This experimental research was conducted with the approval of the Institutional Animal Care and Use Committee (Approval Number: LL-240077).
Cell culturing and drug intervention
Rat Schwann cells (SCs) were cultured in Schwann Cell Medium, consisting of basal medium, 5% fetal bovine serum, 1% Schwann cell growth supplement, 1% penicillin, and 1% streptomycin. All cells were kept in a 5% CO2 atmosphere at 37 °C. When allowed to grow up to a density of 70-80%, SCs were divided into four groups (n = 5 per group): (1) NC group; (2) NC+CoCl2 group; (3) NC+CoCl2+Mus group; (4) NC+CoCl2+siIL-1R1+Mus group.
Cobalt chloride (CoCl2), a frequently employed agent to mimic hypoxia, is known to trigger responses similar to those of hypoxia, such as the impeding degradation and stabilization of hypoxia-inducible factors and accumulation of HIF-1α protein15. According to the modified method based on Osuru et al.17, in the NC+CoCl2 group and NC+CoCl2+Mus group, SCs were cultured in Schwann Cell Medium supplemented with 240 µM CoCl2 for 8 h, at atmospheric conditions of 95% air and 5% CO2 at 37 °C in a humidified incubator (21% O2). Then, in the Mus groups, the intervention of 1.25 µg/mL Mus for an additional 24 h was applied. Meanwhile, in the NC+CoCl2+siIL-1R1+Mus group, the SCs were firstly treated with 24 h of siRNA infection, then continually cultured with 240 µM CoCl2 for 8 h, followed by the intervention of 1.25 µg/mL Mus for an additional 24 h, as in the former groups. The flowchart of the experimental process is shown in Figure 1.
Cell viability assay
The viability of SCs was determined using the cell counting kit-8 (CCK-8) assay reagent according to the manufacturer's instructions. Cultured SCs at a density of 5 × 105 cells/well were seeded in a 96-well cell culture plate with 100 µL of complete growth medium at 37 °C in a 5% CO2 humidified atmosphere. When the confluency reached 70-80%, 10 µL of CCK-8 solution was added to each well, and the plates were incubated for 1 h at 37 °C. The optical density (OD) of the 96-well plates was measured at 450 nm using a microplate reader, and the cell viability was calculated. The cells were divided into four groups: NC group, NC+CoCl2 group, NC+CoCl2+Mus group, and NC+CoCl2+siIL-1R1+Mus group. The experimental results were corrected using a blank well (medium+CCK8 solution). Cell survival rate = [(experimental group - blank well)/(NC group - blank well)] × 100%.
siRNA transfection
Transfection was conducted according to the manufacturer's instructions of a commercial in vitro siRNA/miRNA transfection reagent using synthetic siRNA duplexes of siIL-1R1 (AUAGUCUUGGAUUUUCUCCAA, GGAGAAAAUCCAAGACUAUGA) with a concentration of 100 ng/µL for 24 h. After siIL-1R1 transfection, the siIL-1R1 expressions were assessed by performing RT-qPCR analysis after 24 h of transfection18, and the efficiency must be ensured to be higher than 80%
Enzyme-linked immunosorbent assay (ELISA)
Post-culture supernatants were collected and centrifuged under group-specific conditions (2950 g, 20 min, 25 °C). Extracellular levels of IL-1β, TNF-α, ROS, and SOD were assayed via ELISA following kit instructions. Final absorbance readings at 450 nm were obtained using a microplate reader.
RNA isolation and quantitative real-time PCR (RT-qPCR)
Following manufacturer instructions, total RNA was extracted from cultured cells using TRizol reagent. Target genes (IL-1β, TNF-α, S-100b, IL-1R1) were amplified in 20 µL of SYBR qPCR mix reactions for 40 cycles on a PCR instrument. Data normalization used β-actin, with PCR specificity verified by melting curve analysis. The 2−ΔΔCt method quantified relative expression from five independent samples assayed in triplicate. Primers are listed in Table 1.
Western blot
Following treatment, SCs from all experimental groups were incubated for 24 h and harvested. Total protein was extracted using a total protein extraction kit. Protein lysates were combined with sodium dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE) loading buffer denatured at 98 °C for 5 min, and separated (20 µg per lane) on 10-12% SDS-polyacrylamide gels. Resolved proteins were electrophoretically transferred to polyvinylidene fluoride (PVDF) membranes. Membranes were blocked with 5% non-fat dry milk for 60 min at room temperature, then incubated overnight at 4 °C in a volume of 6 mL with the following primary antibodies: anti-HIF-1α antibody (1:1000), anti-GAPDH antibody (1:1000), anti-IL-1R1 antibody (1:1000), anti-C-JUN antibody (1:1000), anti-GDNF antibody (1:1000), anti-IRAK1 antibody (1:1000), anti-IKK antibody (1:1000), anti-p65 antibody (1:800), anti-p50 antibody (1:900), anti-IκB-α antibody (1:900) and anti-β-actin antibody (1:1000). After washing, membranes were probed with horseradish peroxidase (HRP)-conjugated secondary antibodies for 60 min at 25 °C. Protein signals were detected using Image Studio Digits Ver 4.0. Band intensities were quantified with ImageJ software and normalized to β-actin and GAPDH expression. Three independent experiments were performed.
Immunofluorescence
IL-1R1 localization in SCs was assessed following Zhao et al.19. Harvest cells during the logarithmic growth phase by trypsinization, resuspend them in fresh complete medium, and triturate thoroughly to obtain a uniform single-cell suspension. Seed the cells onto culture plates containing sterile cover slips. Once the cells have reached full confluence, rinse them 1-2 times with phosphate-buffered saline (PBS), carefully remove the cover slips, and fix the adherent cells with 4% paraformaldehyde in PBS for 10 min, permeabilize with 0.05% Triton X-100 (10 min), and block with 5% goat serum (1 h). Primary incubation used rabbit anti-rat IL-1R1 mAb. After PBS washes, samples were incubated with FITC-conjugated goat anti-rabbit IgG for 2 h at room temperature. Add water-soluble mounting agents to the cover slip for mounting. Immunolabeled cells were visualized and quantified using a fluorescence microscope with the excitation wavelength 492 nm and the emission wavelength 520 nm.
Ultrastructure analysis
Following Zhao et al.'s protocol19, SCs were fixed in 2.5% glutaraldehyde and post-fixed overnight at 4°C in 1% osmium tetroxide. Samples underwent an ethanol/acetone dehydration series. Ultrathin sections (80 nm) were stained with uranyl acetate and lead citrate prior to ultrastructural examination using a transmission electron microscope.
Disposal of hazardous chemical reagents
The medium and solutions containing CoCl2 are collected into a designated heavy metal waste container. All disposable materials that have come into contact with the aforementioned liquids, including pipette tips, centrifuge tubes, and gloves are classified as heavy metal hazardous waste and are transferred to a licensed hazardous waste management company approved by the relevant authorities for proper disposal. Discard waste paraformaldehyde solution into a dedicated aldehyde waste container. Used consumables should be collected as aldehyde waste and processed by the same licensed hazardous waste management company.
Statistical analysis
Multi-group comparisons were analyzed by one-way ANOVA with Tukey's post-hoc test in GraphPad Prism 8.0. Statistical significance was defined as P < 0.05. Data are presented as mean ±± standard deviation (SD).