as clear, caution must be taken when analyzing results. Given this limitation, it is important to keep this information in mind when evaluating and developing a protocol, as it may provide valuable context and insight that could aid in ensuring the validity and effectiveness of the protocol.
To the best of our knowledge, no prior studies have assessed the patterns of fuel utilization or circadian rhythms through the methods proposed in this project. Our objective is to examine the responsiveness of markers of mitochondrial fuel utilization and circadian health to changes. This study presents a minimally invasive method for measuring a highly sensitive biomarker, which can serve as an alternative in future interventional studies where muscle biopsy is not feasible.
The authors have no conflicts of interest to disclose.
This study was funded by the Older American's Independence Center (NIH/NIA P30AG028740), with assistance from the Clinical and Translational Science Institute (NIH/NCRR UL1TR000064).
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Agilent Technologies Cell Imaging | Agilent Technologies | Cell image software | |
| Agilent/Seahorse Wave desktop program | Agilent Technologies | 5994-0039EN | Software used to analyse data from the celluar analyser and stress test assay |
| Agilent/Seahorse XFe96 Flux Analyzer | Agilent Technologies | S7800B | Real-time cellular flux analyzer; flux analyser |
| Bar Code Reader | Agilent Technologies | G2615-90007 | |
| Seahorse Wave Desktop Software | Agilent technologies | Data acquisition software; assay analysis; wave program | |
| Seahorse XF 1.0 M Glucose solution | Agilent Technologies | 103577-100 | Supplement to basal medium to make assay medium |
| Seahorse XF 100 mM Pyruvate solution | Agilent Technologies | 103578-100 | Supplement to basal medium to make assay medium |
| Seahorse XF 200 mM Glutamine solution | Agilent Technologies | 103579-100 | Supplement to basal medium to make assay medium |
| Seahorse XF Cell Mito Stress Test | Agilent Technologies | 103015-100 | Mitochondrial bioenergetic function assay |
| Seahorse XF Mito Fuel Flex Test | Agilent Technologies | 103260-100 | Mitochondrial bioenergetic function assay |
| Seahorse XF RPMI Medium | Agilent Technologies | 103576-100 | Basal medium for PBMCs |
| Seahorse XFe96 FluxPak mini | Agilent Technologies | 102601-100 | Sensor cartridges and cell culture microplates |
| Cytation 1 Cell Imaging Multi-Mode Reader | Agilent/BioTek | Multimode reader to image cells | |
| CPT Sodium Heparin Tube, 16 x 125 mm x 8.0 mL | Becton Dickinson | 362753 | Blood collection tubes for isolation of peripheral blood mononuclear cells |
| CellTak Cell and Tissue Adhesive | Corning | 354240 | Cell adherent to coat cell culture microplate |
| Phosphate Buffered Saline | Corning | 21-040-CV | Buffer to wash blood cells |
| Ficoll Paque Plus | Cytiva | GE17-1440-02 | Gradient medium |
| Lunar Prodigy DXA scanner | General Electric | EN 60601-2-7 5.1 | Whole body lean mass and fat/lean tissue mass ratio |
| Freezing container, Nalgene Mr. Frosty | MilliporeSigma | C1562 | Freezing container used to slow-freeze cell suspension |
| Buffer EL. | Qiagen | 79217 | Erythrocyte lysis buffer |
| Buffer RLT | Qiagen | 79216 | RNA lysis buffer |
| Buffer RPE | Qiagen | 1018013 | Mild washing buffer |
| Buffer RW1 | Qiagen | 1053394 | Stringent washing buffer |
| QIAamp DNA Micro Kit | Qiagen | 56304 | DNA preps: QIAamp MinElute Columns, Proteinase K, Carrier RNA, Buffers, Collection Tubes (2 ml) |
| QIAamp RNA Blood Mini Kit | Qiagen | 52304 | RNA blood kit; Used to isolate RNA |
| QIAshredder | Qiagen | 79656 | disposable cell-lysate homogenizers |
| RNase-Free DNase Set | Qiagen | 79254 | Used to perform DNA digest |
| 2-Mercaptoethanol (Reagent) | Thermo Fisher Scientific | MFCD00004890 | |
| 2-mL collection tubes, 100 count | Thermo Fisher Scientific | AM12480 | |
| Fast SYBR Green Master Mix | Thermo Fisher Scientific | 4385612 | Primers are added to this and used to carry out qRT-PCR |
| Microcentrifuge Tubes, 1.5 mL | Thermo Fisher Scientific | 69715 | Used to hold RNA purification filter during RNA purification |
| Narrow p1000 pipette tips | Thermo Fisher Scientific | 02-707-402 | |
| QuantStudio 3 Real-Time PCR System, MiniAmp Plus Thermal Cycler, and 96-Well Plates Package | Thermo Fisher Scientific | A40393 | |
| Tempus Blood RNA Tube | Thermo Fisher Scientific | 4342792 | RNA Tube |
| Tempus Spin RNA Isolation kit | Thermo Fisher Scientific | 4380204 | RNA extraction and isolation |
This article has been published
Video Coming Soon