Name: Multiomics Analysis of TMEM200A as a Pan-Cancer Biomarker (Video) | JoVE Journal
Uploaded: 2023-09-15T14:10:00.000+00:00
Duration: 7 min 47 s
Description: Discover multiomics analysis of TMEM200A as a pan-cancer biomarker using bioinformatics and experimental validation in gastric cancer. This protocol integrates database predictions with siRNA transfection and functional assays.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

This work was supported by the National Natural Science Foundation of China (82160550).

TMEM200A: A Novel Oncogene Regulating EMT and PI3K/AKT in Gastric Cancer

<ol><li>Torre, L. A., Siegel, R. L., Ward, E. M., Jemal, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Global+cancer+incidence+and+mortality+rates+and+trends--an+update%5BTitle%5D)+AND+%22Cancer+Epidemiol+Biomarkers+Prev%22%5BJournal%5D)">Global cancer incidence and mortality rates and trends--an update.</a> Cancer Epidemiol Biomarkers Prev. 25 (1), 16-27 (2016).</li>
<li>Long, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Economic+burden+of+malignant+tumors+-+Yichang+City%2C+Hubei+Province%2C+China%2C+2019%5BTitle%5D)+AND+%22China+CDC+Wkly%22%5BJournal%5D)">Economic burden of malignant tumors - Yichang City, Hubei Province, China, 2019.</a> China CDC Wkly. 4 (15), 312-316 (2022).</li>
<li>Harbeck, N., Gnant, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Breast+cancer%5BTitle%5D)+AND+%22Lancet%22%5BJournal%5D)">Breast cancer.</a> Lancet. 389 (10074), 1134-1150 (2017).</li>
<li>Bagchi, S., Yuan, R., Engleman, E. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Immune+checkpoint+inhibitors+for+the+treatment+of+cancer%3A+clinical+impact+and+mechanisms+of+response+and+resistance%5BTitle%5D)+AND+%22Annu+Rev+Pathol%22%5BJournal%5D)">Immune checkpoint inhibitors for the treatment of cancer: clinical impact and mechanisms of response and resistance.</a> Annu Rev Pathol. 16, 223-249 (2021).</li>
<li>Lam, G. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Pitfalls+in+cutaneous+melanoma+diagnosis+and+the+need+for+new+reliable+markers%5BTitle%5D)+AND+%22Mol+Diagn+Ther%22%5BJournal%5D)">Pitfalls in cutaneous melanoma diagnosis and the need for new reliable markers.</a> Mol Diagn Ther. 27 (1), 49-60 (2023).</li>
<li>Gromiha, M. M., Ou, Y. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Bioinformatics+approaches+for+functional+annotation+of+membrane+proteins%5BTitle%5D)+AND+%22Brief+Bioinform%22%5BJournal%5D)">Bioinformatics approaches for functional annotation of membrane proteins.</a> Brief Bioinform. 15 (2), 155-168 (2014).</li>
<li>Schmit, K., Michiels, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((TMEM+proteins+in+cancer%3A+a+review%5BTitle%5D)+AND+%22Front+Pharmacol%22%5BJournal%5D)">TMEM proteins in cancer: a review.</a> Front Pharmacol. 9, 1345(2018).</li>
<li>Marx, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Transmembrane+%28TMEM%29+protein+family+members%3A+Poorly+characterized+even+if+essential+for+the+metastatic+process%5BTitle%5D)+AND+%22Semin+Cancer+Biol%22%5BJournal%5D)">Transmembrane (TMEM) protein family members: Poorly characterized even if essential for the metastatic process.</a> Semin Cancer Biol. 60, 96-106 (2020).</li>
<li>Fu, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Overexpression+of+transmembrane+protein+168+in+the+mouse+nucleus+accumbens+induces+anxiety+and+sensorimotor+gating+deficit%5BTitle%5D)+AND+%22PLoS+One%22%5BJournal%5D)">Overexpression of transmembrane protein 168 in the mouse nucleus accumbens induces anxiety and sensorimotor gating deficit.</a> PLoS One. 12 (12), e0189006(2017).</li>
<li>Cuajungco, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Abnormal+accumulation+of+human+transmembrane+%28TMEM%29-176A+and+176B+proteins+is+associated+with+cancer+pathology%5BTitle%5D)+AND+%22Acta+Histochem%22%5BJournal%5D)">Abnormal accumulation of human transmembrane (TMEM)-176A and 176B proteins is associated with cancer pathology.</a> Acta Histochem. 114 (7), 705-712 (2012).</li>
<li>Zhang, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((TMEM116+is+required+for+lung+cancer+cell+motility+and+metastasis+through+PDK1+signaling+pathway%5BTitle%5D)+AND+%22Cell+Death+Dis%22%5BJournal%5D)">TMEM116 is required for lung cancer cell motility and metastasis through PDK1 signaling pathway.</a> Cell Death Dis. 12 (12), 1086(2021).</li>
<li>Zhang, N., Pan, H., Liang, X., Xie, J., Han, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+roles+of+transmembrane+family+proteins+in+the+regulation+of+store-operated+Ca%282%2B%29+entry%5BTitle%5D)+AND+%22Cell+Mol+Life+Sci%22%5BJournal%5D)">The roles of transmembrane family proteins in the regulation of store-operated Ca(2+) entry.</a> Cell Mol Life Sci. 79 (2), 118(2022).</li>
<li>Zhang, X., Zheng, P., Li, Z., Gao, S., Liu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+somatic+mutation+landscape+and+RNA+prognostic+markers+in+stomach+adenocarcinoma%5BTitle%5D)+AND+%22Onco+Targets+Ther%22%5BJournal%5D)">The somatic mutation landscape and RNA prognostic markers in stomach adenocarcinoma.</a> Onco Targets Ther. 13, 7735-7746 (2020).</li>
<li>Jia, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Mining+TCGA+database+for+genes+of+prognostic+value+in+glioblastoma+microenvironment%5BTitle%5D)+AND+%22Aging+%28Albany+NY%29%22%5BJournal%5D)">Mining TCGA database for genes of prognostic value in glioblastoma microenvironment.</a> Aging (Albany NY). 10 (4), 592-605 (2018).</li>
<li>Wang, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((UCSCXenaShiny%3A+an+R%2FCRAN+package+for+interactive+analysis+of+UCSC+Xena+data%5BTitle%5D)+AND+%22Bioinformatics%22%5BJournal%5D)">UCSCXenaShiny: an R/CRAN package for interactive analysis of UCSC Xena data.</a> Bioinformatics. 38 (2), 527-529 (2022).</li>
<li>Li, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((TIMER2.0+for+analysis+of+tumor-infiltrating+immune+cells%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">TIMER2.0 for analysis of tumor-infiltrating immune cells.</a> Nucleic Acids Res. 48 (W1), W509-W514 (2020).</li>
<li>Thul, P. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+subcellular+map+of+the+human+proteome%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">A subcellular map of the human proteome.</a> Science. 356 (6340), eaal3321(2017).</li>
<li>Li, Y., Ge, D., Lu, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+SMART+App%3A+an+interactive+web+application+for+comprehensive+DNA+methylation+analysis+and+visualization%5BTitle%5D)+AND+%22Epigenetics+Chromatin%22%5BJournal%5D)">The SMART App: an interactive web application for comprehensive DNA methylation analysis and visualization.</a> Epigenetics Chromatin. 12 (1), 71(2019).</li>
<li>Chandrashekar, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((UALCAN%3A+An+update+to+the+integrated+cancer+data+analysis+platform%5BTitle%5D)+AND+%22Neoplasia%22%5BJournal%5D)">UALCAN: An update to the integrated cancer data analysis platform.</a> Neoplasia. 25, 18-27 (2022).</li>
<li>Tate, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((COSMIC%3A+the+Catalogue+Of+Somatic+Mutations+In+Cancer%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">COSMIC: the Catalogue Of Somatic Mutations In Cancer.</a> Nucleic Acids Res. 47 (D1), D941-D947 (2019).</li>
<li>Gao, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Integrative+analysis+of+complex+cancer+genomics+and+clinical+profiles+using+the+cBioPortal%5BTitle%5D)+AND+%22Sci+Signal%22%5BJournal%5D)">Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal.</a> Sci Signal. 6 (269), pl1(2013).</li>
<li>Shen, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sangerbox%3A+A+comprehensive%2C+interaction-friendly+clinical+bioinformatics+analysis+platform%5BTitle%5D)+AND+%22iMeta%22%5BJournal%5D)">Sangerbox: A comprehensive, interaction-friendly clinical bioinformatics analysis platform.</a> iMeta. 1 (3), e36(2022).</li>
<li>Ru, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((TISIDB%3A+an+integrated+repository+portal+for+tumor-immune+system+interactions%5BTitle%5D)+AND+%22Bioinformatics%22%5BJournal%5D)">TISIDB: an integrated repository portal for tumor-immune system interactions.</a> Bioinformatics. 35 (20), 4200-4202 (2019).</li>
<li>Yuan, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CancerSEA%3A+a+cancer+single-cell+state+atlas%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">CancerSEA: a cancer single-cell state atlas.</a> Nucleic Acids Res. 47 (D1), D900-D908 (2019).</li>
<li>Sun, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((TISCH%3A+a+comprehensive+web+resource+enabling+interactive+single-cell+transcriptome+visualization+of+tumor+microenvironment%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">TISCH: a comprehensive web resource enabling interactive single-cell transcriptome visualization of tumor microenvironment.</a> Nucleic Acids Res. 49 (D1), D1420-D1430 (2021).</li>
<li>Warde-Farley, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+GeneMANIA+prediction+server%3A+biological+network+integration+for+gene+prioritization+and+predicting+gene+function%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">The GeneMANIA prediction server: biological network integration for gene prioritization and predicting gene function.</a> Nucleic Acids Res. 38, W214-W220 (2010).</li>
<li>Zhu, Y., Feng, S., Song, Z., Wang, Z., Chen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Identification+of+immunological+characteristics+and+immune+subtypes+based+on+single-sample+gene+set+enrichment+analysis+algorithm+in+lower-grade+glioma%5BTitle%5D)+AND+%22Front+Genet%22%5BJournal%5D)">Identification of immunological characteristics and immune subtypes based on single-sample gene set enrichment analysis algorithm in lower-grade glioma.</a> Front Genet. 13, 894865(2022).</li>
<li>Mueller Bustin, S. A., R, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Real-time+reverse+transcription+PCR+%28qRT-PCR%29+and+its+potential+use+in+clinical+diagnosis%5BTitle%5D)+AND+%22Clin+Sci+%28Lond%29%22%5BJournal%5D)">Real-time reverse transcription PCR (qRT-PCR) and its potential use in clinical diagnosis.</a> Clin Sci (Lond). 109 (4), 365-379 (2005).</li>
<li>Sun, L., Zhang, H., Gao, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Metabolic+reprogramming+and+epigenetic+modifications+on+the+path+to+cancer%5BTitle%5D)+AND+%22Protein+Cell%22%5BJournal%5D)">Metabolic reprogramming and epigenetic modifications on the path to cancer.</a> Protein Cell. 13 (12), 877-919 (2022).</li>
<li>Ntontsi, P., Photiades, A., Zervas, E., Xanthou, G., Samitas, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genetics+and+epigenetics+in+asthma%5BTitle%5D)+AND+%22Int+J+Mol+Sci%22%5BJournal%5D)">Genetics and epigenetics in asthma.</a> Int J Mol Sci. 22 (5), 2412(2021).</li>
<li>Martínez-Reyes, I., Chandel, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cancer+metabolism%3A+looking+forward%5BTitle%5D)+AND+%22Nat+Rev+Cancer%22%5BJournal%5D)">Cancer metabolism: looking forward.</a> Nat Rev Cancer. 21 (10), 669-680 (2021).</li>
<li>Chen, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((PremPS%3A+Predicting+the+impact+of+missense+mutations+on+protein+stability%5BTitle%5D)+AND+%22PLoS+Comput+Biol%22%5BJournal%5D)">PremPS: Predicting the impact of missense mutations on protein stability.</a> PLoS Comput Biol. 16 (12), e1008543(2020).</li>
<li>Li, M., Petukh, M., Alexov, E., Panchenko, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Predicting+the+impact+of+missense+mutations+on+protein-protein+binding+affinity%5BTitle%5D)+AND+%22J+Chem+Theory+Comput%22%5BJournal%5D)">Predicting the impact of missense mutations on protein-protein binding affinity.</a> J Chem Theory Comput. 10 (4), 1770-1780 (2014).</li>
<li>Hirsch, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Clinical+responses+to+PD-1+inhibition+and+their+molecular+characterization+in+six+patients+with+mismatch+repair-deficient+metastatic+cancer+of+the+digestive+system%5BTitle%5D)+AND+%22J+Cancer+Res+Clin+Oncol%22%5BJournal%5D)">Clinical responses to PD-1 inhibition and their molecular characterization in six patients with mismatch repair-deficient metastatic cancer of the digestive system.</a> J Cancer Res Clin Oncol. 147 (1), 263-273 (2021).</li>
<li>Poulogiannis, G., Frayling, I. M., Arends, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+mismatch+repair+deficiency+in+sporadic+colorectal+cancer+and+Lynch+syndrome%5BTitle%5D)+AND+%22Histopathology%22%5BJournal%5D)">DNA mismatch repair deficiency in sporadic colorectal cancer and Lynch syndrome.</a> Histopathology. 56 (2), 167-179 (2010).</li>
<li>Chintamani, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+expression+of+mismatched+repair+genes+and+their+correlation+with+clinicopathological+parameters+and+response+to+neo-adjuvant+chemotherapy+in+breast+cancer%5BTitle%5D)+AND+%22Int+Semin+Surg+Oncol%22%5BJournal%5D)">The expression of mismatched repair genes and their correlation with clinicopathological parameters and response to neo-adjuvant chemotherapy in breast cancer.</a> Int Semin Surg Oncol. 4, 5(2007).</li>
<li>Deng, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((High+expression+of+TMEM200A+is+associated+with+a+poor+prognosis+and+immune+infiltration+in+gastric+cancer%5BTitle%5D)+AND+%22Pathol+Oncol+Res%22%5BJournal%5D)">High expression of TMEM200A is associated with a poor prognosis and immune infiltration in gastric cancer.</a> Pathol Oncol Res. 29, 1610893(2023).</li>
<li>Stemmler, M. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cadherins+in+development+and+cancer%5BTitle%5D)+AND+%22Mol+Biosyst%22%5BJournal%5D)">Cadherins in development and cancer.</a> Mol Biosyst. 4 (8), 835-850 (2008).</li>
<li>Bill, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((ANO1%2FTMEM16A+interacts+with+EGFR+and+correlates+with+sensitivity+to+EGFR-targeting+therapy+in+head+and+neck+cancer%5BTitle%5D)+AND+%22Oncotarget%22%5BJournal%5D)">ANO1/TMEM16A interacts with EGFR and correlates with sensitivity to EGFR-targeting therapy in head and neck cancer.</a> Oncotarget. 6 (11), 9173-9188 (2015).</li>
<li>De Las Rivas, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cancer+drug+resistance+induced+by+EMT%3A+novel+therapeutic+strategies%5BTitle%5D)+AND+%22Arch+Toxicol%22%5BJournal%5D)">Cancer drug resistance induced by EMT: novel therapeutic strategies.</a> Arch Toxicol. 95 (7), 2279-2297 (2021).</li>
<li>Tian, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((SERPINH1+regulates+EMT+and+gastric+cancer+metastasis+via+the+Wnt%2F%CE%B2-catenin+signaling+pathway%5BTitle%5D)+AND+%22Aging+%28Albany+NY%29%22%5BJournal%5D)">SERPINH1 regulates EMT and gastric cancer metastasis via the Wnt/β-catenin signaling pathway.</a> Aging (Albany NY). 12 (4), 3574-3593 (2020).</li>
</ol>

The authors declare there are no conflicts of interest.

TMEM200A belongs to a family of TMEMs that is essential for cancer cells to proliferate38. The variable expression of TMEM200A in different malignancies has received less attention, and a thorough pan-cancer investigation is lacking. However, evidence continues to accumulate, showing that the TMEM transmembrane protein family may be important in keeping cancer cells malignant through interactions with several proteins, for example, activation of TMEM16A Ca2+-activated ...

Cancer has emerged as a persistent public health issue endangering human health globally1due to its high morbidity and mortality rates worldwide, posing a heavy financial and medical burden to society2. Significant advancements in cancer therapy have been achieved in recent years thanks to the discovery of cancer markers3, and researchers have developed novel diagnostic methods and new drugs to treat cancer. However, some patients with cancer still have poor prognoses because of factors such as medication resistance, side effects of drugs, and chemical sensitivity4. Therefore, there is an urgent need for identifying new biomarkers for screening and treating early-stage cancers5.
Membrane proteins are proteins that can bind and integrate into cells and organelle membranes6. These can be grouped into three categories depending on the strength of binding to the membrane and their location: lipid-anchored proteins, integral proteins, and peripheral membrane proteins7,8. A transmembrane (TMEM) protein is an integral membrane protein that consists of at least one transmembrane segment9, which passes either completely or partially through the biological membrane. 
Although the mechanisms of action of proteins belonging to the TMEM family are not well understood, these proteins are known to be involved in several types of cancers10. Several TMEM proteins are associated with migratory, proliferative, and invasive phenotypes, and their expression is often associated with a patient's prognosis11. Therefore, TMEM family members have become the target of research. A comprehensive review of existing reports on TMEM revealed that they are mostly associated with inter- and intracellular signaling12, immune-related diseases, and tumorigenesis10. Many TMEMs also possess important physiological functions, for example, ion channels in the plasma membrane, activation of signal transduction pathways, as well as the mediation of cell chemotaxis, adhesion, apoptosis, and autophagy10. Therefore, we hypothesized that TMEM proteins may be important prognostic markers in the detection and treatment of tumors.
TMEM200A expression is significantly elevated in gastric cancer (GC). Higher expression of TMEM200A13, which has eight exons and a full length of 77.536 kb on chromosome 6q23.1, has been linked to a poor prognosis for overall survival (OS) in cases of GC. Yet the changes in its expression have rarely been reported in oncology studies. This article compares and analyzes the usefulness of TMEM200A as a therapeutic target and tumor diagnostic marker in various cancer studies using different publicly available datasets. We assessed the effectiveness of TMEM200A as a pan-cancer diagnostic and prognostic biomarker as well as its expression levels in various human cancer types using RNA-seq data from the UCSC Xena and TCGA databases, as well as by real-time quantitative polymerase chain reaction (qRT-PCR) and western blotting. 
The effect of TMEM200A expression levels on mutation rates, regulatory processes, tumor diagnosis and prognosis, immune infiltration, and immunotherapy was further investigated using a mix of computational tools and dataset websites. CBioPortal and the Catalog of Somatic Mutations in Cancer Cells (COSMIC) databases were used to examine mutations in TMEM200A. Sangerbox and TISIDB websites were utilized to understand how TMEM200A influences immune infiltration. The Tumor Immune Single Cell Center (TISCH) online tool and CancerSEA database were used to investigate the function of TMEM200A. Finally, to assess the impact of TMEM200A on the malignant behavior and tumor development function of GC cells, a loss-of-function experiment was conducted in an in vitro assay. Additionally, western blotting was performed to assess how TMEM200A knockdown affected the PI3K/AKT signaling pathway and the epithelial-mesenchymal transition (EMT) in GC.

<table><tbody><tr><td>Anti-AKT antibody</td><td>Proteintech Group, Inc</td><td>60203-2-Ig</td><td></td></tr><tr><td>Anti-E-cadherin antibody</td><td>Proteintech Group, Inc</td><td>20874-1-AP</td><td></td></tr><tr><td>anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) antibody</td><td>Proteintech Group, Inc</td><td>10494-1-AP</td><td></td></tr><tr><td>Anti-N-cadherin antibody</td><td>Proteintech Group, Inc</td><td>22018-1-AP</td><td></td></tr><tr><td>Anti-P-AKT antibody</td><td>Proteintech Group, Inc</td><td>66444-1-Ig</td><td></td></tr><tr><td>Anti-snail antibody</td><td>Proteintech Group, Inc</td><td>13099-1-AP</td><td></td></tr><tr><td>Anti-Vimentin antibody</td><td>Proteintech Group, Inc</td><td>10366-1-AP</td><td></td></tr><tr><td>AxyPrepMultisourceTotalRNAMini-&lt;br/&gt; prep Kit</td><td>Suzhou Youyi Landi Biotechnology Co., Ltd</td><td>UEL-UE-MN-MS-RNA-50G</td><td></td></tr><tr><td>BCA Protein Assay Kit</td><td>Epizyme Biotech</td><td>ZJ101L</td><td></td></tr><tr><td>CCK-8 reagent</td><td>MedChemExpress</td><td>HY-K0301-500T</td><td></td></tr><tr><td>Fetal bovine serum (FBS)</td><td>CYAGEN BIOSCIENCES (GUANGZHOU) INC</td><td>FBSSR-01021</td><td></td></tr><tr><td>&lt;em&gt;GAPDH &lt;/em&gt;primer</td><td>Sangon Biotech (Shanghai) Co., Ltd.</td><td></td><td>Forward primer (5&amp;rsquo;-3&amp;rsquo;): TGACATCAAGAAGGTG&lt;br/&gt; GTGAAGCAG; Reverse primer (5&amp;rsquo;-3&amp;rsquo;): GTGTCGCTGTTGAAG&lt;br/&gt; TCAGAGGAG</td></tr><tr><td>HighGene plus Transfection reagent</td><td>ABclonal</td><td>RM09014P</td><td></td></tr><tr><td>HRP-conjugated Affinipure Goat Anti-Mouse lgG (H+L)</td><td>Proteintech Group, Inc</td><td>SA00001-1</td><td></td></tr><tr><td>HRP-conjugated Affinipure Goat Anti-Rabbit lgG (H+L)</td><td>Proteintech Group, Inc</td><td>SA00001-2</td><td></td></tr><tr><td>Human gastric mucosal epithelial &lt;strong&gt;GES-1 cells&lt;/strong&gt;</td><td>Guangzhou Cellcook Biotech Co.,Ltd.</td><td></td><td></td></tr><tr><td>Human STAD HGC-27 cells</td><td>Procell Life Science&amp;amp;Technology Co.,Ltd</td><td></td><td></td></tr><tr><td>Human STAD SGC-7901 cells</td><td>Procell Life Science&amp;amp;Technology Co.,Ltd</td><td></td><td></td></tr><tr><td>MonAmp SYBR Green qPCR Mix (None ROX)</td><td>Mona (Suzhou) Biotechnology Co., Ltd</td><td>MQ10101S</td><td></td></tr><tr><td>MonScript RTIII All-in-One Mix with dsDNase&amp;nbsp;&amp;nbsp;</td><td>Mona (Suzhou) Biotechnology Co., Ltd</td><td>MR05101M</td><td></td></tr><tr><td>Omni-ECL Femto Light Chemiluminescence Kit</td><td>Epizyme Biotech</td><td>SQ201</td><td></td></tr><tr><td>PAGE Gel Fast Preparationb Kit&amp;nbsp;</td><td>Epizyme Biotech</td><td>PG111</td><td></td></tr><tr><td>Penicillin-streptomycin (Pen-Strep)</td><td>Beijing Solarbio Science &amp;amp; Technology Co.,Ltd</td><td>P1400-100</td><td></td></tr><tr><td>Polyvinylidene difluoride (PVDF) membrane</td><td>Merck KGaA</td><td>IPVH00010-1</td><td></td></tr><tr><td>Protein Free Rapid Blocking Buffer</td><td>Epizyme Biotech</td><td>PS108P</td><td></td></tr><tr><td>RIPA lysis solution</td><td>Beijing Solarbio Science &amp;amp; Technology Co., Ltd</td><td>R0010</td><td></td></tr><tr><td>RPMI 1640 complete medium</td><td>Thermo Fisher Scientific</td><td>C11875500BT</td><td></td></tr><tr><td>Skimmed milk</td><td>Campina: Elk</td><td></td><td></td></tr><tr><td>TBST buffer solution</td><td>Beijing Solarbio Science &amp;amp; Technology Co., Ltd</td><td>T1082</td><td></td></tr><tr><td>The protein loading buffer</td><td>Epizyme Biotech</td><td>LT101S</td><td></td></tr><tr><td>TMEM200A knockdown plasmid</td><td>MiaoLing Plasmid</td><td></td><td></td></tr><tr><td>&lt;em&gt;TMEM200A &lt;/em&gt;primer</td><td>Sangon Biotech (Shanghai) Co., Ltd.</td><td></td><td>Forward primer (5&amp;rsquo;-3&amp;rsquo;): AAGGCGGTGTGGTGGTTCG; Reverse primer (5&amp;rsquo;-3&amp;rsquo;): GATTTTGGTCTCTTTGTCACGGTT</td></tr><tr><td>&lt;em&gt;TMEM200A &lt;/em&gt;SiRNA1</td><td>MiaoLing Plasmid</td><td></td><td>Forward primer (5&amp;rsquo;-3&amp;rsquo;): ACAACTGATGATAAGACCAG; Reverse primer (5&amp;rsquo;-3&amp;rsquo;): TGTTGACTACTATTCTGGTC</td></tr><tr><td>&lt;em&gt;TMEM200A &lt;/em&gt;SiRNA2</td><td>MiaoLing Plasmid</td><td></td><td>Forward primer (5&amp;rsquo;-3&amp;rsquo;): CGTGTGAATGTCAATGACTG; Reverse primer (5&amp;rsquo;-3&amp;rsquo;): GCACACTTACAGTTACTGAC</td></tr><tr><td>&lt;em&gt;TMEM200A &lt;/em&gt;SiRNA3</td><td>MiaoLing Plasmid</td><td></td><td>Forward primer (5&amp;rsquo;-3&amp;rsquo;): ACAACCACAACATCTGCCCG; Reverse primer (5&amp;rsquo;-3&amp;rsquo;): TGTTGGTGTTGTAGACGGGC</td></tr><tr><td>Transmembrane protein 200A Antibody</td><td>Proteintech Group, Inc</td><td>48081-1</td><td></td></tr><tr><td>&lt;strong&gt;Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>CO&lt;sub&gt;2&lt;/sub&gt; cell culture incubator</td><td>Haier Group</td><td>PYXE-80IR</td><td></td></tr><tr><td>Electrophoresis instrument</td><td>Bio-RAD</td><td></td><td></td></tr><tr><td>Fluorescence quantitative PCR instrument</td><td>Bio-RAD</td><td></td><td></td></tr><tr><td>Multifunctional Enzyme Labeler</td><td>Berthold</td><td></td><td></td></tr></tbody></table>

multiomics analysis of tmem200a as a pan-cancer biomarker

Multiomics Analysis of TMEM200A as a Pan-Cancer Biomarker

The transmembrane protein, TMEM200A, is known to be associated with human cancers and immune infiltration. Here, we assessed the function of TMEM200A in common cancers by multiomics analysis and used in vitro cell cultures of gastric cells to verify the results. The expression of TMEM200A in several human cancer types was assessed using the RNA-seq data from the UCSC Xena database. Bioinformatic analysis revealed a potential role of TMEM200A as a diagnostic and prognostic biomarker. 
Cultures of normal gastric and cancer cell lines were grown and TMEM200A was knocked down. The expression levels of TMEM200A were measured by using quantitative real-time polymerase chain reaction and western blotting. In vitro loss-of-function studies were then used to determine the roles of TMEM200A in the malignant behavior and tumor formation of gastric cancer (GC) cells. Western blots were used to assess the effect of the knockdown on epithelial-mesenchymal transition (EMT) and PI3K/AKT signaling pathway in GC. Bioinformatic analysis showed that TMEM200A was expressed at high levels in GC. 
The proliferation of GC cells was inhibited by TMEM200A knockdown, which also decreased vimentin, N-cadherin, and Snai proteins, and inhibited AKT phosphorylation. The PI3K/AKT signaling pathway also appeared to be involved in TMEM200A-mediated regulation of GC development. The results presented here suggest that TMEM200A regulates the tumor microenvironment by affecting the EMT. TMEM200A may also affect EMT through PI3K/AKT signaling, thus influencing the tumor microenvironment. Therefore, in pan-cancers, especially GC, TMEM200A may be a potential biomarker and oncogene.

Expression of TMEM200A in various cancers 
As illustrated in Figure 1, we first analyzed the differential expression levels of TMEM200A in various cancers through different databases. TMEM200A expression was elevated in cholangiocarcinoma (CHOL), head and neck squamous cell carcinoma (HNSC), renal clear cell carcinoma (KIRC), renal papillary cell carcinoma (KIRP), hepatocellular carcinoma (LIHC), STAD, and thyroid carcinoma (THC...

Here, a protocol is presented in which multiple bioinformatic tools are combined to study the biological functions of TMEM200A in cancer. In addition, we also experimentally validate the bioinformatics predictions.

The transmembrane protein, TMEM200A, is known to be associated with human cancers and immune infiltration. Here, we assessed the function of TMEM200A in ...

multiomics-analysis-of-tmem200a-as-a-pan-cancer-biomarker

Research

JoVE Journal

Cancer Research

Mice bearing the Colon-26 (C26) carcinoma represent a classical model of cancer cachexia. Progressive muscle wasting occurs in association with tumor growth, over-expression of muscle-specific ubiquitin ligases, and reductions in muscle cross-sectional area. Fat loss is also observed. Cachexia is studied in a time-dependent manner with increasing severity of wasting.

The Colon-26 Carcinoma Tumor-bearing Mouse as a Model for the Study of Cancer Cachexia

Obtaining high-quality genomic DNA from tumor tissues is an essential first step for analyzing genetic alterations using next generation sequencing. In this article, we present a simple and rapid method to enrich tumor cells and obtain intact DNA from touch imprint cytology specimens.

Simple and Rapid Method to Obtain High-quality Tumor DNA from Clinical-pathological Specimens Using Touch Imprint Cytology

Existing algorithms generate one solution for a biomarker detection dataset. This protocol demonstrates the existence of multiple similarly effective solutions and presents a user-friendly software to help biomedical researchers investigate their datasets for the proposed challenge. Computer scientists may also provide this feature in their biomarker detection algorithms.

Selecting Multiple Biomarker Subsets with Similarly Effective Binary Classification Performances

Here, a protocol for medium- to high-throughput analysis of protein phosphorylation events at the cellular level is presented. Phospho flow cytometry is a powerful approach to characterize signaling aberrations, identify and validate biomarkers, and assess pharmacodynamics.

Phospho Flow Cytometry with Fluorescent Cell Barcoding for Single Cell Signaling Analysis and Biomarker Discovery

Presented here are four protocols to construct and exploit yeast Saccharomyces cerevisiae reporter strains to study human P53 transactivation potential, impacts of its various cancer-associated mutations, co-expressed interacting proteins, and the effects of specific small molecules.

Yeast As a Chassis for Developing Functional Assays to Study Human P53

Here, we present a protocol to explore the biomarker and survival predictor of breast cancer based on the comprehensive analysis of pooled clinical datasets derived from a variety of publicly accessible databases, using the strategy of expression, correlation and survival analysis step by step.

Performing Data Mining And Integrative Analysis Of Biomarker in Breast Cancer Using Multiple Publicly Accessible Databases

The goal of this protocol is to establish a 3D in vitro model to study the differentiation of cancer-associated fibroblasts (CAFs) in a tumor bulk-like environment, which can be addressed in different analysis systems, such as immunofluorescence, transcriptional analysis and life cell imaging.

A 3D Spheroid Model as a More Physiological System for Cancer-Associated Fibroblasts Differentiation and Invasion In Vitro Studies

Intravenous injection of cancer cells is often used in metastasis research, but the metastatic tumor burden can be difficult to analyze. Herein, we demonstrate a tail-vein injection model of metastasis and include a novel approach to analyze the resulting metastatic lung tumor burden.

Pathological Analysis of Lung Metastasis Following Lateral Tail-Vein Injection of Tumor Cells

Here methods are presented to understand anti-cancer effects of Lactobacillus cell-free supernatant (LCFS). Colorectal cancer cell lines show cell deaths when treated with LCFS in 3D cultures. The process of generating spheroids can be optimized depending on the scaffold and the analysis methods presented are useful for evaluating the involved signaling pathways.

Evaluating Cell Death Using Cell-Free Supernatant of Probiotics in Three-Dimensional Spheroid Cultures of Colorectal Cancer Cells

Patient-derived organoids (PDOs) are a powerful tool in translational cancer research, reflecting both the genetic and phenotypic heterogeneity of the disease and response to personalized anti-cancer therapies. Here, a consolidated protocol to generate human primary bladder cancer PDOs in preparation for the evaluation of phenotypic analyses and drug responses is detailed.

Culture of Bladder Cancer Organoids as Precision Medicine Tools

Discover multiomics analysis of TMEM200A as a pan-cancer biomarker using bioinformatics and experimental validation in gastric cancer. This protocol integrates database predictions with siRNA transfection and functional assays.

Multiomics Analysis of TMEM200A as a Pan-Cancer Biomarker

Explore More Videos