Establishment and Evaluation of an In Vitro Human-Based Advanced Model of Pulmonary Fibrosis

Summary

An imaging method was developed to evaluate the activation of fibroblasts in human precision-cut lung slices based on fibroblast activation protein (FAP). This methodology establishes a robust and reproducible platform for staging fibrotic progression, advancing translational in vitro models for therapeutic development while maintaining the fidelity of the human tissue microenvironment.

Abstract

Pulmonary fibrosis is characterized by irreversible destruction of alveolar structure and excessive deposition of extracellular matrix. Although animal models have been widely used in pulmonary fibrosis research, none of the currently available models fully recapitulate the progressive nature of IPF or its defining histological feature, such as fibroblastic foci. Advanced in vitro models, including precision-cut lung slices (PCLS), are often considered the most physiologically relevant pulmonary test system and have been successfully employed for drug screening. Nevertheless, the inability to differentiate the degree of fibrosis in the IPF lung has resulted in blinding and uncertainty in the PCLS obtained. Previous research demonstrated that fibroblast activation protein (FAP) could evaluate the pro-fibrotic activity of ILD, potentially contributing to early diagnosis and the selection of appropriate therapeutic windows. In this study, 600 µm PCLS will be obtained from healthy donors and IPF patients using a shock slicer and evaluated using molecular probes targeting FAP to determine the degree of fibroblast activity based on fluorescent signal intensity. This approach provides an advanced in vitro model and evaluation technique for pulmonary fibrosis research, enhancing the ability to study disease mechanisms and assess therapeutic interventions.

Introduction

Pulmonary fibrosis (PF) is a common form with an unknown etiology and a particularly poor prognosis, with a median five-year survival rate of only 25%¹. The intratracheal bleomycin administration model is currently the most widely used animal model for preclinical studies². However, fibrosis induced by bleomycin is transient and resolves over time, which contrasts sharply with the irreversible nature of IPF³. Moreover, the intratracheal bleomycin model presents significant challenges due to the heterogeneous severity of fibrosis resulting from endotracheal administration, whether surgical or nonsu....

Protocol

The study was approved by the Ethics Committee of the First Hospital of Guangzhou Medical University (2021G-29). IPF was diagnosed based on physical examination and chest high-resolution computed tomography findings, following the diagnostic criteria established by ATS/ERS/JRS/ALAT (2022). All IPF patient specimens were obtained from lung transplantation or lung biopsy. Healthy lung tissue samples were obtained from organ donors diagnosed with brain death10. Written consent for tissue collection was obtained from each patient or the patient's family prior to collection. For details regarding all materials, solutions, and instruments used in this protocol, refer to....

Results

The preparation procedure for PCLS of human lung tissue is depicted in Figure 1. Human lung tissue was embedded in agarose and subsequently trimmed into tissue blocks approximately 1 cm³ in size using a razor blade. Trimmed and flattened tissues were affixed to a platform for sectioning at 600 µm thickness using a microtome (Figure 1A,B). PCLS were incubated in 12-well plates (Figure 1C).

Prepa.......

Discussion

Through the above research methods, PCLS from healthy donors and IPF patients were prepared. Simultaneously, mammalian cells were used to express single-chain variable fragments of FAP, and their purity and specificity were verified. A molecular probe targeting FAP and labeled with ICG was employed to detect FAP expression levels, reflecting the degree of fibroblast activation. This approach provides an advanced evaluation method for pulmonary fibrosis treatment.

PCLS preserves the natural cel.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
0.25 % trypsin-EDTA	Gibco	15050-057
2× Color SYBR Green qPCR Master Mix (ROX2)	EZBioscience	A0012-R2
20 ml syringe	Winner	V532159
293T cell	Beyotime	C6008
502 glue	Zhuolide	D-40
Agarose, low gelling temperature	Sigma Aldrich	A9414-25G
Anti-Collagen I antibody	abcam	ab138492
Anti-Fibronectin antibody	abcam	ab2413
Anti-His-tag mAb-Alexa Fluor 488	MBL	D291-A48
BL21	Beyotime	D1009S
Blade	Gillette	7in83a7Q
Color Reverse Transcription Kit (with gDNA Remover)	EZBioscience	A0010CGQ
Coomassie Blue Super Fast Staining Solution	Beyotime	P0017F
DMEM	Gibco	12800017
Erlenmeyer flask	Sichuan Shunbo	GG-17
FAP Rabbit mAb	CST	66562
FBS	Gibco	10099-141
Forceps	Roboz	RS-5135
ICG-NHS	Ruixibio	R-TE-157
IPTG	MCE	367-93-1
microbalance	Secura	Secura225D-1CN
microwave	Mideo	PM2002
Multi-Mode In Vivo Animal Imaging System	BioLight	AniView600
Ni-NTA	Genscript	L00250
NovoCyte flow cytometer	ACEA Biosciences	Novocyte
PBS	Gibco	10010023
Penicillin-Streptomycin	Gibco	15140122
SDS-PAGE	Beyotime	P00528
Universal RNA Purification	EZBioscience	EZB-RN4
Vibratome	DOSAKA	DTK-1000N
β-actin Rabbit pAb	Yeasen	30102ES
Primer
β-actin primer-F	iGenebook Biotech		CATGTACGTTGCTATCCAGGC
β-actin primer-R	iGenebook Biotech		CTCCTTAATGTCACGCACGAT
FAP primer-F	iGenebook Biotech		TTGAGTGGATGGGAGGGAT
FAP primer-R	iGenebook Biotech		GCTGTGCTCGTGGATTTGT
Collagen-I primer-F	iGenebook Biotech		GAGGGCCAAGACGAAGACATC
Collagen-I primer-R	iGenebook Biotech		CAGATCACGTCATCGCACAAC
Fibronectin primer-F	iGenebook Biotech		CGGTGGCTGTCAGTCAAAG
Fibronectin primer-R	iGenebook Biotech		AAACCTCGGCTTCCTCCATAA