This study examines the association between MLH1 gene expression in peripheral blood and colon cancer, utilizing a case-control approach to compare expression levels in patients and matched healthy controls.
Method Article
This study examines the association between MLH1 gene expression in peripheral blood and colon cancer, utilizing a case-control approach to compare expression levels in patients and matched healthy controls.
MutL homolog 1 (MLH1) is a component of the heterodimeric complex MutLα that detects and fixes base-base mismatches and insertion/deletion loops caused by nucleotide misincorporation. In the absence of MLH1 protein, the frequency of non-repaired mismatches increases, resulting in organ cancer. The current study sought to quantify MLH1 gene expression and its relationship with tumor invasion (T) and lymph node invasion (N) in blood samples from patients with colorectal cancer (CRC). Blood samples were obtained from 36 CRC patients. RNA was extracted, and cDNA was synthesized using a kit. The primers were built using the exon-exon junction approach, and MLH1 and β-actin genes were tested 3x using real-time polymerase chain reaction (Real-Time PCR). Gene expression analysis software was used to analyze the data, and a t-test was used to examine the expression of MLH1 and its connection with T and N variables. In this study, 36 patients with colorectal cancer, including 15 (41.6%) women and 21 (58.4%) men, with a mean age of 57.35 ± 4.22 years and in the age range of 26-87 years, were included. The results showed that the ratio of MLH1 gene expression in patients decreased compared to that in healthy individuals, and the decrease in gene expression at different stages of the disease was significant. The results of this study showed that the reduction of MLH1 gene expression has an effective role in the development of CRC.
Colon cancer (CRC) is one of the most common types of cancer. It is the fourth leading cause of cancer-related death worldwide1. CRC is more frequent in males than in females, and it is three to four times more common in industrialized countries than in developing countries. The age-standardized (global) incidence rate per 1 x 105 of CRC incidences is 19.7 in both sexes, 23.6 in men, and 16.3 in females2. Epidemiological studies have shown strong environmental and lifestyle associations with CRC. Obesity, red/processed meat, tobacco, alcohol, androgen deprivation therapy, and cholecystectomy are all associated with modestly increased CRC risks2,3.
Chromosomal instability, microsatellite instability, and CpG island methylator phenotype (CIMP) play an important role in the tumorigenesis of CRC4. According to previous studies, approximately 250 different mutations have been identified in patients with CRC, which is equivalent to approximately 55% of known mutations related to DNA mismatch repair (MMR) genes. Defects in mismatch repair proteins can be caused by germline mutations in the MSH6, MLH1, PMS2, and MSH2 genes, and most of these mutations are found in MLH1 and MSH2 genes4,5. The most important protein in the MMR system, which is usually involved in CRC, is MLH1. Recent studies have shown that any change in MLH1 expression may increase the risk of CRC. Germline mutations in MLH1 are responsible for Lynch Syndrome, an inherited type of CRC. In addition, 13%-15% of diffuse colon cancer cases are caused by MLH1 deficiency based on somatic promoter hypermethylation6,7,8.
MLH1 gene is located on the short arm of chromosome 3 at position 22.2 and contains 21 exons9. The protein encoded by the MLH1 gene can cooperate with an endonuclease involved in mismatch repair, PMS2, to generate MutLα, which is part of the MMR system. MutLα is mainly involved in the repair of base-base mismatches and deletion and addition loops as a result of incomplete DNA replication. In addition, the encoded protein is involved in DNA damage signaling and can be converted to the ɣMutL form with the MLH3 protein, which is involved in DNA mismatch repair observed in meiosis10,11,12. Studies have shown that MLH1 is involved in other major cellular activities, including regulation of cell cycle checkpoints, apoptosis, crossover recombination, and mitotic incompatibility13.
The MLH1 gene plays a key role in the DNA mismatch repair (MMR) system. A defect in the function of this gene can lead to the accumulation of genetic mutations and, as a result, the development of colorectal cancer14. Previous studies have shown that about 55% of mutations associated with MMR genes in patients with CRC are related to MLH1 gene mutations. In addition, decreased MLH1 gene expression can lead to Lynch syndrome, which is an inherited form of colorectal cancer15,16. Also, MLH1 gene defect based on somatic promoter hypermethylation has been observed in 13%-15% of sporadic colorectal cancer cases17. These scientific evidence show that the MLH1 gene acts as an important biomarker in colorectal cancer, and its expression analysis can provide valuable information about the function of the MMR pathway and the genetic risk of CRC18. Measuring MLH1 expression levels in the peripheral blood of patients with colon cancer can provide valuable information about the functionality of the MMR pathway, which is often disrupted in colon cancer. This method can be used for prognostic purposes and to understand genetic susceptibility to colon cancer19,20. A study on the relationship between MLH1 415 locus G to C mutation and sporadic colorectal cancer in Chinese patients found that the frequency of the MLH1 C/C genotype was significantly higher in sporadic CRC patients than in controls, suggesting a genetic susceptibility to sporadic CRC in Chinese patients21. Another study compared the gene expression of CRC genetic biomarkers in peripheral blood and biopsy samples of inflammatory bowel disease (IBD) patients, highlighting the potential of peripheral blood gene expression analysis for understanding colon cancer-related biomarkers22.
Considering the important role of the MLH1 gene and studies conducted in recent decades with molecular analysis by profiling mRNA expression, cancers have been classified with higher accuracy. The purpose of this study was to quantitatively investigate the expression of MLH1 in peripheral blood samples of patients with CRC using real-time PCR, and to investigate its relationship with pathological factors, stages of tumor progression to the layers of the intestinal wall (T), and stages of invasion to lymph nodes (N). This study was carried out in 36 CRC patients to potentially establish quantitative changes in gene expression as biomarkers for CRC screening, prognosis, and diagnosis using peripheral blood samples.
A case-control research was conducted at Affiliated Hospital 2 of Nantong University between April 2021 and May 2023. Engage with the hospital's administrative department to establish the study framework. Ethical approval was obtained by submitting the study proposal to the Nantong University Ethics Committee. Ethical guidelines were followed to ensure confidentiality and informed consent.
1. Patient recruitment and study design
2. Extraction and purification of RNA
3. Primer design for real-time PCR
4. Real-time PCR
5. Immunohistochemistry and genetic analyses
6. Statistical analysis
In this study, 36 patients with colon cancer were examined for MLH1 gene expression in the peripheral blood and its relationship with colon cancer. Analysis of demographic variables showed that 15 patients (41.6%) were women, and 21 patients (58.4%) were men. The mean age of the patients was 57.35 ± 4.22 years, and the age range was 26-87 years. The body mass index (BMI) status of the patients showed that 14 patients (38.8%) had a normal BMI (18.5 and 24.9 kg/m2), and 22 patients (61.2%) did not have a BMI within the normal range (below 18.5 or above 24.9 kg/m2). The histopathological characteristics of the colorectal cancer cases were as follows: tumor grade was classified according to the WHO grading system26, with 12 cases (33.3%) well-differentiated, 18 cases (50%) moderately differentiated, and 6 cases (16.7%) poorly differentiated. Lymphovascular invasion was present in 14 cases (38.9%), and perineural invasion was observed in 9 cases (25%). All the patients had clear resection margins. The results of examining the variable of tumor location showed that 20 tumors (55.5%) were in the colon, and 16 (45.5%) were in the rectum. Of all the tumors, 4 tumors (11.1%) were smaller than 10 mm, and 32 tumors (88.9%) were larger than 10 mm (Table 4).
We conducted a stratified analysis of MLH1 promoter hypermethylation and Lynch syndrome. Of the 36 colon cancer patients, 10 (27.8%) had MLH1 promoter hypermethylation, while genetic sequencing identified 5 patients (13.9%) with germline mutations consistent with Lynch syndrome. The remaining 21 patients (58.3%) did not exhibit MLH1 hypermethylation or Lynch syndrome, suggesting sporadic CRC (Table 5).
In the present study, genetic testing and family history were used to identify cases of hereditary MLH1 deficiency versus somatic MLH1 deficiency. Out of the 36 patients, 12 patients had a family history of Lynch syndrome, and genetic sequencing confirmed MLH1 germline mutations in 5 of these patients (13.9%). The remaining 7 patients with a family history showed no germline mutations but had somatic MLH1 deficiencies, possibly due to acquired mutations or epigenetic changes, such as hypermethylation. Of the 24 patients without a family history of Lynch syndrome, 15 (41.7%) had somatic MLH1 deficiency due to hypermethylation or somatic mutations. The remaining 9 patients without a family history had normal MLH1 expression levels, suggesting other mechanisms driving CRC.
The hereditary MLH1 deficiency group showed the most significant reduction in MLH1 expression, with an average fold change of 0.4, which was statistically significant (p <0.01). The somatic MLH1 deficiency group also showed a significant reduction in expression with an average fold change of 0.6 (p <0.001). The group with normal MLH1 expression levels did not show a statistically significant difference from the healthy control group (Table 6).
Figure 1 compares MLH1 gene expression levels between the two groups. Specifically, CRC patients exhibited significantly lower levels of MLH1 gene expression compared to the healthy individuals (p ≤ 0.001; Figure 1).
The level of gene expression at each stage of the disease compared to that in healthy people is shown in Table 7. The level of MLH1 gene expression was significant in Stage II (p ≤ 0.02), Stage III (p ≤ 0.01), and Stage IV (p ≤ 0.03). This indicates a decrease in gene expression in these stages of the disease in sick people compared to healthy people.

Figure 1: MLH1 gene expression. Comparison of MLH1 gene expression in blood samples of two groups of colorectal cancer patients and healthy people. The difference is significant (p ≤ 0.001). The statistical test used is the independent t-test. Error bars indicate the standard error of the mean (SEM). Please click here to view a larger version of this figure.
| Primer | Primer sequence | Length | Ta (°C) | |
| MLH1 Forward Primer | TCAGGTCATCGGAGCAAGCAC | 23 | 60 | |
| MLH1 Reverse Primer | CGATCTTCCTCTGTCAAGCCAC | 20 | 58 | |
Table 1: Primers used in the study. The sequence of the designed primers and the length of the PCR product for the MLH1 target gene. The annealing temperature (Ta) is also provided.
| Reagent | Volume (µL) | Final Concentration |
| 2x PCR Master Mix | 10 | 1x (as per kit instructions) |
| Forward Primer (10 µM) | 1 | 0.5 µM |
| Reverse Primer (10 µM) | 1 | 0.5 µM |
| cDNA Template | 2 | 100 ng/µL hypothesized |
| Nuclease-free Water | 6 | to adjust volume |
Table 2: Reaction setup.
| 45 cycles | ||
| Phase | Temperature | Duration |
| Denaturation | 95 °C | 20 min |
| Annealing | 54 °C | 30 s |
| Extension | 72 °C | 30 s |
Table 3: Temperature cycle and time spent in technique real-time PCR.
| Patient | Status | |
| Age | 4.22 ± 57.35(26-86) year | |
| Gender | Male | (58.4%) 21 |
| Female | (41.6%) 15 | |
| BMI | normal | (38.8%) 14 |
| Abnormal | (61.2%) 22 | |
| Familial colon cancer history | (33.3%) 12 | |
| Histopathological Diagnosis | Well-differentiated | (33.3%) 12 |
| Moderately differentiated | (50%) 18 | |
| Poorly differentiated | (16.7%) 6 | |
| Invasion | Lymphovascular | (38.9%) 14 |
| Perineural | (25%) 9 | |
| Other | (36.1%) 13 | |
| Resection margins | clear | (100) 36 |
| Location | Colon | (55.5%) 20 |
| Rectum | (45.5%) 16 | |
| Size | < 10 mm | (11.1%) 4 |
| > 10 mm | (88.9%) 32 | |
Table 4: Demographic and clinical characteristics of patients.
| Group | Number of Patients | Percentage |
| MLH1 Hypermethylation | 10 | 27.80% |
| Lynch Syndrome | 5 | 13.90% |
| Neither | 21 | 58.30% |
Table 5: Data on MLH1 promoter hypermethylation and Lynch syndrome status.
| Group | Number of Patients | Percentage | Average Fold Change | P-value |
| Hereditary MLH1 Deficiency | 5 | 13.90% | 0.4 | <0.01 |
| Somatic MLH1 Deficiency | 22 | 61.10% | 0.6 | <0.001 |
| Normal MLH1 Expression | 9 | 25% | 0.9 | >0.05 |
Table 6: MLH1 gene expression levels in CRC patients. The mean fold-change indicates the level of MLH1 gene expression relative to the control group. A fold-change of less than 1 indicates a reduction in expression.
| Stage | Fold change | P-value | |
| Decrease | Increase | ||
| Stage 0 | 1.8 | - | 0.33 |
| Stage I | 1.7 | - | 0.12 |
| Stage II | 2.2 | - | 0.02 |
| Stage III | 5.2 | - | 0.01 |
| Stage IV | 7.3 | - | 0.03 |
Table 7: Gene expression at different stages. The relative level of gene expression in each of the different stages of the disease compared to healthy people.
This study was conducted with the aim of investigating the expression of the MLH1 gene. In this study, it was shown that the level of MLH1 gene expression was decreased in sick people compared to healthy people. Based on fold change studies, it has been shown that the expression of the MLH1 gene in Stage II, Stage III, and Stage IV in sick people compared to healthy people had a significant decrease.
Colorectal cancer is a major problem in the management of cancer in the world due to its prevalence and survival rate3,27. Considering that the life expectancy of some patients with colorectal cancer does not even reach 5 years and also because the needs of patients with cancer are different in different years after diagnosis, a complete investigation of colorectal cancer is an essential need28,29.
In the meantime, launching completely specific molecular diagnostic tests along with clinical symptoms can be an effective help to diagnose people at risk and even people without clinical symptoms of colorectal cancer30,31. Defects in mismatch repair proteins can result from mutations in genes such as MLH1. The most important protein of DNA mismatch repair involved in colon cancer is MLH132,33.
According to studies, MLH1 gene is related to many cancers, including colorectal, stomach, esophagus and cervix34. The MLH1 gene plays an essential role in DNA repair, and this protein helps correct errors that occur during DNA replication in preparation for cell division35. Therefore, better identification of the mechanism and expression of the MLH1 gene can determine how colorectal cancer occurs, and by identifying this mechanism, appropriate measures can be taken to prevent and treat colorectal cancer36.
Guo et al. conducted a study in China with the aim of investigating MLH1 and MSH2 gene expression with clinicopathological features in colorectal cancer. In this study, clinical and pathological data of 88 patients undergoing cancer treatment were collected. The fold change of MLH1 and MSH2 in the tissues was measured by qRT-PCR, and the relationship between MLH1 and MSH2 was analyzed using the patients' pathological data. The results of this study confirmed the results of our study and showed that the expression of MLH1 and MSH2 genes is lower in cancer tissues than in other tissues37.
In another study conducted by Liu et al., the analysis of the expression of MLH1 and PMS2 genes in elderly patients with colorectal cancer and its relationship with clinical pathology features was investigated. In this retrospective cohort study, elderly patients with colorectal cancer from January 2014 to December 2018 who were admitted to a Beijing hospital were divided into two groups, MLH1 and PMS. The pathological characteristics and gene expression were compared in two groups. The results showed that MLH1 gene expression is decreased in patients and this decrease in gene expression is also evident in different stages of cancer and the decrease in gene expression in patients is related to age of onset, rapid tumor progression, poor differentiation and pathological staging38.
This decrease in gene expression has been shown in other studies in other countries. In studies conducted in the United States39, Iran40, and Ireland41, a decrease in MLH1 gene expression has been shown in patients with colorectal cancer.
The current standard involves universal tumor analysis of resected CRC specimens using IHC and molecular techniques. Patients with abnormal IHC findings are subsequently referred for definitive mutational testing. However, recent developments in our understanding of molecular genetics have transformed screening and diagnostic practices for Lynch syndrome42. A study by Alipoor et al. quantitatively analyzed MLH1 gene expression and its association with depth of tumor invasion (T) and lymph node invasion (N) factors in blood samples of Iranian patients with CRC. The study found that MLH1 gene expression was significantly associated with T and N stages, suggesting that MLH1 gene expression analysis could provide additional information beyond IHC techniques43. Moreover, a study by Halil et al. analyzed the impact of each specific MMR gene loss and clinical characteristics of patients with dMMR CRC who received immune checkpoint inhibitors (ICIs). The study found that overall response rates (ORRs) in MLH1 ± PMS2 and MSH2 ±MSH6 groups were 68% and 57.1%, respectively, without statistical difference. This suggests that MLH1 gene expression analysis could be a valuable tool for predicting response to ICI therapy in dMMR CRC patients44. Further research is needed to validate the role of MLH1 gene expression analysis in CRC management and to integrate it into clinical practice.
Considering the important and key role of the MLH1 gene in the repair of DNA inconsistencies and in accordance with the results of previous studies, it can be concluded that colorectal cancer is related to the decrease in the expression of the MLH1 gene. Therefore, with the reduction of gene expression, there is no possibility of correcting the defective cycle of replication, and the risk of creating a mutation will increase; therefore, this decrease in gene expression will play an important role in the process of disease development, treatment and the final outcome of the disease for people.
The results showed that the reduction of MLH1 gene expression has an effective role in the development of colorectal cancer. But the point in the importance of this gene is its role in cancer stages, which reduces gene expression in each stage of the disease. Therefore, this gene can be considered more in future studies; because there is a possibility that in the future it can play an effective role in improving the treatment status of colorectal cancer. Also, conducting more studies to find out other aspects seems necessary.
Critical steps within the protocol include strict adherence to RNA extraction and purification procedures, as the quality of RNA is paramount for accurate gene expression analysis. Additionally, the real-time PCR setup and the specific cycling conditions are crucial for reliable amplification and quantification of the MLH1 gene. Modifications and troubleshooting of the technique were addressed throughout the study. For instance, when suboptimal RNA purity was initially encountered, as indicated by spectrophotometer measurements, the extraction protocol was refined to include additional washing steps to remove potential contaminants. The technique's limitations include the reliance on peripheral blood, which may not fully represent the MLH1 expression levels within the tumor microenvironment.
In this study, we analyzed MLH1 gene expression in peripheral blood samples from 36 colorectal cancer patients. We recognize that this sample size is limited, which could affect the statistical power of our findings. Future studies with larger cohorts are warranted to validate our results and to better understand the role of MLH1 expression in colorectal cancer. Furthermore, the convenience sampling method may introduce selection bias, potentially affecting the generalizability of the results.
The authors declare no conflict of interest.
We would like to express our gratitude and appreciation to everyone who helped us complete this research endeavor.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Agarose Gel Electrophoresis Equipment | Bio-Rad | Mini-Sub Cell GT Systems | Used to check RNA quality |
| Ethylenediaminetetraacetic acid (EDTA) | Sigma-Aldrich | E9884 | Used as an anticoagulant for blood samples |
| NanoDrop | ThermoFisher Scientific | ND-2000 | Spectrophotometer used to determine RNA purity |
| Real-time PCR Machine | Applied Biosystems | A34322 | Used for RT-PCR reactions |
| RNA Extraction Kit | Intron Biotechnology Co | #Cat 17061 | Used for RNA extraction from blood samples |
| SYBR Green PCR Kit | Thermo Fisher Scientific | 4309155 | Reagents used for RT-PCR experiments |
This article has been published
Video Coming Soon