Establishment and Evaluation of an In Vitro Human-Based Advanced Model of Pulmonary Fibrosis

Summary

An imaging method was developed to evaluate the activation of fibroblasts in human precision-cut lung slices based on fibroblast activation protein (FAP). This methodology establishes a robust and reproducible platform for staging fibrotic progression, advancing translational in vitro models for therapeutic development while maintaining the fidelity of the human tissue microenvironment.

Abstract

Pulmonary fibrosis is characterized by irreversible destruction of alveolar structure and excessive deposition of extracellular matrix. Although animal models have been widely used in pulmonary fibrosis research, none of the currently available models fully recapitulate the progressive nature of IPF or its defining histological feature, such as fibroblastic foci. Advanced in vitro models, including precision-cut lung slices (PCLS), are often considered the most physiologically relevant pulmonary test system and have been successfully employed for drug screening. Nevertheless, the inability to differentiate the degree of fibrosis in the IPF lung has resulted in blinding and uncertainty in the PCLS obtained. Previous research demonstrated that fibroblast activation protein (FAP) could evaluate the pro-fibrotic activity of ILD, potentially contributing to early diagnosis and the selection of appropriate therapeutic windows. In this study, 600 µm PCLS will be obtained from healthy donors and IPF patients using a shock slicer and evaluated using molecular probes targeting FAP to determine the degree of fibroblast activity based on fluorescent signal intensity. This approach provides an advanced in vitro model and evaluation technique for pulmonary fibrosis research, enhancing the ability to study disease mechanisms and assess therapeutic interventions.

Introduction

Pulmonary fibrosis (PF) is a common form with an unknown etiology and a particularly poor prognosis, with a median five-year survival rate of only 25%¹. The intratracheal bleomycin administration model is currently the most widely used animal model for preclinical studies². However, fibrosis induced by bleomycin is transient and resolves over time, which contrasts sharply with the irreversible nature of IPF³. Moreover, the intratracheal bleomycin model presents significant challenges due to the heterogeneous severity of fibrosis resulting from endotracheal administration, whether surgical or nonsurgical. These limitations of current animal models contribute to the high failure rate of clinical trials targeting IPF⁴.

Precision-cut lung slices (PCLS) have been used in a variety of diseases because they faithfully preserve disease-specific cellular crosstalk networks and the microenvironment^5,6,7. In pulmonary fibrosis, PCLS from IPF lungs retains native tissue architecture and cellular heterogeneity, enabling observation of various cell types and cell-extracellular matrix interactions^8,9, establishing them as a representative ex vivo model for investigating pulmonary pathophysiology. However, because pulmonary fibrosis is characterized by heterogeneous fibrotic lesions in the lungs, PCLS sampling is inherently blind. It is not possible to visually distinguish whether the obtained sections represent fibrotic areas in the quiescent phase, active phase, or normal lung tissue. This limitation underscores the necessity of visual assessment and screening tools. Previous research found that fibroblast activation protein (FAP) was highly and specifically expressed in the lung tissue of IPF patients, indicating that FAP could evaluate the pro-fibrotic activity of ILD¹⁰.

In this study, a single-chain antibody against FAP was labeled with indocyanine green (ICG) to develop a targeted molecular imaging probe with enhanced tissue penetration. The 600 µm PCLS obtained from healthy donors and IPF patients were imaged using this probe, and fibroblast activity was assessed based on fluorescent signal intensity. This imaging modality outperforms conventional fibrosis assessment techniques (Western blotting, qPCR, Masson's trichrome staining, or immunofluorescence) by simplicity of operation, maintaining cytoarchitectural integrity and viability while enabling longitudinal tracking of pathogenic progression. More importantly, it is easy to operate and requires only 90 min. This provides an advanced screening tool for the PCLS in vitro model, facilitating lung fibrosis research.

Protocol

The study was approved by the Ethics Committee of the First Hospital of Guangzhou Medical University (2021G-29). IPF was diagnosed based on physical examination and chest high-resolution computed tomography findings, following the diagnostic criteria established by ATS/ERS/JRS/ALAT (2022). All IPF patient specimens were obtained from lung transplantation or lung biopsy. Healthy lung tissue samples were obtained from organ donors diagnosed with brain death10. Written consent for tissue collection was obtained from each patient or the patient's family prior to collection. For details regarding all materials, solutions, and instruments used in this protocol, refer to the Table of Materials.

1. Preparation of Human PCLS

NOTE: Patients are routinely screened for viruses such as HIV, HCV, or syphilis prior to lung transplantation or biopsy, and must test negative before proceeding with subsequent experiments to ensure the occupational safety of laboratory personnel.

1. Solutions preparation
   1. Prepare phosphate buffered solution (1× PBS), and pre-cool at 4 °C.
   2. Prepare 2% agarose solution. Weigh 2 g of agarose and transfer it to an Erlenmeyer flask. Add 100 mL of PBS, mix thoroughly, and heat in a microwave until the mixture reaches a vigorous boil (≥95 °C), becoming completely clear, homogeneous, and free of visible particles or streaks. Swirl the flask occasionally during heating to prevent excessive boiling. Place the solution in a water bath at 37 °C until use.
2. Precision-cut lung slices
   1. Wash the external surface of the lung tissue with PBS to remove excess impurities and blood.
   2. Use a 20 mL syringe (1.2 mm needle) to aspirate an appropriate volume of agarose and insert it into the trachea. Inject agarose into the lung lobes slowly until fully inflated. Discontinue injection upon encountering marked resistance to prevent agarose leakage.
      NOTE: Approximately 10 mL of agarose is required for every 5 × 2 × 1 cm tissue block, avoiding overflow. For smaller tissue pieces, use a 5 mL syringe and embedding molds (e.g., silicone molds, plastic trays, or centrifuge tubes cut to size) to assist embedding. Pour a 1-2 mm thick base layer of agarose into the mold and allow it to semi-solidify. Gently place the lung tissue on the semi-solid agarose, then slowly pour additional agarose to cover the tissue fully, avoiding bubbles. Allow the agarose to solidify completely.
   3. Place the lungs on ice for approximately 30 min to allow agarose polymerization. Check the pleura for hardness and coolness to confirm polymerization; continue chilling if necessary.
   4. Cut the lung tissue into 1-2 cm slabs using a sharp blade.
   5. Center the ice bath tray on the cutting bench and fill it with ice cubes in advance for pre-cooling.
   6. Turn on the power switch and press and hold the UP button to raise the sample stage to a suitable position.
   7. Carefully load the blade onto the knife holder.
      NOTE: Handle the blade cautiously to avoid injury. Dispose of used blades in designated sharps containers.
   8. Cut a piece of tape approximately 3 cm long and 1 cm wide. Attach the sticky side to the tray and evenly coat the non-sticky side with cyanoacrylate adhesive.
   9. Pick up a piece of lung tissue using forceps. Blot the surface dry with absorbent paper and place it onto the glue-coated tape. Press gently to ensure firm adhesion.
   10. After the glue sets, load the tray onto the ice bath tray. Fill with pre-cooled PBS until the tissue block is submerged.
   11. Set the vibration frequency to "10" and the cutting speed to "2". Press the FWD button to begin slicing. After the first slice is fully cut, press the STP button to stop, then press the RVE button to retract the blade. Discard the first slice.
   12. Manually rotate the turntable 6 times to set the section thickness to 600 µm. Press the FWD button to resume slicing, and press the STP button after the section is cut. Press RVE to retract the knife and retrieve the lung slice using tweezers. Place the slice in PBS containing 1% penicillin/streptomycin (P/S) and keep it on ice.
   13. Repeat the above slicing steps to obtain additional PCLS, each approximately 600 µm thick.
   14. When the current tissue block is nearly exhausted, replace it with a new tissue block and repeat steps 1.2.4 to 1.2.13.

2. Purification of FAP antibody

NOTE: Generate the FAP-specific single-domain antibody containing a C-terminal His tag as previously described^11,12.

1. Perform phage display to enable high-throughput selection of FAP-specific antibody fragments (scFv) by repetitively panning combinatorial libraries against immobilized or solution-phase targets. Recover bound phages through stringent washing and elution. Amplify phages by reinfecting E. coli and enrich target binders over 3-4 cycles. Validate clones using phage ELISA and DNA sequencing to identify high-affinity antibodies¹².
2. Clone the DNA sequence encoding the anti-FAP single-chain variable fragment into the pET-28a(+) vector fused with a His tag for expression in E. coli¹³.
3. Transform the recombinant plasmid into E. coli BL21 (DE3) cells. Induce protein expression using isopropyl-β-D-1-thiogalactopyranoside (IPTG) in shake-flask cultures incubated overnight at 20 °C¹⁴.
4. Purify the FAP antibody from the supernatant using Nickel-Nitrilotriacetic acid (Ni-NTA) beads. Perform buffer exchange with PBS for downstream applications.
5. Assess antibody purity by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). A single dominant band at the expected molecular weight indicates high purity.

3. Assessment of FAP antibody affinity

1. Culture human embryonic kidney 293T (HEK 293T) cells in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin.
2. Add lentivirus overexpressing human fibroblast activation protein (hFAP) to 293T cells at 90% confluence. Incubate for 96 h to generate a stable 293T-hFAP cell line.
3. Digest both 293T and 293T-hFAP cells with 0.25% trypsin-EDTA and collect the cells.
4. Wash the cells with PBS and incubate with FAP antibody followed by Alexa Fluor 488-conjugated anti-His IgG.
5. Analyze fluorescence intensity using a NovoCyte flow cytometer^15,16.

4. scFv-FAP-ICG molecule probe labeling

1. Adjust the concentration of FAP-scFv to 2 mg/mL using PBS.
2. Add indocyanine green NHS ester (ICG-NHS) to achieve a molar ratio of 5:1 (ICG-NHS:FAP-scFv).
3. Mix thoroughly by vortexing and shaking.
4. Incubate the reaction in the dark at room temperature for 2 h.
5. Remove unbound dye using a desalting column. Store the final conjugated product at 4 °C in the dark.

5. scFv-FAP-ICG molecular probe for evaluating the degree of fibroblast activity in PCLS

1. After cutting the PCLS, place one section per well into a 12-well plate. Rinse each well twice with 1 mL PBS to remove residual blood and debris.
2. Submerge the PCLS in 1 mL DMEM without FBS. Add scFv-FAP-ICG at a final concentration of 5 µg/mL. Incubate on a shaker at room temperature for 1 h with gentle shaking, protected from light.
3. Wash the samples with PBS three times, each for 5 min.
4. Acquire ICG fluorescence images of PCLS using the in vivo animal imaging system with the following settings: excitation wavelength at 785 nm and emission wavelength at 810 nm.
5. Assess fibrosis activity of PCLS based on fluorescence intensity. Define regions of interest (ROI) using compatible software, with fluorescence radiance expressed as photons/s/cm²/sr.
   1. Click on the Select ROI button to allow the software to automatically outline the pseudo-colored area. If the ROI placement is inaccurate, adjust manually. Click on Calculate to determine signal strength within the region. If multiple subregions are selected, sum the values from all subregions.

Results

The preparation procedure for PCLS of human lung tissue is depicted in Figure 1. Human lung tissue was embedded in agarose and subsequently trimmed into tissue blocks approximately 1 cm³ in size using a razor blade. Trimmed and flattened tissues were affixed to a platform for sectioning at 600 µm thickness using a microtome (Figure 1A,B). PCLS were incubated in 12-well plates (Figure 1C).

Prepa...

Discussion

Through the above research methods, PCLS from healthy donors and IPF patients were prepared. Simultaneously, mammalian cells were used to express single-chain variable fragments of FAP, and their purity and specificity were verified. A molecular probe targeting FAP and labeled with ICG was employed to detect FAP expression levels, reflecting the degree of fibroblast activation. This approach provides an advanced evaluation method for pulmonary fibrosis treatment.

PCLS preserves the natural cel...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
0.25 % trypsin-EDTA	Gibco	15050-057
2× Color SYBR Green qPCR Master Mix (ROX2)	EZBioscience	A0012-R2
20 ml syringe	Winner	V532159
293T cell	Beyotime	C6008
502 glue	Zhuolide	D-40
Agarose, low gelling temperature	Sigma Aldrich	A9414-25G
Anti-Collagen I antibody	abcam	ab138492
Anti-Fibronectin antibody	abcam	ab2413
Anti-His-tag mAb-Alexa Fluor 488	MBL	D291-A48
BL21	Beyotime	D1009S
Blade	Gillette	7in83a7Q
Color Reverse Transcription Kit (with gDNA Remover)	EZBioscience	A0010CGQ
Coomassie Blue Super Fast Staining Solution	Beyotime	P0017F
DMEM	Gibco	12800017
Erlenmeyer flask	Sichuan Shunbo	GG-17
FAP Rabbit mAb	CST	66562
FBS	Gibco	10099-141
Forceps	Roboz	RS-5135
ICG-NHS	Ruixibio	R-TE-157
IPTG	MCE	367-93-1
microbalance	Secura	Secura225D-1CN
microwave	Mideo	PM2002
Multi-Mode In Vivo Animal Imaging System	BioLight	AniView600
Ni-NTA	Genscript	L00250
NovoCyte flow cytometer	ACEA Biosciences	Novocyte
PBS	Gibco	10010023
Penicillin-Streptomycin	Gibco	15140122
SDS-PAGE	Beyotime	P00528
Universal RNA Purification	EZBioscience	EZB-RN4
Vibratome	DOSAKA	DTK-1000N
β-actin Rabbit pAb	Yeasen	30102ES
Primer
β-actin primer-F	iGenebook Biotech		CATGTACGTTGCTATCCAGGC
β-actin primer-R	iGenebook Biotech		CTCCTTAATGTCACGCACGAT
FAP primer-F	iGenebook Biotech		TTGAGTGGATGGGAGGGAT
FAP primer-R	iGenebook Biotech		GCTGTGCTCGTGGATTTGT
Collagen-I primer-F	iGenebook Biotech		GAGGGCCAAGACGAAGACATC
Collagen-I primer-R	iGenebook Biotech		CAGATCACGTCATCGCACAAC
Fibronectin primer-F	iGenebook Biotech		CGGTGGCTGTCAGTCAAAG
Fibronectin primer-R	iGenebook Biotech		AAACCTCGGCTTCCTCCATAA