CD8+CD103+ Tregs Attenuate Dry Eye Disease Through Suppression of CD4+ T Cell-Mediated Inflammation and Protection of Ocular Surface Integrity in Mice

Summary

Here, we present a protocol demonstrating the adoptive transfer of CD8+CD103+ regulatory T cells as an immunotherapeutic intervention to ameliorate desiccating stress-induced dry eye disease through the comprehensive modulation of pathogenic CD4+ T cell responses.

Abstract

CD8+CD103+ regulatory T cells represent a specialized immunosuppressive population with demonstrated therapeutic potential in autoimmune disorders; however, their role in ocular surface inflammation remains unexplored. This protocol describes a systematic approach for isolating CD8+CD103+ T cells from mice exposed to desiccating stress and evaluating their therapeutic efficacy through adoptive transfer in experimental dry eye disease. The methodology encompasses magnetic-activated cell sorting for CD8+CD103+ T-cell purification, standardized desiccating stress induction, and comprehensive functional assessments, including tear production measurement, corneal barrier permeability testing, and molecular analysis of inflammatory mediators. Representative results demonstrate that CD8+CD103+ T cell therapy significantly restored tear production, preserved conjunctival goblet cell populations, and maintained corneal epithelial barrier integrity. Treatment achieved substantial suppression of matrix metalloproteinase expression, reduced apoptotic cell death, and modulated cytokine profiles from pro-inflammatory to tissue-protective patterns. The protocol effectively reduced CD4+ T cell infiltration in ocular tissues, while simultaneously suppressing pathogenic IL-17A and IFN-γ production and enhancing protective IL-13 levels. This approach provides a robust experimental framework for investigating CD8+CD103+ T cell-mediated immunomodulation in ocular surface disorders and establishes a foundational methodology for developing novel cell-based therapeutics for dry eye disease management.

Introduction

Dry eye disease (DED) represents a prevalent and debilitating ocular surface disorder that has emerged as a significant global health concern, affecting 10-30% of the worldwide population and substantially compromising patients' quality of life, work productivity, and psychological well-being^1,2,3. The pathophysiology of DED involves a complex interplay between tear film instability, ocular surface inflammation, and neurosensory abnormalities, which collectively perpetuate a vicious cycle of tissue damage and functional impairment⁴. At the molecular level, tear hyperosmolarity serves as a central pathogenic mechanism, triggering cascading inflammatory events that activate stress response pathways, induce proinflammatory mediator release, and ultimately compromise the delicate homeostatic balance of the ocular surface microenvironment^5,6,7.

The immunological landscape of DED is dominated by adaptive immune responses, with CD4+ T cell-mediated immunity playing a pivotal role in orchestrating ocular surface deterioration and perpetuating chronic inflammation⁸. CD8+ T cells constitute an essential component of the normal homeostatic immune cell population within ocular tissues, maintaining immune surveillance and tissue integrity under physiological conditions⁹. Seminal investigations have demonstrated that desiccating stress (DS) activates antigen-presenting cells and subsequently primes CD4+ T cells toward pathogenic phenotypes, which can autonomously induce autoimmune lacrimal keratoconjunctivitis sicca (KCS) when adoptively transferred to T-cell-deficient nude mice, thereby recapitulating the key features of human DED^10,11.

Given the central role of dysregulated CD4+ T cell responses in DED pathogenesis, therapeutic strategies targeting the modulation of pathogenic T cell immunity have emerged as promising approaches for the management of this disease. In this context, CD8+ regulatory T cells (Tregs), particularly the CD8+CD103+ subset, have garnered significant attention because of their potent immunosuppressive capabilities and tissue-protective functions across diverse autoimmune and inflammatory conditions. These specialized regulatory populations modulate immune responses through multiple mechanisms, including cytokine-mediated suppression, direct cell-to-cell contact inhibition, and metabolic regulation of effector lymphocyte function^12,13,14. Integrin αEβ7 (CD103) serves as a critical homing receptor that facilitates intraepithelial lymphocyte positioning across mucosal tissues, enabling CD8+CD103+ Tregs to exert localized immunoregulatory effects at sites of inflammation¹⁵.

There is growing evidence that CD8+CD103+ Tregs have significant therapeutic potential for mitigating harmful immune reactions in a range of autoimmune mucosal conditions^16,17,18. These cells exhibit unique trafficking patterns that allow their preferential accumulation at mucosal sites, where they can effectively counteract tissue-destructive immune responses while promoting healing and homeostasis. Recent investigations have begun to elucidate the role of CD8+CD103+ T cells in ocular surface immunity, demonstrating their numerical expansion in cervical lymph nodes following DS exposure and their capacity to migrate to conjunctival tissues^19,20,21,22. However, despite these intriguing observations, the specific functional contributions of CD8+CD103+ T cells to dry eye pathogenesis and their therapeutic potential in modulating CD4+ T cell-mediated ocular surface damage remain incompletely understood.

Adoptive transfer of CD8+CD103+ Tregs represents a distinct advancement over conventional DED therapeutic approaches, including artificial tears, anti-inflammatory agents, and immunosuppressive drugs, by targeting the underlying pathogenic immune mechanisms rather than merely addressing symptomatic manifestations²³. Unlike systemic immunosuppressive therapies that broadly suppress immune function, CD8+CD103+ Treg-based intervention offers targeted modulation of pathogenic CD4+ T cell responses while preserving protective immunity²⁴. This approach complements existing cell-based therapies, such as mesenchymal stem cell applications and CD4+CD25+ Treg transfer, by providing enhanced mucosal tissue specificity through CD103-mediated homing mechanisms²⁵.

The critical knowledge gap regarding the regulatory mechanisms by which CD8+CD103+ T cells might influence dry eye pathogenesis represents a significant barrier to developing targeted immunotherapeutic interventions for this debilitating condition. Furthermore, the complex interplay between regulatory and effector T cell populations in ocular surface inflammation requires systematic investigation to identify novel therapeutic targets and optimize treatment strategies. This study aims to comprehensively characterize CD8+CD103+ T cell-mediated regulation of CD4+ T cell-driven pathogenic processes in a well-established mouse model of dry eye disease. The core methodological innovation involves the sequential isolation of CD8+CD103+ regulatory cells, followed by adoptive transfer and comprehensive assessment of functional, histological, and molecular readouts to establish therapeutic efficacy and elucidate underlying mechanisms. The ultimate objective was to enhance our understanding of immune responses on the ocular surface and discover potential treatment strategies for managing DED in humans.

Protocol

All experimental procedures involving animals were conducted in strict accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and were approved by the Experimental Animal Ethics Committee of the Jinan Second People's Hospital. All efforts were made to minimize animal suffering and reduce the number of animals used in accordance with the 3Rs principle (Replacement, Reduction, and Refinement).

1. Animal preparation and experimental design

1. Obtain female C57BL/6 mice aged 6-8 weeks from an approved laboratory animal facility (strain code: 027) with a specific pathogen-free health status.
2. House animals in a controlled environment, maintaining 12 h light-dark cycles (lights on 06:00-18:00), temperature at 22 ± 2 °C, and relative humidity of 50-60% using environmental monitoring systems.
3. Allow animals to acclimatize for 1 week before experimental procedures while providing standard laboratory chow and water ad libitum.
4. Randomize 32 mice into four experimental groups (n = 8 per group) using computer-generated randomization: non-stressed controls (NS), desiccating stress alone (DS), desiccating stress with vehicle control (DS + VC), and desiccating stress with CD8+CD103+ T cell treatment (DS + CD8+CD103+).
   ​NOTE: Monitor animals daily for signs of distress, such as reduced activity or weight loss exceeding 10%.

2. Desiccating stress induction

1. Prepare scopolamine hydrobromide solution by dissolving 0.5 mg in 0.2 mL of sterile phosphate-buffered saline (PBS) immediately before use, achieving a final concentration of 2.5 mg/mL.
2. Administer scopolamine subcutaneously at a dose of 0.5 mg/kg body weight (approximately 0.04 mL per 20 g mouse) four times daily at 8:00, 12:00, 15:00, and 18:00 h for five consecutive days using 27-G needles.
3. Position variable-speed fans to generate a continuous air draft with a standardized velocity of 15 m/s measured at cage level using a digital anemometer calibration.
4. Maintain ambient humidity below 40% using desiccant chambers containing activated silica gel (Grade 40, 6-12 mesh) while monitoring environmental conditions continuously with digital hygrometers (accuracy ±2% RH).
5. Maintain temperature at 22 ± 1 °C throughout the entire exposure period using precision environmental control systems with continuous monitoring.
6. Monitor animals twice daily for signs of dehydration, weight loss (>15% warrants exclusion), or distress behaviors, including excessive grooming or reduced activity.

3. CD8+CD103+ T cell isolation and purification

1. Sacrifice donor mice previously exposed to desiccating stress using CO₂ asphyxiation, followed by cervical dislocation, according to approved euthanasia protocols.
2. Harvest spleens and superficial cervical lymph nodes under sterile conditions using sterile instruments in a biological safety cabinet, placing tissues in ice-cold RPMI-1640 medium supplemented with 10% fetal bovine serum.
3. Prepare single-cell suspensions by mechanically disrupting tissues through 70 µm cell strainers using sterile syringe plungers, washing cells twice with PBS containing 2% FBS and 1 mM ethylenediaminetetraacetic acid (EDTA).
4. Isolate CD8+ T cells using magnetic-activated cell sorting with anti-CD8 antibody-conjugated magnetic microbeads according to the manufacturer's instructions.
5. Assess cell viability using the trypan blue exclusion assay (0.4% solution), counting viable and non-viable cells using an automated cell counter, proceeding only with preparations exceeding 95% viability.
6. Enrich for CD103+ expression through sequential incubation with anti-CD103-APC antibody at 1:100 dilution for 30 min at 4 °C in the dark.
7. Perform secondary magnetic separation using anti-allophycocyanin (anti-APC) microbeads with LS Columns to obtain CD8+CD103+ double-positive cells following the manufacturer's protocols.
8. Validate cell purity using flow cytometry by staining aliquots with anti-CD8-FITC and anti-CD103-APC antibodies, ensuring a population of>90% CD8+CD103+ double-positive cells before proceeding.

4. Adoptive transfer protocol

1. Prepare CD8+CD103+ T cell suspensions at a concentration of 5 × 10⁶ cells/mL in sterile phosphate-buffered saline by centrifuging cells at 300 × g for 5 min and resuspending in an appropriate volume.
2. Inject 1 × 10⁶ cells in 200 µL of sterile PBS intraperitoneally on days -2, 0, and +2 relative to desiccating stress initiation, ensuring gentle mixing before each injection.
3. Administer equivalent volumes of sterile PBS to vehicle control groups using an identical injection schedule and technique to maintain experimental consistency.
4. Maintain cell preparations on ice and complete transfers within 2 h of isolation to preserve optimal viability and function.
5. Rotate injection sites between the left and right lower abdomen to minimize local inflammation and monitor animals for 24 h post-injection for adverse reactions.

5. Functional assessment procedure

1. Tear production measurement
   1. Perform measurements consistently at 8:00 PM to account for circadian variations in tear production.
   2. Gently restrain the mouse using appropriate restraint devices without anesthesia to avoid interference with natural tear production mechanisms.
   3. Place phenol red-impregnated cotton thread in the lower conjunctival fornix for exactly 15 s using fine-tipped forceps.
   4. Measure wetted thread length immediately using precision digital calipers (accuracy ± 0.01 mm) under standardized fluorescent lighting conditions.
2. Corneal barrier function assessment²⁶
   1. Anesthetize the mouse briefly with 2% isoflurane inhalation during tracer application to ensure precise instillation.
   2. Instill 0.5 µL of 50 mg/mL Oregon green-dextran solution onto the central corneal surface using a precision micropipette with positive displacement tips.
   3. Rinse corneas thoroughly with sterile saline five times after 1 min incubation to remove excess tracer, ensuring complete removal of surface fluorescence.
   4. Photograph corneas immediately using fluorescence microscopy with a Fluorescein isothiocyanate (FITC) filter set (excitation 490 nm, emission 525 nm) and standardized exposure parameters.
   5. Quantify fluorescence intensity using ImageJ software with consistent region-of-interest selection and background subtraction protocols.
      1. Convert images to 8-bit grayscale, define a standardized circular region of interest (ROI) covering the central 3 mm diameter of the cornea.
      2. Measure mean gray value, subtract background fluorescence measured from an adjacent non-corneal region, and express results as corrected total fluorescence (CTF) calculated as: CTF = Integrated Density - (Area of ROI × Mean background fluorescence)²².

6. Histological processing and analysis

1. Remove eyes and surrounding structures immediately post-euthanasia, then fix in 4% paraformaldehyde for 24 h or embed in optimal cutting temperature (OCT) compound for frozen sections, ensuring proper orientation for sagittal sectioning.
2. Prepare serial sagittal sections (6 µm for frozen, 5 µm for paraffin) using standardized anatomical landmarks (optic nerve as a reference point) for consistent sectioning planes across all specimens.
3. Perform periodic acid-Schiff (PAS) staining for goblet cell quantification using standardized protocols with appropriate positive and negative controls.
4. Execute immunofluorescence staining using primary antibodies: anti-MMP-3 (1:200), anti-MMP-9 (1:100), anti-activated caspase-3 (1:300), anti-activated caspase-8 (1:200), and anti-CD4 (1:100) with overnight incubation at 4 °C.
5. Quantify goblet cells per millimeter of conjunctival length using systematic sampling methods, counting cells in five non-overlapping high-power fields per section and averaging results.

7. Molecular analysis

1. Extract total RNA from pooled conjunctival and corneal tissues using validated extraction protocols²⁷.
2. cDNA synthesis and quantitative real-time PCR²⁸
   1. Prepare reverse transcription reaction mixtures containing 1 µg of total RNA, oligo-dT primers (50 µM), random hexamer primers (100 µM), reverse transcriptase enzyme, reaction buffer, and nuclease-free water in a final volume of 20 µL.
   2. Incubate reaction mixtures in a thermal cycler at 37 °C for 15 min to allow first-strand cDNA synthesis.
   3. Inactivate the reverse transcriptase enzyme by heating at 85 °C for 5 s, then cool to 4 °C and store cDNA at -20 °C until use.
   4. Dilute synthesized cDNA 1:10 with nuclease-free water for use as a template in subsequent PCR reactions.
   5. Prepare real-time PCR reaction mixtures (20 µL final volume) containing 1 µL of diluted cDNA template, forward and reverse primers (0.2 µM final concentration each), SYBR Green master mix, and nuclease-free water.
   6. Load samples in triplicate into 96-well optical reaction plates, including no-template controls for each primer pair.
   7. Program the thermal cycler with the following conditions: initial denaturation at 95 °C for 10 min, followed by 40 cycles of denaturation (95 °C for 15 s), annealing (60 °C for 30 s), and extension (72 °C for 30 s).
   8. Include a dissociation curve stage immediately after amplification: 95 °C for 15 s, 60 °C for 1 min, then gradual temperature increase to 95 °C at a rate of 0.3 °C/s to verify single product amplification.
   9. Analyze amplification curves and cycle threshold (Ct) values using instrument software, ensuring amplification efficiency between 90-110% for all primer pairs.
   10. Normalize target gene expression (IL-17A, IFN-γ, IL-13, MMP-3, and MMP-9) to the housekeeping gene GAPDH using the 2^-ΔΔCt method.
   11. Use primer sequences as specified in Table 1 for all target and reference genes.
3. Quantify cytokine protein levels in tissue extracts using commercially available ELISA kits with appropriate standard curves and quality controls.

Results

The successful implementation of this protocol yields comprehensive amelioration of desiccating stress-induced ocular surface pathology through CD8+CD103+ T cell-mediated immunomodulation. Positive results demonstrate significant restoration of tear production, typically achieving 60-80% recovery compared to non-stressed controls, while vehicle-treated animals exhibit persistent lacrimation deficits (Figure 1A).

Successful treatment maintains conjunctival goblet cell populations at levels approaching those observed in non-stressed controls, with goblet cell density normalized per millimeter of conjunctival length, as evidenced by PAS staining and quantitative cell enumeration (Figure 1B,C). Optimal outcomes exhibit comprehensive preservation of mucosal architecture with clearly visible goblet cells displaying characteristic morphology and intense PAS-positive staining. Corneal barrier integrity assessment reveals a dramatic reduction in Oregon green-dextran penetration following treatment, with fluorescence intensity approaching normal levels, contrasting with persistent barrier dysfunction in vehicle controls (Figure 2A,B).

Representative molecular analyses demonstrate coordinated suppression of destructive matrix metalloproteinases, with both MMP-3 and MMP-9 expression reduced to near-baseline levels as shown by immunofluorescence and quantitative RT-PCR analysis²⁹ (Figure 2C-H). Successful treatment produces a substantial reduction in apoptotic cell death across ocular surface tissues, as evidenced by decreased TUNEL positivity and reduced activation of both caspase-3 and caspase-8 pathways³⁰ (Figure 3A-I).

Flow cytometric analysis reveals effective suppression of CD4+ T cell expansion in cervical lymph nodes and reduced conjunctival infiltration in treated animals^5,7 (Figure 4A-D). Optimal outcomes exhibit a comprehensive cytokine profile modulation, characterized by a significant reduction in pathogenic IL-17A and IFN-γ production coupled with enhanced protective IL-13 levels in both local tissues and draining lymph nodes⁵ (Figure 5A-I).

Suboptimal results may occur with inadequate cell viability (<95%), improper timing of adoptive transfers, insufficient environmental control during desiccating stress induction, or compromised cell purity (<90% CD8+CD103+ population). These conditions typically manifest as partial restoration of tear production (Figure 1A), incomplete barrier protection with persistent Oregon green-dextran penetration (Figure 2A,B), or inconsistent cytokine modulation patterns (Figure 5A-I). Technical issues, such as contamination during cell isolation, inadequate magnetic separation purity, or prolonged cell handling times, can compromise therapeutic efficacy, resulting in minimal differences from vehicle control groups across all measured parameters.

Figure 1: CD8+CD103+ T cell adoptive transfer restores tear production and preserves conjunctival goblet cell populations in desiccating stress-induced dry eye. (A) Quantitative assessment of tear production using the phenol red thread test with individual data points overlaid. (B) Quantification of conjunctival goblet cell numbers normalized per millimeter of conjunctival length per microscopic field following PAS staining. (C) Representative photomicrographs of PAS-stained conjunctival sections showing goblet cells across experimental groups. Data represent mean ± SD (n = 5 mice per group). *P < 0.05, **P < 0.01, ***P < 0.001 compared to DS + VC group. Scale bars: 50 µm. Please click here to view a larger version of this figure.

Figure 2: CD8+CD103+ T cell therapy preserves corneal barrier integrity and suppresses matrix metalloproteinase expression during desiccating stress. Lower than expected OGD fluorescence intensity values may reflect specific microscopy parameters, lamp age, and instrument calibration settings used in this study. (A) Representative fluorescence microscopy images of Oregon green-dextran corneal permeability. (B) Quantitative analysis of mean fluorescence intensity. (C-H) (C, F) Representative immunofluorescence images of MMP-9 and MMP-3 expression in corneal epithelium. (D,G) Quantitative analysis of MMP-9 and MMP-3 immunofluorescence intensity. (E, H) Quantitative real-time PCR analysis of MMP-9 and MMP-3 mRNA expression levels. Data represent mean ± SD (n = 5 mice per group). *P < 0.05, **P < 0.01 compared to DS + VC group. Scale bars: 50 µm. Please click here to view a larger version of this figure.

Figure 3: CD8+CD103+ T cells reduce desiccating stress-induced apoptosis through modulation of caspase activation pathways. (A-C) TUNEL staining and quantitative analysis in corneal epithelium and conjunctiva. (D-F) Activated caspase-3 immunofluorescence and quantitative analysis. (G-I) Activated caspase-8 immunofluorescence and quantitative analysis. Data represent mean ± SD (n = 5 mice per group). *P < 0.05, **P < 0.01, ***P < 0.001 compared to DS + VC group. Scale bars: 50 µm. Please click here to view a larger version of this figure.

Figure 4: CD8+CD103+ T cell treatment suppresses CD4+ T cell responses in conjunctival tissues and draining lymph nodes. (A,B) Immunohistochemical analysis of CD4+ T cell infiltration in conjunctival tissues. (C,D) Flow cytometric analysis of CD4+ lymphocyte populations in cervical lymph nodes. Data represent mean ± SD (n = 5 mice per group). *P < 0.05, **P < 0.01, ***P < 0.001 compared to DS + VC group. Scale bars: 50 µm. Please click here to view a larger version of this figure.

Figure 5: CD8+CD103+ T cell therapy modulates cytokine production profiles, shifting from pro-inflammatory to tissue-protective responses. (A-C) Quantitative real-time PCR analysis of IL-17A, IFN-γ, and IL-13 mRNA expression in conjunctival tissues. (D-F) ELISA quantification of cytokine protein concentrations in conjunctival tissue extracts. (G-I) ELISA quantification of cytokine protein concentrations in cervical lymph node extracts. Data represent mean ± SD (n = 5 mice per group). *P < 0.05, **P < 0.01, ***P < 0.001 compared to DS + VC group. Please click here to view a larger version of this figure.

Gene	Sense primer	Anti-sense primer
MMP-3	CCTTTTGATGGGCCTGGAAC	GAGTGGCCAAGTTCATGAGC
MMP-9	CAATCCTTGCAATGTGGATG	AGTAAGGAAGGGGCCCTGTA
IL-13	GCAGCATGGTATGGAGTGT	TATCCTCTGGGTCCTGTAGATG
IL-17A	CGCAATGAAGACCCTGATAGAT	CTCTTGCTGGATGAGAACAGAA
IFN-y	AAATCCTGCAGAGCCAGATTAT	GCTGTTGCTGAAGAAGGTAGTA
β-actin	CCTAAGGCCAACCGTGAAAAG	AGGCATACAGGGACAGCACAG

Table 1. Mouse primer sequences used for qRT-PCR.

Discussion

This investigation establishes CD8+CD103+ regulatory T cells as potent therapeutic agents desiccating stress-induced dry eye disease through comprehensive modulation of CD4+ T cell-mediated pathogenic responses. The findings reveal that adoptive transfer of CD8+CD103+ T cells achieves multifaceted protection of ocular surface integrity, encompassing functional restoration of tear production, preservation of mucosal architecture, maintenance of epithelial barrier function, and suppression of inflammatory tissue damage.

This research demonstrates that CD8+CD103+ Tregs play a suppressive role in CD4+ T cell-induced pathogenesis, supporting the evolving understanding of regulatory hierarchies in adaptive immune responses to stress affecting the ocular surface³¹. The demonstration that CD8+CD103+ T cell therapy effectively reduced both local conjunctival CD4+ T cell infiltration and systemic CD4+ T cell expansion in draining lymph nodes suggests these regulatory cells operate through multiple complementary mechanisms. Earlier studies demonstrated that when CD8+CD103+ Tregs were co-transferred with CD4+ T cells from mice exposed to DS into nude recipients, these regulatory cells effectively migrated to conjunctival tissues but did not have a significant impact on the movement of CD4+ T cells to the ocular surface^19,32,33. This collective evidence supports our hypothesis that CD8+CD103+ Tregs primarily function by suppressing pathogenic CD4+ cell generation and activation during afferent immune responses in regional lymphoid organs, rather than merely inhibiting cell trafficking to target tissues.

The profound therapeutic effects extend to corneal barrier protection, representing a significant advance in understanding how immunoregulatory interventions preserve ocular surface integrity. The dramatic reduction in Oregon green-dextran penetration following CD8+CD103+ T cell therapy, accompanied by coordinated suppression of MMP-3 and MMP-9 expression, indicates these regulatory cells effectively interrupt the proteolytic cascade responsible for epithelial barrier destruction. Previous research established MMP-9 as a crucial mediator in desiccating stress-induced corneal barrier disruption, with MMP-9-deficient mice demonstrating resistance to barrier dysfunction under desiccating conditions. Studies also demonstrated that IL-17A neutralization reduces both MMP-9 and MMP-3 expression while improving corneal barrier function, with MMP-3 serving as the primary activator of latent MMP-9^18,34,35. The observation that CD8+CD103+ T cell therapy simultaneously suppressed IL-17A production and reduced both MMP-3 and MMP-9 expression suggests these regulatory cells effectively interrupt this destructive proteolytic cascade at multiple levels^36,37,38.

The remarkable preservation of conjunctival goblet cell populations observed in this study represents a critical therapeutic outcome, as these specialized cells maintain ocular surface homeostasis through MUC5AC secretion and other gel-forming mucins essential for tear film stability³⁹. The mechanisms underlying goblet cell loss in dry eye involve dysregulation of the Th2/Th1 cytokine balance, particularly the IL-13/IFN-γ ratio^39,40,41. IL-13 promotes goblet cell differentiation and mucin secretion, while IFN-γ induces goblet cell apoptosis and inhibits IL-13 signaling^42,43,44. The demonstration that CD8+CD103+ T cell therapy enhanced IL-13 production while reducing IFN-γ levels provides a mechanistic explanation for preserved goblet cell populations in treated animals.

The profound anti-apoptotic effects of CD8+CD103+ T cell therapy observed across ocular surface tissues provide important insights into cytoprotective mechanisms underlying improved tissue integrity. The pathogenic role of Th1 cells secreting IFN-γ in promoting ocular surface apoptosis is well-established, with previous studies demonstrating that DS-induced apoptosis occurs via caspase-8-mediated extrinsic pathways in IFN-γ-expressing tissues, that IFN-γ knockout mice show resistance to DS-induced apoptosis, and that exogenous IFN-γ administration augments DS-induced apoptosis^45,46,47. The findings that CD8+CD103+ T cell transfer suppressed both caspase-8-mediated apoptosis and IFN-γ production provide evidence that these regulatory cells protect against programmed cell death through modulation of inflammatory cytokine networks.

Successful implementation of this therapeutic approach requires careful attention to several critical parameters that must be tightly controlled to ensure experimental success. Cell viability must exceed 95% post-isolation, and CD8+CD103+ purity must surpass 90% before adoptive transfer. The timing of cell injection relative to desiccating stress initiation proves crucial, with optimal therapeutic efficacy achieved through transfers on days -2, 0, and +2. Environmental control during desiccating stress induction requires precise maintenance of humidity below 40%, airflow velocity at 15 m/s, and temperature at 22±1°C, while scopolamine administration must be performed at exact 4-h intervals to maintain consistent cholinergic blockade.

When therapeutic efficacy appears suboptimal, several factors warrant investigation. Poor cell viability below 95% can be addressed by minimizing isolation time and maintaining cells on ice, while inadequate cell purity can be resolved by extending magnetic separation incubation times or performing additional purification steps. Environmental inconsistencies during desiccating stress can be managed through continuous monitoring and backup systems, and injection technique problems can be minimized through proper training and consistent anatomical landmarks. If Oregon green-dextran values appear unusually low, investigators should verify fluorescence microscopy settings, ensure proper tracer concentration, and confirm adequate incubation time.

Despite these promising results, several important limitations must be acknowledged when interpreting these findings. The acute desiccating stress model may not fully recapitulate chronic human dry eye disease characteristics, and the exclusive use of female mice limits generalizability to male subjects, although this design reflects the female predominance of dry eye disease. The requirement for specialized magnetic separation equipment may limit accessibility, while scopolamine administration may have independent effects on immune function beyond cholinergic blockade. The protocol does not include direct cell tracking to confirm tissue homing, and lacrimal gland histopathological assessment was not performed. Additionally, the model constraints include the artificial nature of environmental desiccating conditions and the lack of assessment of long-term therapeutic durability.

When compared to existing therapeutic approaches, CD8+CD103+ T cell therapy offers distinct advantages over current dry eye disease treatments. Unlike artificial tears or lubricating agents that provide only symptomatic relief, this approach targets underlying immune pathogenesis. Compared to systemic anti-inflammatory drugs that broadly suppress immune function, CD8+CD103+ Tregs provide targeted modulation of pathogenic responses while preserving protective immunity. In contrast to CD4+CD25+ Treg therapy, CD8+CD103+ cells offer enhanced mucosal tissue specificity through CD103-mediated homing mechanisms and may demonstrate superior stability in inflammatory environments. Unlike mesenchymal stem cell therapies that require extensive ex vivo expansion, CD8+CD103+ Tregs can be isolated and transferred without prolonged culture periods, reducing contamination risks and maintaining physiological phenotypes.

The comprehensive therapeutic effects demonstrated in this study establish CD8+CD103+ T cells as promising candidates for cell-based immunotherapy in dry eye disease. The ability of these regulatory cells to simultaneously address multiple pathogenic mechanisms suggests they could provide more comprehensive therapeutic benefits than current single-target approaches. The clinical translation of these findings will require careful consideration of cell sourcing, expansion protocols, and delivery methods optimized for human application⁴⁸. Future investigations employing chronic dry eye models would provide valuable insights into long-term therapeutic efficacy, while detailed mechanistic studies examining specific molecular pathways would facilitate development of more targeted therapeutic approaches.

In conclusion, CD8+CD103+ T cells effectively regulate dry eye pathogenesis through coordinated suppression of pathogenic CD4+ T cell responses, preservation of corneal barrier function, maintenance of goblet cell populations, and prevention of ocular surface apoptosis. These effects are mediated through modulation of key inflammatory mediators and cytokines, particularly IFN-γ, IL-17A, and IL-13. Our findings establish CD8+CD103+ T cells as potential therapeutic targets for dry eye disease treatment, offering new perspectives for developing targeted immunological interventions and highlighting the broader potential of regulatory T cell-based therapies in treating inflammatory ocular surface diseases.

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Anti-CD103-APC antibody	Biolegend	Clone 2E7	Flow cytometry and cell sorting
Anti-CD8 magnetic microbeads	Miltenyi Biotec	-	Magnetic cell separation
Corneal Oregon green-dextran	Invitrogen	D7172	Molecular weight 70,000
ELISA kit IFN-γ	eBioscience	BMS606	Cytokine quantification
ELISA kit IL-13	eBioscience	BMS6015	Cytokine quantification
ELISA kit IL-17A	eBioscience	BMS6001	Cytokine quantification
ImageJ	National Institutes of Health	version 1.53k
Phenol red cotton threads	Zone-Quick, Yokota	-	Tear production measurement
Scopolamine hydrobromide	Melonepharma	MB5860	Muscarinic antagonist