Name: Tear-Derived Exosomal miR-15a as New Diagnostic Tool for Diabetic Retinopathy (Video) | JoVE Journal
Uploaded: 2025-12-30T12:30:00.000+00:00
Duration: 7 min 45 s
Description: Learn to detect tear-derived exosomal miR-15a as a non-invasive biomarker for diabetic retinopathy using droplet digital PCR and exosome isolation. This method improves early diagnosis and patient outcomes.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

This research was supported by Alcon Research Institute (IF011-2020) and FOM UMSC Care Postdoctoral Research Grant 2021.

The study was conducted with approval from the Universiti Malaya Medical Centre Medical Research Ethical Committee (Reference number: 20165-2446). Written consent was obtained from all human subjects prior to recruitment. A total of 135 subjects were included from among patients attending the ophthalmology clinic at the Universiti Malaya Medical Centre (UMMC), Kuala Lumpur. Inclusion criteria included patients who received services under UMMC and were aged between 20-80 years. Patients undergoing active insulin treatment, with a history of laser or anti-VEGF treatment in the last 3 months, or on regular anti-platelets or blood thinners were excluded from the study. Subjects were then divided into three groups: (1) healthy control (Control), (2) diabetic without retinopathy (DM No DR), and (3) diabetic with retinopathy (DR). A summary of the protocol is provided in Figure 1. Details of the reagents and equipment used in this study are listed in the Table of Materials.
<img alt="Flowchart of study process: tears collected, RNA isolation, cDNA synthesis, ddPCR analysis." class="xfigimg" src="/files/ftp_upload/66687/66687fig1.jpg" data-altupdatedat="1773720005000" data-alt="Figure 1"> 
Figure 1: An overview of the protocol. <a href="https://www.jove.com/files/ftp_upload/66687/66687fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
1. Preparation of materials    
<ol>
	<li>Lay out a sterile basic dressing set containing two forceps, six cotton balls, four gauze pads, a tray, and a bio-hazard bag.</li>
	<li>Pour 5 mL of 0.9% w/v sodium chloride irrigation solution into a tray.</li>
	<li>Open a pack of eyelid cleansing wipes and place it on the sterile field.</li>
	<li>Prepare a tube containing 250 µL of preservative solution.</li>
	<li>Fold a Schirmer strip at the wedge level while still in its packaging before placing the sterile strip onto the sterile field.    </li>
	<li>Put on surgical gloves in an aseptic manner.</li>
	<li>Using a pair of sterile forceps, moisten the cotton balls with 0.9% w/v sterile sodium chloride irrigation solution.</li>
</ol>
2. Preparation of human subjects    
<ol>
	<li>Allow the subject to sit comfortably and ask to close his/her eyes.</li>
	<li>Wipe the periorbital skin four times using cotton balls soaked in an irrigation solution.</li>
	<li>Wipe the periorbital skin with an eyelid cleansing wipe.</li>
</ol>
3. Collection of human tear fluid
<ol>
	<li>Collect tear fluids using the Schirmers strip placed at the temporal inferior fornix.    </li>
	<li>When placing the partially folded strip onto the right eye, request the subject to gaze to the left. Pull down the lower lid to expose the inferior fornix.</li>
	<li>Using a pair of sterile forceps, place a Schirmer strip on the outer two-thirds of the lower conjunctival fornix. Avoid letting the strip from touching the skin to prevent contamination of the sample with sweat or other materials on the skin.</li>
	<li>Place a gauze pad underneath the strip to prevent skin contact.</li>
	<li>Allow tears to be absorbed into the strip until the 20 mm mark or a maximum of 5 min, whichever comes first.</li>
	<li>If the 20 mm level mark is not reached, document the level of tears based on the markings to allow standardization of tear fluid volume.      </li>
	<li>Using a pair of sterile forceps, carefully remove the Schirmer strip and place the strip into a tube containing 1x phosphate buffer saline (PBS) solution.</li>
	<li>Place the tube into a cooler box for transportation to the laboratory.</li>
	<li>Clean the periorbital surface by wiping away any residual solution on the skin.</li>
</ol>
4. Pre-processing of tear samples    
<ol>
	<li>Vortex the tube containing the Schirmer strip soaked in PBS for 5 min at room temperature.</li>
	<li>Agitate the tube on a rocker for 5 min at room temperature.</li>
	<li>Centrifuge the tube at 2000 x g for 15 min at 4 °C.      </li>
	<li>Transfer the solution into a new tube, label and keep it at -80 °C until downstream processing.  </li>
	<li>Discard the remaining strip.</li>
</ol>
5. Exosome isolation
NOTE: RNA isolation is performed using a commercially available kit following the manufacturer protocol (see Table of Materials).
<ol>
	<li>Thaw the tear solution on ice for 10 min.</li>
	<li>Equilibrate the spin column for 15 min at room temperature before use.      </li>
	<li>Remove the lower outlet of the column and place it onto the waste collection plate provided.</li>
	<li>Remove the top sealing mat and allow the storage buffer to pass through the column through gravitational force.</li>
	<li>Add 250 µL of PBS and allow it to pass through the column.      </li>
	<li>Repeat step 5.5.</li>
	<li>Apply a 110 µL sample to the top of each column and allow the sample to enter the column.      </li>
	<li>Transfer the column onto a provided sample collection plate.</li>
	<li>Add 100 µL of PBS and allow it to pass through the column into the sample collection plate.</li>
	<li>Transfer the column onto the waste collection plate.</li>
	<li>Add 4x 200 µL PBS to the column and allow it to enter the column to remove the free proteins fraction from the first loading.      </li>
	<li>Add 110 µL of sample into the column. Allow to enter the column.    </li>
	<li>Place the column onto a sample collection plate. Add 100 µL of PBS and allow it to pass through the column.</li>
	<li>Briefly centrifuge the sample collection plate at 100 x g for 30 s. The isolated exosomes are now ready for RNA isolation.</li>
</ol>
6. RNA isolation
NOTE: RNA isolation is performed using a commercially available kit following the manufacturer protocol (see Table of Materials).
<ol>
	<li>Subject 200 µL of the isolated exosomes to RNA isolation.      </li>
	<li>Add 60 µL of lysis buffer to the isolated exosomes. Vortex for 5 s.</li>
	<li>Incubate at room temperature for 3 min.</li>
	<li>Add 20 µL of inhibitor precipitation buffer, vortex for 20 s, and incubate at room temperature for 3 min.</li>
	<li>Centrifuge at 12,000 x g for 3 min at room temperature.</li>
	<li>Transfer the clear, colorless supernatant to a new tube.</li>
	<li>Add 1 volume of isopropanol.</li>
	<li>Vortex for 5 s and transfer the solution to the mini spin column provided in the kit.</li>
	<li>Centrifuge at room temperature for 15 s at 8000 x g. Discard the flow through.</li>
	<li>Wash the column with 700 µL of RWT wash buffer. </li>
	<li>Centrifuge for 15 s at 8000 x g. Discard the flowthrough.</li>
	<li>Wash the column with 500 µL of RPE wash buffer.</li>
	<li>Centrifuge for 15 s at 8000 x g. Discard the flowthrough.    </li>
	<li>Add 500 µL of 80% ethanol to the sample mini spin column.</li>
	<li>Centrifuge for 2 min at 8000 x g. Discard the flowthrough and collection tube.</li>
	<li>Place the mini spin column into a new 2 mL collection tube.      </li>
	<li>Centrifuge the column and tube at 18,000 x g for 5 min. Discard the flow through and the collection tube.</li>
	<li>Place the mini spin column into a new 1.5 mL tube and add 15 µL of RNase-free water at the center of the spin column membrane.    </li>
	<li>Incubate for 3 min at room temperature.</li>
	<li>Centrifuge at 18,000 x g for 1 min to elute the RNA. RNA is ready for downstream processing.      </li>
	<li>Perform Nanoparticle tracking analysis for quality control and verification of the RNA yield.</li>
</ol>
7. cDNA synthesis
<ol>
	<li>Perform cDNA synthesis using commercially available kits following the manufacturer protocols (see Table of Materials).</li>
	<li>Prepare the master mix according to Table 1 in a 1.5 mL microcentrifuge tube.    </li>
	<li>Mix the solution by pipetting up and down.      </li>
	<li>Pipette 5.1 µL of the master mix into 0.1 µL PCR tubes.</li>
	<li>Add 9.9 µL of sample to the allocated tube containing the master mix.</li>
	<li>Place the PCR tubes into a thermocycler and run according to Table 2. 
	NOTE: The cDNA is ready for further analysis.</li>
</ol>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Component</td>
			<td>Volume/ reaction</td>
		</tr>
		<tr>
			<td>10x RT Buffer</td>
			<td>1.5 µL </td>
		</tr>
		<tr>
			<td>100M dNTP mix</td>
			<td>0.15 µL</td>
		</tr>
		<tr>
			<td>RNAse Inhibitor (200U/µL )</td>
			<td>0.19 µL</td>
		</tr>
		<tr>
			<td>Multiscribe RT Enzyme (50U/µl )</td>
			<td>1 µl </td>
		</tr>
		<tr>
			<td>20x RT Primer</td>
			<td>0.75 µL </td>
		</tr>
		<tr>
			<td>RNAse Free Water</td>
			<td>1.51 µL</td>
		</tr>
		<tr>
			<td>Sample</td>
			<td>9.9 µL</td>
		</tr>
		<tr>
			<td>Total Volume</td>
			<td>15 µL </td>
		</tr>
	</tbody>
</table>
Table 1: Preparation of the PCR master mix used for cDNA synthesis from the isolated RNA.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Step</td>
			<td>Temperature</td>
			<td>Duration</td>
		</tr>
		<tr>
			<td>Reverse Transcription</td>
			<td>16 °C</td>
			<td>30 min</td>
		</tr>
		<tr>
			<td></td>
			<td>42 °C</td>
			<td>30 min</td>
		</tr>
		<tr>
			<td>Stop</td>
			<td>85 °C</td>
			<td>5 min</td>
		</tr>
		<tr>
			<td>Hold </td>
			<td>4 °C</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 2: Thermocycling conditions for the cDNA synthesis.
8. Digital droplet PCR 
NOTE: Digital droplet PCR (ddPCR) is performed using commercially available kits following the manufacturer protocols (see Table of Materials).
<ol>
	<li>Prepare the master mix for ddPCR in a 1.5 mL microcentrifuge tube according to Table 3.</li>
	<li>Pipette 19.8 µL of master mix into 0.1 µL PCR tubes. Add 2.2 µL of samples and mix well by pipetting the mixture up and down for 10 times.</li>
	<li>Transfer 20 µL of the sample mixture into the sample lane of the ddPCR cartridge.      </li>
	<li>Add 50 µL of oil to the oil lane of the cartridge     .      </li>
	<li>Attach a gasket onto the cartridge using the hook on the plate.</li>
	<li>Place the cartridge into the droplet generation machine. A click sound indicates a proper insertion of the cartridge into the droplet generation machine.</li>
	<li>Carefully transfer all of the generated droplets into wells of a 96-well plate. Add at least one well of no template control well as a negative control.</li>
	<li>Seal the plate using a pierceable foil in a plate sealer machine (see Table of Materials).    </li>
	<li>Place the plate into a thermocycler and run according to Table 4.</li>
	<li>Transfer the plate into the droplet reader machine to count for positive and negative droplets.</li>
	<li>Quantify the copy number/mL using the copy number/20 µL value generated from the run.</li>
</ol>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Component</td>
			<td>Volume/ reaction</td>
		</tr>
		<tr>
			<td>2x ddPCR Supermix for Probes (No dUTP)</td>
			<td>10 µL</td>
		</tr>
		<tr>
			<td>20x Primers/ probe</td>
			<td>1 µL</td>
		</tr>
		<tr>
			<td>Sample</td>
			<td>7 µL </td>
		</tr>
		<tr>
			<td>RNAse Free Water</td>
			<td>2 µL </td>
		</tr>
		<tr>
			<td>Total Volume</td>
			<td>20 µL </td>
		</tr>
	</tbody>
</table>
Table 3: Preparation of the PCR master mix used for ddPCR.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Step</td>
			<td>Temperature</td>
			<td>Duration</td>
			<td>Ramp</td>
			<td>Cycle</td>
		</tr>
		<tr>
			<td>Enzyme Activation</td>
			<td>95  °C</td>
			<td>10 min</td>
			<td rowspan="5">~2 °C/ s for each steps</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Denaturation</td>
			<td>94 °C</td>
			<td>30 s</td>
			<td>40</td>
		</tr>
		<tr>
			<td>Annealing</td>
			<td>60 °C</td>
			<td>1 min</td>
			<td>40</td>
		</tr>
		<tr>
			<td>Enzyme deactivation</td>
			<td>98 °C</td>
			<td>10 min</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Hold </td>
			<td>4 °C</td>
			<td>N/A</td>
			<td>N/A</td>
		</tr>
	</tbody>
</table>
Table 4: Thermocycling conditions for the ddPCR.

The authors declare that they have no competing interests.

Funduscopy examination, optical coherence tomography, and fluorescein angiography are the currently available detection techniques for diabetic retinopathy detection. The three techniques are often used together to provide a comprehensive assessment of various retinal and choroidal diseases. Funduscopy is a clinical examination routinely performed during diabetic retinopathy assessment. This method is carried out by trained ophthalmologists and is the gold standard for diagnosing diabetic retinopathy. This method enables...

Diabetic retinopathy (DR) is one of the most prominent microvascular complications of diabetes, threatening the vision of millions around the globe. The global prevalence of DR from population data of IDP Atlas 2019 was estimated at 22.7% out of the whole diabetic population worldwide, with the number of new cases being continuously on the rise, particularly in developed and developing countries1. Clinically, DR is characterized by early-stage DR or non-proliferative diabetic retinopathy (NPDR), late-stage DR or proliferative diabetic retinopathy (PDR), and the presence of macular edema. Increased vascular permeability and capillary blockage are two common pathological changes seen in NPDR, and abnormal neovascularization of the iris, macula, optic disc, or retina are observed in the case of PDR2,3. The progression into PDR, which could potentially result in vitreous hemorrhage and retinal detachment, may cause significant vision impairment3. In all cases, pathological changes can be detected through funduscopy or fundus photography examination by trained ophthalmologists4. Using the standard fundus photography method, diabetic retinopathy can be detected with 78%-96% sensitivity and 86%-97% specificity5. However, this method only detects once damage has occurred to the retina. There is an unmet need for early detection of DR before the onset of clinically visible retinal signs, such as blot retinal hemorrhages, microaneurysms, exudates, and new vessel proliferation.
The advancement of molecular tools led to the discovery of exosomes as a potential diagnostic tool for various diseases, including cancer and cardiovascular diseases6,7. Exosomes are nanosized particles bound by a lipid bilayer membrane secreted by most of the cells into their extracellular vesicle (EV) space. These exosomes can be transported by biofluids such as blood, tears, saliva, and urine, making them readily accessible for non-invasive or minimally invasive diagnostic procedures8. They carry various origin cell markers which include proteins, lipids, and nucleic acids. Of particular interest are small non-coding RNAs carried within EVs. Although these RNAs are not encoded for proteins, they play pivotal roles in gene regulation and have been implicated in many physiological and pathological processes, including in the pancreatic &#946;-cells, which are highly important in the development of diabetes9,10.&#160; &#160; &#160;
Specifically, miR-15a has been shown to have a strong association with the development of diabetes, mainly through the regulation of insulin production and pancreatic beta-cell functions11. Our group has recently demonstrated that miR-15a is altered in the plasma of diabetic retinopathy. In addition, the miR-15a was also shown to be secreted by the pancreatic beta-cells, and it travels through the bloodstream to the retina12. Tear fluid is considered an easily accessible fluid, readily obtainable from the eye in a non-invasively and cost-effective manner13. It contains a mixture of various proteins, lipids, electrolytes, and other molecules, which reflects the physiological state of the ocular surface and surrounding tissues, including the retina14. A higher number of miRNAs have been detected in tear fluid than in serum and aqueous humor solution15,16. The tear composition changes in response to various systemic conditions, including diabetes17. In fact, tear fluid analysis has been shown to have a promising potential for monitoring and diagnosis of other non-eyes-related diseases such as multiple sclerosis and breast cancer18,19. With the direct link of diabetic retinopathy to the eye, it would be more relevant to look for potential diagnostic properties of tear fluid in this disease. Levels of IL-1RA, IL-8, IL-6, and TNF-&#945; in the tear fluids of patients with diabetic retinopathy have been observed to undergo changes, which also vary according to the severity of the disease20,21. Compared to the traditional funduscopy examination, tear fluid analysis for diabetic retinopathy offers potential advantages in terms of accessibility, non-invasiveness, and specificity and allows early detection before the onset of the disease22.
Hence, the main goal of this study is to investigate the potential of tear fluid-derived exosomal miR-15a as a novel diagnostic marker for diabetic retinopathy through miRNA isolation and quantification from tear fluids of the diabetic retinopathy population. With this, there would be a new detection method for diabetic retinopathy through tear fluid screening, which is detectable even before the onset of retinal complications, allowing early preventative or therapeutic measures.

<table><tbody><tr><td>0.9% w/v Sodium Chloride</td><td>Ain Medicare Sdn Bhd</td><td>GB16165967618</td><td></td></tr><tr><td>1x Phosphate Buffer Saline</td><td>Thermo Fisher Scientific</td><td>10010-023</td><td></td></tr><tr><td>Applied Biosystems&amp;nbsp;TaqMan MicroRNA Reverse Transcription Kit</td><td>Applied Biosystems</td><td>4366596</td><td></td></tr><tr><td>ddPCR Supermix for Probes (No dUTP)</td><td>BioRad Laboratories</td><td>1863024</td><td></td></tr><tr><td>ddPCR 96-Well Plates</td><td>BioRad Laboratories</td><td>12001925</td><td></td></tr><tr><td>DG8 Cartridges</td><td>BioRad Laboratories</td><td>1864008</td><td></td></tr><tr><td>DG8 Gaskets</td><td>BioRad Laboratories</td><td>1863009</td><td></td></tr><tr><td>Droplet Generation Oil for Probes</td><td>BioRad Laboratories</td><td>1863005</td><td></td></tr><tr><td>Exospin-96 Exosome Isolation Kit</td><td>Cell Guidance Systems</td><td>EX07-96</td><td></td></tr><tr><td>miRNeasy Serum/Plasma Advanced Kit</td><td>Qiagen</td><td>&amp;nbsp;217204</td><td></td></tr><tr><td>PX1 PCR Plate Sealer</td><td>BioRad Laboratories</td><td>1814000</td><td></td></tr><tr><td>QX100 droplet digital PCR System</td><td>BioRad Laboratories</td><td>QX100</td><td></td></tr><tr><td>QXDx Droplet Generator&amp;nbsp;</td><td>BioRad Laboratories</td><td>12001049</td><td></td></tr><tr><td>Schirmer Strip</td><td>Optitech</td><td>SCH-100</td><td></td></tr><tr><td>T100 Thermal Cycler</td><td>BioRad Laboratories</td><td>1861096</td><td></td></tr><tr><td>Taqman MicroRNA Assay MTOMED 20 (Assay ID: 000389 )</td><td>Applied Biosystems</td><td>4440887</td><td>Target Sequence: UAGCAGCACAUAAUGGUUUGUG</td></tr></tbody></table>

tear-derived exosomal mir-15a as new diagnostic tool for diabetic retinopathy

Tear-Derived Exosomal miR-15a as New Diagnostic Tool for Diabetic Retinopathy

Diabetic retinopathy (DR) is a major complication of diabetes mellitus, affecting a significant percentage of the diabetic population. Early diagnosis and intervention are critical for preventing irreversible vision loss. Current diagnostic methods, although effective, have limitations. miRNA, a small non-coding RNA that inhibits the stability and/or translation of an mRNA by binding to the 3'-untranslated regions (3'-UTRs) of target mRNAs, has been increasingly recognized as being significantly associated with diabetes and can be obtained from tears. This study investigated the potential of tear fluid-derived exosomal miR-15a as a novel diagnostic marker for DR. Tear Samples were obtained from 135 diabetic patients (36 with diabetic retinopathy [DR] and 50 without DR) and 49 healthy controls. Exosomes were isolated, and the expression levels of exosomal miR-15a were measured using droplet digital PCR (ddPCR). The results showed that exosomal miR-15a expression was altered in diabetic and DR patients compared to healthy individuals. These findings indicate that exosomal miR-15a derived from tear fluid may play a role in the molecular mechanisms underlying diabetes and its complications. Furthermore, it holds potential as a non-invasive and reliable diagnostic biomarker for diabetic retinopathy, offering high sensitivity and specificity.

Standard curve 
A standard curve was created to determine the exact volume of tears collected from each patient. Basically, different volumes of preservative ranges between 3 µL to 25 µL were exposed to Schirmer strips. And the distance of the wet area on the Schirmer was observed. The procedure was repeated three times for each procedure, and the average reading was calculated. A standard curve of the volume of tears collected vs the distance of wet areas of Schirmer was generated (<strong class="xfi...

This article describes a protocol for the collection and detection of miR-15a from tears as a new diagnostic tool for diabetic retinopathy.

Diabetic retinopathy (DR) is a major complication of diabetes mellitus, affecting a significant percentage of the diabetic population. Early diagnosis and ...

Our research explores the potential of tear-derived exosomal microRNA-15a as a non-invasive biomarker for diabetic retinopathy, aiming to improve early diagnosis and patient outcomes in diabetic-related eye diseases. Current research leverages droplet digital PCR, exosome isolation, and molecular profiling of tear-based microRNAs to enhance diagnostic accuracy and biomarker discovery for diabetic retinopathy. Current challenges include limited tear volume, absence of specialized tear isolation kits, and lack of a validated endogenous reference microRNA, complicating normalization and consistent quantification in tear-based diagnostics.We identify tear-derived extracellular vesicular or exosomal biomarkers as a non-invasive tool for diabetic retinopathy, though DR and non-DR groups overlap, finding support tear fluids potential for early disease detection. We will focus on how other microRNAs regulate diabetic retinopathy, explore the use as a non-invasive biomarker, and investigate their role in other diseases to prevent vision loss. To begin, take a tube containing the Schirmer strip soaked in PBS and vortex it for five minutes at room temperature.Place the tube on a rocker and agitate it for five minutes at room temperature. Now, centrifuge the tube at 2, 000 G for 15 minutes at four degrees Celsius. Transfer the solution into a new labeled tube and store it at minus 80 degrees Celsius until further processing.For the exosome isolation, thaw the tear solution on ice for 10 minutes. Equilibrate the spin column for 15 minutes at room temperature. Then remove the lower outlet of the column and position it over the provided waste collection plate.Remove the top ceiling mat and allow the storage buffer to pass through the column by gravity. Then add 250 microliters of PBS and let it pass through the column. Apply 110 microliters of a sample onto the top of each column and allow it to enter the column.Move the column onto a provided sample collection plate. Add 100 microliters of PBS to the top and allow it to pass through the column into the sample collection plate. Place the column back onto the waste collection plate.Add 200 microliters of PBS four times to the column and allow it to enter the column to remove the free protein fraction from the first loading. Then add 110 microliters of the sample into the column and allow it to enter. Place the column onto the sample collection plate.Add 100 microliters of PBS and allow it to pass through the column. Briefly centrifuge the sample collection plate at 100 G for 30 seconds. The isolated exosomes are now ready for RNA isolation.Take 200 microliters of the isolated exosomes and add 60 microliters of lysis buffer to it. Vortex for five seconds and incubate the mixture at room temperature for three minutes. Add 20 microliters of inhibitor precipitation buffer.Vortex again for 20 seconds before incubating for three minutes at room temperature. Centrifuge the tube at 12, 000 G for three minutes at room temperature. Transfer the clear colorless supernatant to a new tube and add one volume of isopropanol to it.After vortexing for five seconds, transfer the solution to the mini spin column provided in the kit. Centrifuge the column at room temperature for 15 seconds at 8, 000 G and discard the flowthrough. Wash the column with 700 microliters of RWT wash buffer.After centrifuging for 15 seconds, discard the flowthrough. Now wash the column with 500 microliters of RPE wash buffer before centrifuging again for 15 seconds. Discard the flowthrough and add 500 microliters of 80%ethanol to the sample mini spin column before centrifuging again.After discarding the flowthrough and the collection tube, place the mini spin column into a new two milliliter collection tube. Centrifuge at 18, 000 G for five minutes and discard the flowthrough and collection tube. Place the mini spin column into a new 1.5 milliliter tube.Then add 15 microliters of RNAse-free water at the center of the spin column membrane. After incubating for three minutes at room temperature, centrifuge the tube at 18, 000 G for one minute to elute the RNA. Nanoparticle tracking analysis was used to evaluate the size distribution and concentration of exosomes isolated from tear samples.The average size of exosomes isolated from tears was approximately 142.4 nanometers. The total number of exosomes in the sample diluted to 1:20 was 3.9 times 10 to the 10th particles per milliliter. The copy number of microRNA-15a significantly increased in patients with diabetes without retinopathy compared to healthy controls, suggesting early elevation of this biomarker with diabetic onset.A further significant increase in microRNA-15a copy number was observed in patients with diabetic retinopathy compared to controls, reinforcing its association with diabetic conditions. No statistically significant difference in microRNA-15a levels was found between the diabetes without retinopathy and diabetic retinopathy groups, indicating that while miR-15a reflects diabetic presence, it does not differentiate between stages of retinopathy.

tear-derived-exosomal-mir-15a-as-new-diagnostic-tool-for-diabetic

Research

JoVE Journal

Medicine

Here, we present a protocol to study the pathophysiology of proliferative diabetic retinopathy by using patient-derived, surgically-excised, fibrovascular tissues for three-dimensional native tissue characterization and ex vivo culture. This ex vivo culture model is also amenable for testing or developing new treatments.

An Ex Vivo Tissue Culture Model for Fibrovascular Complications in Proliferative Diabetic Retinopathy

Clinical translation of exosome-derived biomarkers for diseased and malignant cells is hindered by the lack of rapid and accurate quantification methods. This report describes the use of low-magnification dark-field microscope images to quantify specific exosome subtypes in small volume serum or plasma samples.

Using Nanoplasmon-Enhanced Scattering and Low-Magnification Microscope Imaging to Quantify Tumor-Derived Exosomes

This study aims to develop a novel human organotypic retinal culture (HORC) model that prevents compromising retinal integrity during explant handling. This is achieved by culturing the retina with the overlying vitreous and the underlying retinal pigment epithelium-choroid (RPE-choroid) and sclera.

Characterization of a Novel Human Organotypic Retinal Culture Technique

Diabetic retinopathy is one of the leading causes of blindness. Histology, blood-retinal barrier breakdown assay, and fluorescence angiography are valuable techniques to understand the pathophysiology of the retina, which could further enhance the efficient drug screening against diabetic retinopathy.

Retinal Pathophysiological Evaluation in a Rat Model

A protection assay was developed to monitor the retinal vasculature's resilience to death from diabetes/diabetic retinopathy-related insults such as oxidative stress and cytokines.

An Assay to Detect Protection of the Retinal Vasculature from Diabetes-Related Death in Mice

We demonstrate a method to label the walls of the retinal vasculature and adherent leukocytes. These adherent leukocytes can then be counted under a fluorescence microscope as a parameter of inflammation or the response of that inflammation to therapies.

Quantification of Diabetes-induced Adherent Leukocytes in Retinal Vasculature

We present a simple agarose overlay platform to grow 3D multicellular spheroids using neuroendocrine cancer cell lines. This method provides a very convenient way to examine the effect of therapeutic drugs on the neuroendocrine tumor cells. It could also help us establish human neuroendocrine tumor spheroids for cancer therapy.

Human Neuroendocrine Tumor Cell Lines as a Three-Dimensional Model for the Study of Human Neuroendocrine Tumor Therapy

Pneumonia is one of the top ten leading causes of death in the U.S. Osteopathic manipulative techniques (OMT) may be utilized as an adjunctive therapy in the treatment of pneumonia to enhance biomechanical and immune function; and ultimately, to reduce hospital stay, duration of antibiotics, incidence of respiratory failure, and mortality. In this video-article, we will review randomized controlled studies on the use of OMT in pneumonia patients, as well as demonstrate specific hands-on...

Osteopathic Manipulative Treatment as a Useful Adjunctive Tool for Pneumonia

Retinal image analysis is an unobtrusive procedure for visualizing the microcirculation. The impact of cardiovascular disease risk factors can result in changes of retinal vessel calibers. The procedures to acquire fundus images and the steps for calculating the vessel calibers are described.

Fundus Photography as a Convenient Tool to Study Microvascular Responses to Cardiovascular Disease Risk Factors in Epidemiological Studies

To investigate the blood-retinal barrier permeability and the inner limiting membrane integrity in animal models of retinal disease, we used several adeno-associated virus (AAV) variants as tools to label retinal neurons and glia. Virus mediated reporter gene expression is then used as an indicator of retinal barrier permeability.

Using Adeno-associated Virus as a Tool to Study Retinal Barriers in Disease

Learn to detect tear-derived exosomal miR-15a as a non-invasive biomarker for diabetic retinopathy using droplet digital PCR and exosome isolation. This method improves early diagnosis and patient outcomes.

Tear-Derived Exosomal miR-15a as New Diagnostic Tool for Diabetic Retinopathy

Explore More Videos