Blue Light-inducible Semi-random Mutagenesis on Specific Exogenous DNA in Escherichia coli BL21 Strain

Summary

The outlined protocol describes streamlined methods for recognizing any exogenous DNA while generating mutations only on those exogenous DNAs in Escherichia coli.

Abstract

Mutagenesis technologies have been widely used in variation breeding, directed evolution, and protein engineering. However, most methods can only induce random genomic DNA mutations that are uncontrollable, leading to deformities or even lethal effects. Here, by leveraging the fusion of three systems: cytosine base editor (CBE), blue light-inducible p-Mag/n-Mag elements, and split T7 RNA polymerase, this outlined method incorporates a blue-light-controllable, DNA region-specific, semi-random mutagenesis system.

This system can mutate cytosine to thymine on DNAs starting from the T7 promoter and ending in the T7 terminator. Any exogenous gene downstream of the T7 promoter can be potentially mutated. These tools were also designed in two parts to make the system blue-light-controllable. The first part was created by fusing CBE with n-Mag and the N-terminal-T7 RNA polymerase gene. The second part involved fusing p-Mag with the C-terminal-T7 RNA polymerase. Under blue light, these two parts were assembled to function as a mutation generator on DNAs between the T7 promoter and the T7 terminator. Without blue light, p-Mag is detached from n-Mag, releasing the CBE from editing the DNA.

The aim of this protocol is to generate region-specific random mutations in Escherichia coli with blue light control and further validate the mutated plasmids. The system can be adapted to an in vivo evolution system where the function of the gene of interest can be selected, and the desired mutations can be collected for further study.

Introduction

Random mutation and natural selection are the key forces driving evolution, which has generated large genetic variation across species. The evolutionary process has been utilized as a powerful tool to engineer proteins with optimized or novel functions¹. Natural mutation rates from DNA replication have been estimated to be about one in 10⁹ bases per cell division in multiple prokaryotes and eukaryotes². Low natural mutation rates make it impractical to generate large genetic diversity in laboratories. Studies have focused on developing methods that increase the mutation rates to cover as many sites as possible in a given gene within a reasonable amount of time.

Multiple systems have been developed to achieve higher mutation rates in laboratory evolution studies^{3,4,5,6,7,8,9,10}. In vitro evolution systems leverage error-prone PCR, site-directed saturation mutagenesis, or computational library design to introduce mutations in genes of interest¹. The DNA libraries are transformed into host cells where the protein products are screened or selected. The mutagenesis and selection steps in in vitro evolution are not coupled, limiting the efficiency and scale of populations that can be generated¹¹. In vivo evolution systems have overcome the limitations by introducing mutation systems into cells and coupling the mutagenesis and selection steps to enable continuous evolution. Earlier in vivo mutagenesis methods employed chemical mutagens^3,4 and mutator strains^5,6. However, these methods suffer from low mutation rates, lack of control, and narrow or uneven mutational spectrum¹². Recent studies have developed novel and improved in vivo evolution systems, represented by OrthoRep, an orthogonal error-prone DNA replication system^7,8; MutaT7, a fusion of cytidine deaminase to T7 RNA polymerase⁹; and EvolvR, a fusion of nickase Cas9 to error-prone DNA polymerase¹⁰. These methods have different host cells, target context, and ease of implementation.

T7 RNA polymerase (T7 RNAP), a key component of the MutaT7 system, has been extensively studied and engineered in the field of synthetic biology. Fragments of T7 RNAP have been co-expressed at different levels at different time points to build a resource allocator¹³. A split T7 RNAP with C-terminal fragments of different promoter specificity has been built to create AND logic gate¹⁴. The ability of T7 RNAP fragments to assemble to reconstitute a functional polymerase has led to the development of light- and small molecule-activated biosensors where dimerization of interaction partners fused to each of the N- and C-terminals of T7 RNAP generates transcriptional output¹⁵. The split T7 RNAP has also been fused to n-Mag and p-Mag domains to build light-inducible gene expression control in Escherichia coli¹⁶. Upon blue light activation, the Magnet domains dimerize, bringing two domains of the split T7 RNAP spatially close to carry out polymerase function. This system enables precise spatiotemporal control of gene expression with low basal expression and a large dynamic range.

This paper presents a protocol to build a blue light-controllable, in vivo, semi-random mutagenesis system (Figure 1). It is built on rAPOBEC1 deaminase fused to n-Mag-N-T7 RNAP. Co-expression of p-Mag-C-T7 RNAP from the same plasmid enables blue light control of the polymerase and base editing activities. The system combines the base editing capacity of rAPOBEC1 with light-controlled split T7 RNAP. It has been validated in E. coli using green fluorescent protein (GFP) as the target gene where its intensity is selected by fluorescence-activated cell sorting (FACS). Compared to the original MutaT7 system, our blue light-controlled system introduces semi-random mutations in the target gene by modulating the light interval. Instead of converting all cytosine to uracil bases in the target gene, it generates a larger mutation profile by editing a subset of the nucleotides through light control. The system can be easily adapted to an in vivo evolution system where the GFP can be replaced by other genes of interest and the function can be selected by cell fitness or survival.

Protocol

The following protocol outlines how to perform exogenous DNA mutagenesis design using CBE-Mag-T7 polymerase mutagenesis system (Step 1). Once the exogenous DNA plasmid is constructed, steps for transformation of the two plasmids are described for expressing CBE-Mag-T7 polymerase mutagenesis in the E. coli BL21 strain by adding isopropyl β-D-1-thiogalactopyranoside (IPTG) and followed by irradiating with blue light forinitiating the mutagenesis (Steps 2-9.2). The quality control steps for evaluating how many mutations were generated on either GFP or exogenous DNA were performed using Sanger sequencing (Steps 9.3-11.2).

1. Design exogenous DNA and construct the CBE-Mag-T7 polymerase mutagenesis system

1. Find the exogenous DNA or cDNA sequencing using online tools (https://www.ncbi.nlm.nih.gov/gene or https://www.uniprot.org/). 
   NOTE: Here, we used the GFP sequence as an exogenous DNA for cytosine mutagenesis.
2. Replace the gfp DNA with the DNA of interest using an appropriate cloning kit.
   NOTE: We use NheI to remove the gfp DNA in the original plasmid in DNA colony assembly kit. An alternative is to work with companies for the DNA synthesis. See Supplemental File 1 for plasmid sequence.
3. Synthesize all the genes together with the CBE-Mag-T7 polymerase mutagenesis system and incorporate them into the pET-11a backbone with ampicillin resistance.
   NOTE: We worked with a DNA synthesis company to build this plasmid, and we obtained glycerol stock bacteria containing our target plasmid.

2. Bacterial strain activation

1. Pipette 10 µL of the glycerol stock bacteria onto the edge of an LB agar plate containing 100 µg/mL ampicillin. Streak the bacteria from this spot across the plate using a sterile loop.
2. Incubate the plate upside down at 37 °C overnight in a bacterial incubator.

3. Plasmid amplification

1. Pick a single colony from the plate and inoculate it into a 50 mL conical tube with 15 mL of LB medium containing 100 µg/mL ampicillin.
2. Place the culture in a shaking incubator at 37 °C, 180 rpm for 14-16 h.

4. Plasmid extraction

1. Take 5-15 mL of the overnight bacterial culture and transfer it into a centrifuge tube. Centrifuge at 18,894 × g for 1 min.
2. Collect the bacterial pellet and carefully remove all the supernatant. Resuspend the bacterial pellet in 500 µL of resuspension buffer by vortexing or pipetting.
3. Add 500 µL of lysis buffer to the tube, mix gently by inverting the tube 8-10x, and let it sit at room temperature for 5 min to lyse the cells.
   NOTE: Confirm complete lysis by ensuring no visible white flocculent material remains.
4. Add 200 µL of equilibration buffer to the spin column placed in a collection tube. Centrifuge at 18,894 × g for 2 min and discard the flowthrough. Place the column back into the collection tube.
5. Add 500 µL of neutralization buffer to the bacterial lysate, mix gently by inverting the tube 8-10x until a white precipitate appears, and let it sit at room temperature for 5 min.
6. Centrifuge at 18,894 × g for 5 min, and transfer the supernatant to a filter column. Centrifuge at 18,894 × g for 1 min to filter the solution.
7. Add 0.3x the volume of isopropanol to the filtered solution, mix by inverting. Transfer the mixture to the equilibrated spin column.
8. Centrifuge at 18,894 × g for 1 min, discard the flowthrough, and place the column back into the collection tube.
9. Wash the column with 750 µL of wash buffer, centrifuge at 18,894 × g for 1 min, and discard the flowthrough.
10. Centrifuge the column again at 18,894 × g for 1 min to remove residual wash buffer.
11. Place the spin column in a new centrifuge tube. Add 100-200 µL of elution buffer to the center of the column membrane. Let it sit at room temperature for 2-5 min and centrifuge at 18,894 × g for 2 min. Store the plasmid DNA at -20 °C.

5. Plasmid transformation (E. coli BL21 chemically competent cells)

1. Take 50 µL of thawed BL21 chemically competent cells on ice. Add 2 µL of plasmid DNA from step 4.11 and mix gently. Incubate on ice for 30 min.
2. Heat shock at 42 °C for 45 s, then immediately transfer the tube back to ice for 2 min.
3. Add 500 µL of sterile LB medium to each tube. Incubate at 37 °C, 180 rpm for 1 h to allow recovery.
4. Centrifuge at 1,000 × g for 5 min, discard excess supernatant, leaving approximately 100 µL. Resuspend the cells and plate onto LB agar containing 100 µg/mL ampicillin. Incubate upside down at 37 °C overnight.

6. Expressing CBE-Mag-T7 polymerase mutation generator (inactive form)

1. Follow steps 5.1-5.4. Before spreading the cells, uniformly apply 1 mM IPTG to the surface of the LB agar with ampicillin. Use deionized water as a control to compare with IPTG treated groups.
2. After all the colonies are grown, pick 10-20 colonies to culture in 5 mL of LB medium containing 1 mM IPTG in 100 mL round-bottom glass tubes with phenolic screw cap and rubber liner at 16 °C, 180 rpm for 8 h.
   NOTE: All the colonies can be stored at 4 °C for short-term storage before proceeding to step 7.

7. Activate the CBE-Mag-T7 polymerase mutation generator

1. Collect the bacteria in 100 mL round-bottom glass tubes with phenolic screw cap and rubber liner and centrifuge at 18,894 × g for 2 min.
2. Change the medium to LB medium without any IPTG.
   NOTE: This step is important to make sure the CBE-Mag-T7 polymerase mutation generator cannot edit itself. We have designed the lacI/O system to protect the CBE-Mag-T7 polymerase genes clusters.
3. Irradiate the plate with one blue-light irradiator (470 nm, 4 mW/cm²) while culturing at 37 °C for the predetermined time. Perform Sanger sequencing to verify the mutations and check if longer exposure increases mutation frequency.
   NOTE: Here, we set blue light exposure for 0, 8, 16, and 24 h.

8. Selection of mutations for increased protein function and continued mutagenesis

NOTE: Here, we use gfp gene as an exogenous DNA for mutagenesis and are looking for mutations that can enhance the fluorescent intensity of GFP protein.

1. Pick the colonies, label the position on a plate, and inoculate the collected colonies into 100 µL of ddH₂O.
2. Transfer the 100 µL of bacterial suspension to a 96-well plate and read the GFP intensity at Ex/Em = 488/510 nm.
3. Repeat steps 6.3 to 9.2 until some obvious colonies can be identified.

9. Stop the mutagenesis and verify the mutations

1. After performing several hours of blue-light irradiation, move all the bacteria back to a dark place at 4 °C for another 15 min.
2. Follow the same plasmid extraction steps as described in step 4.
3. Design the forward and reverse primers for Sanger sequencing.
   NOTE: Here, we use ATGGTGAGCAAGGGCGAGGAGCTGT as a forward primer and TTACTTGTACAGCTCGTCCATGCCG as a reverse primer for Sanger sequencing.

10. Data analysis and mutation frequency calculation

1. View the mutation by opening the .ab1 file and check the peaks manually.
2. Analyze the mutation frequency by using online tools (e.g., Mutation Surveyor tool).
3. Upload the Sanger data file to the online tool and start the analysis of the mutation rate.

11. Bacterial glycerol stock preparation

1. Inoculate a single colony into a tube containing 5 mL of LB medium with 100 µg/mL ampicillin. Incubate at 37 °C, 180 rpm for 12-16 h.
2. Mix the bacterial culture with 50% glycerol at a 1:1 ratio. Aliquot into 1.5 mL centrifuge tubes. Store at -80 °C.

Results

The methods outlined in this protocol are for the creation of mutations on exogenous DNA using a split CBE-Mag-T7 RNA polymerase mutation generator. Genes for building the CBE-Mag-T7 RNA polymerase mutation system and the target gene for mutagenesis are all incorporated into the pET-11a plasmid backbone. Successful transformation and blue light irradiation were performed without any damage to the bacterial genomic DNA, shown through normal and comparable colony numbers on LB-agar (Figure 2)....

Discussion

The polymerase-guided base editing tool was first created by Cravens et al. in 2021, using a protein fusion strategy¹⁷. Mutations on four DNA nucleotides were successfully incorporated at rates greater than 10^-4 mutations per bp. However, since mutations were continuously introduced between T7 promotor and terminator without additional control by researchers¹⁸, "good" mutations could not be preserved from ongoing editing. To address this limitation, we in...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
50 mL Conical Centrifuge Tubes	Falcon	CLS352070
Ampicillin	Thermo Scientific Chemicals	J60977.14
Blue-light irradiator	Thorlabs	LIU470A
DNA Assembly Cloning Kit	NEB	E5520S
DNA/Prmers synthesis	BGI Genomics
EndoFree Plasmid Midi Kit	CWBIO	CW2106S	Buffer P1: resuspension buffer, Buffer P2: lysis buffer, Buffer E3: equilibration buffer, Buffer PS: neutralization buffer, Buffer PW: wash buffer,Endo-Free Buffer EB: DNA purification buffer,RNase A Endo-Remover FM: endotoxin removal buffer, Spin Columns DM with Collection Tubes
Glycerol	Fisher Chemical	G33-4
Incubated Shaker	Thermo Scientific	SK2001CPKG
IPTG (isopropylthio-β-galactoside)	Invitrogen	15529019
Microplate Reader	Thermo Scientific	Varioskan LUX
Microscope	Leica	DMI 4000B
Multiskan FC	Thermo Scientific Chemicals
One Shot BL21(DE3) Chemically Competent E. coli	Invitrogen	C600003
PureLink Fast Low-Endotoxin Midi Plasmid Purification Kit	Invitrogen	A36227
Pyrex heavy-duty round-bottom centrifuge tubes, with phenolic screw cap and rubber liner	Corning 8422	CLS8422100