Neuregulin1-ErbB4 Signaling Involved in Acupuncture Promoting Myelin Regeneration in Spinal Cord Injury Rats

Summary

This study aims to investigate the effects of electroacupuncture on myelin regeneration in a rat model of SCI and to verify whether the Neuregulin1 (NRG1)-ErbB4 signaling pathway plays a role in this process.

Abstract

Spinal cord injury (SCI) often results in severe neurological dysfunction, and myelin repair is a critical step in the recovery of neurological function. Electroacupuncture (EA), a therapeutic method that combines traditional acupuncture with electrical stimulation, has been widely applied in the field of nerve repair. However, the specific signaling pathways involved in EA have not been fully elucidated. This study aims to investigate the effects of EA on myelin regeneration in SCI rats and to verify whether the Neuregulin1 (NRG1)-ErbB4 signaling pathway plays a role in this process. SCI rats were induced by aneurysm clip injury at the T10 spinal segment. A polyethylene (PE) catheter was implanted into the vertebral canal between the L5-6 intervertebral spaces and fixed subcutaneously to establish a long-term drug delivery system. Exogenous NRG1 and its antagonist were administered through the PE catheter every other day, with a volume of 20 µL per injection. EA treatment was applied at the Dazhui (GV14) and Mingmen (GV4) acupuncture points every other day, each session lasting 30 min for 4 consecutive weeks. The results showed that EA treatment significantly promoted the expression of myelin basic protein (MBP) in spinal cord tissue and improved hind limb motor function in the rats. Furthermore, exogenous NRG1 produced similar effects to EA. In conclusion, the NRG1-ErbB4 signaling pathway plays an important role in EA-induced myelin regeneration in SCI rats.

Introduction

SCI is a traumatic condition that leads to severe neurological deficits, typically manifested by motor impairment, sensory loss, and autonomic dysfunction, with an annual incidence rate of approximately 40-80 cases per million people globally^1,2. Following injury, axonal rupture and myelin loss are the primary pathological features that impede neural signal conduction³. Myelin is formed by oligodendrocytes in the central nervous system (CNS) and Schwann cells in the peripheral nervous system (PNS), and its integrity is crucial for the rapid conduction of nerve impulses⁴. However, the inflammatory response, oxidative stress, and glial scar formation in the local microenvironment after SCI significantly inhibit myelin regeneration, leading to chronic neurological dysfunction⁵. At the same time, the death of oligodendrocytes (OLs) after SCI leads to demyelination of axons, a process that develops chronically and persistently. Studies have shown that axonal demyelination in both human and animal models can be effectively repaired through myelin regeneration⁶. Therefore, exploring strategies to promote myelin repair is one of the key directions in SCI treatment.

Acupuncture, as an ancient traditional medical technique, has been widely applied in clinical practice across multiple countries, including China, Korea, and Japan^7,8. EA, which combines traditional acupuncture with electrical stimulation, has been widely adopted in clinical settings. Increasing evidence shows that EA has therapeutic effects on various diseases, particularly in promoting myelin regeneration following spinal cord injury. The selection of acupuncture points is critical during EA treatment, such as GV14 and GV4⁹. GV14 is located below the spinous process of the 7^th cervical vertebra, near the midline of the spine, while GV4 is located between the spinous processes of the 2^nd and 3^rd lumbar vertebrae. Previous studies have shown that inflammatory signaling pathways, oxidative stress, neurotrophic factors, and autophagy play a role in EA-induced myelin repair^10,11,12. Furthermore, increasing evidence suggests that specific acupuncture points, such as GV14 and GV4, play an active role in promoting myelin regeneration during EA treatment^13,14,15. However, the molecular mechanisms through which EA regulates myelin regeneration after spinal cord injury have not been fully elucidated.

NRG1 is a member of the epidermal growth factor family, and based on its amino-terminal region, it can be classified into six types (I-VI)¹⁶. NRG1 and its receptor family, ErbB (ErbB1/2/3/4), play significant roles in the development and repair of the nervous system, including processes such as neuronal migration, differentiation, remyelination, and synaptogenesis. During the development of the PNS, Schwann cells (SCs) proliferate and migrate along the axons of neurons to form myelin, and the NRG1-ErbB4 signaling pathway plays a key role in the maturation of PNS Schwann progenitor cells^17,18. Previous studies have shown that the NRG1 signaling pathway is involved in the differentiation of neural stem cells into Schwann cells and promotes myelin repair of neural cells after SCI¹⁹. Additionally, one study has shown that following spinal cord injury, the NRG1-ErbB4 signaling pathway promotes the transformation of oligodendrocyte progenitor cells (OPCs) into Schwann-like cells with remyelination potential²⁰. Alex et al. constructed a co-culture system of human induced pluripotent stem cell-derived sensory neurons and rat Schwann cells and found that blocking the NRG1-ErbB signaling pathway with drugs significantly inhibited neuronal myelination, providing direct evidence of this pathway's role in promoting human sensory axon myelination²¹. Another study has also shown that EA treatment can upregulate the expression of NRG1 in the spinal cord and alleviate inflammatory pain²².

Research on the impact of EA on the NRG1-ErbB4 signaling pathway in SCI is limited, and the underlying mechanisms remain unclear. This study aims to investigate whether EA stimulation at the GV14 and GV4 acupuncture points can regulate NRG1-ErbB4 signal transduction and explore its potential role in promoting myelin regeneration and recovery of neurological function in SCI rats. This is the first study to examine the relationship between the NRG1-ErbB4 signaling pathway and EA-induced myelin regeneration in SCI rats, providing experimental evidence for the development of novel and effective treatment strategies for SCI.

Protocol

​All ethical guidelines were adhered to during the experiment to minimize animal suffering. The experimental protocol and design were approved by the Animal Experiment Committee of Kunming Medical University (Approval No. KMMU2021051) and conducted in accordance with the university's animal research guidelines. Adult male Sprague-Dawley rats (8 weeks old, weighing 250-270 g, n = 60) were obtained from Kunming Medical University (Yunnan, China).

Animal preparation

The animals were housed in a controlled environment with constant humidity, a moderate temperature, and a 12 h light/dark cycle. The animals were randomly assigned to 11 groups: Sham operation group (S, n = 6), SCI group (M, n = 6), SCI with EA treatment group (M + EA, n = 6), SCI with NRG-1β treatment group (M + NRG-1β, n = 6), SCI with 5% DMSO solvent group (M + D, n = 6 ), SCI with PD158780 inhibitor and NRG-1β treatment group (M + PD+NRG-1β, n = 6), SCI with PD158780 inhibitor and EA treatment group (M + EA + PD, n = 6), SCI with solvent and EA treatment group (M + EA + D, n = 6), SCI with shRNA and EA treatment group (M + EA + shRNA, n = 6), SCI with lentivirus containing non-targeting shRNA and EA treatment group (M + EA + NC, n = 6), SCI with shRNA treatment group (M + shRNA, n = 6). The current sample size was determined based on our prior experience with similar models and interventions, which have consistently shown significant effects with this number. Furthermore, despite the sample size, we observed statistically robust and significant differences in key outcomes, which strengthens confidence in the reported findings.

SCI rat model

A Yasargil aneurysm clip (titanium, standard closing force of 70 g) was used to establish a rat model of SCI using a clamp-type technique (Figure 1A). The rats were anesthetized with 2% sodium pentobarbital (30 mg/kg, intraperitoneally) and placed on an operating table. A 3-4 cm incision was made in the back skin, followed by layer-by-layer dissection of the subcutaneous tissue and muscle to expose the T9-11 thoracic spinous processes and vertebral arches. A vascular clip was used to remove the T10 thoracic spinous process and vertebral arch, fully exposing the spinal cord. The Yasargil aneurysm clip was positioned vertically over the entire T10 segment and released rapidly after a 60 s dwell time. The model was considered successful if two or more of the following signs were observed: (1) spasmodic tremor of the body, (2) tail-wagging reflex, and (3) visible black pinch marks on the spinal cord. After ensuring adequate hemostasis, the incision was disinfected and sutured. In the sham operation group, the same procedure was performed, except the spinal cord was not clamped. Postoperatively, the rats received normal saline (3 mL, intraperitoneally) for rehydration and penicillin (100,000 units, intraperitoneally) once in the morning and once in the evening for 3 consecutive days to prevent infection. Manual assistance with urination was provided until spontaneous urination was restored (2x daily).

Rat intrathecal tubing and drug delivery

Following the method of Storkson et al.²³, a catheter was implanted into the subarachnoid space in rats 1 week prior to SCI model induction. After anesthesia, the rats were fixed on the operating table, and the L5-6 intervertebral space was exposed. A 19G needle was used to vertically penetrate the dura mater and arachnoid membrane. The needle was advanced approximately 1-2 mm, and after breaking through the arachnoid membrane, a sensation of space was felt, followed by the clear flow of cerebrospinal fluid, indicating successful puncture. A PE-10 catheter (polyethylene, inner diameter 0.38 mm, outer diameter 1.09 mm) was inserted into the subarachnoid space along the puncture needle. The catheter was advanced to a length of approximately 3 cm, with the catheter tip positioned near the L3 vertebral body. During insertion, tail flicking and hindlimb twitching were observed in the rats, and cerebrospinal fluid flowed out through the catheter, confirming the catheter's position within the subarachnoid space.

Both NRG-1β and PD158780 were dissolved in dimethyl sulfoxide (DMSO) and subsequently diluted with artificial cerebrospinal fluid (ACSF), ensuring that the final DMSO concentration remained below 0.5%. The final working concentrations were 20 nM for NRG-1β and 20 µM for PD158780²⁴. On the second day post-SCI, rats in the M + NRG-1β group received intrathecal injections of 20 µL of NRG-1β every other day. Rats in the M + EA + PD group were administered 20 µL of PD158780 intrathecally²⁵, 2 h prior to EA treatment.

EA treatment

On the 3^rd day post-surgery, rats were fixed on the treatment table for electroacupuncture (EA) therapy at the acupuncture points GV14 and GV4 (Figure 1B). Two acupuncture needles (0.25 mm x 13 mm) were inserted into these points to a depth of 3-4 mm. EA therapy was administered using an electroacupuncture device with a sparse-dense wave pattern (sparse wave at 2 Hz and dense wave at 10 Hz, with a 1:5 frequency ratio)²⁶. The output intensity was set to 5 (approximately 0.5 mA) for 30 min, every other day.

Behavioral assessment

Locomotor function was evaluated using the Basso, Beattie, and Bresnahan (BBB) scale²⁷, which assesses limb movement, gait, coordination, and paw placement at the following time points: 0, 3, 7, 14, 21, and 28 days post-surgery ( Figure 2D) . The BBB scale ranges from 0 (representing complete paralysis) to 21 (indicating normal gait). All assessments were performed independently by two researchers who were blinded to the experimental group assignments.

Sample collection

Following the conclusion of the experiment, anesthetized rats were fixed on a dissection platform for tissue collection. The abdominal cavity was opened to fully expose the diaphragm, which was carefully incised with iris scissors to avoid vascular injury. The rib cage was then cut open along both costal margins to expose the heart, following which a needle was inserted into the left ventricle at the apex and approximately 300-400 mL of pre-chilled PBS was rapidly perfused to clear systemic blood until clear fluid flowed from the right atrium. For molecular protein analysis, perfusion was stopped at this stage, and the spinal column was dissected. After removing adjacent ribs and muscles to expose the vertebrae, the T10 segment was located, and a spinal cord segment approximately 1 cm rostral and caudal to T10 was collected using iris scissors, then snap-frozen in liquid nitrogen and stored at -80 °C. For morphological examination, perfusion was switched to 4% paraformaldehyde after PBS, with successful fixation indicated by muscle contraction and rigidity of the trunk. The same spinal segment was then carefully dissected to preserve tissue architecture and post-fixed in 4% paraformaldehyde at 4 °C for 48 h.

Hematoxylin and eosin staining

The spinal cord paraffin sections were placed in a 60 °C oven for preheating for 30 min. Dewaxing: Xylene I for 15 min followed by Xylene II for 15 min. Rehydration: Treated with 100% ethanol for 2 min, then 95% ethanol for 2 min, next with 80% ethanol for 2 min, followed by 70% ethanol for 2 min, and finally distilled water for 5 min. Hematoxylin staining was done for 7 min, followed by rinsing with distilled water to remove residual staining solution. Differentiation in 1% hydrochloric acid alcohol was carried out for 3 s, followed by rinsing with distilled water to remove residual staining solution. Bluing with 5% ammonia water for 2 min was done, followed by washing off the residual bluing solution. Eosin staining for 30 s was done, followed by rinsing with distilled water to remove residual staining solution. Dehydration of the sections was done with 70% ethanol for 10 s, then 80% ethanol for 10 s, and finally with 100% ethanol for 30 s. Clearing was done by treating with Xylene for 5 min. After mounting, the slides were air-dried, and images were captured after drying.

Luxol fast blue staining

The sections were dewaxed 2x with xylene for 10 min each, then stained with LFB myelin staining solution, and incubated overnight at 37 °C. The following day, excess staining solution was removed using 90% ethanol. The sections were differentiated in Luxol differentiation solution for 10 s (C0631S), followed by immersion in 75% ethanol for 30 s until the gray matter appeared clear. Finally, the sections were counterstained with eosin staining solution for 1 min.

Western blotting

Protein samples were boiled in water for 5 min. A total of 5 µL of protein marker was first loaded into the electrophoresis gel, followed by sequential loading of the test protein samples. Electrophoresis was initiated at 80 V until the marker bands were clearly separated, after which the voltage was increased to 130 V and maintained until electrophoresis was complete. Pre-cut PVDF membranes were activated in methanol for 1 min, then placed on filter paper, and overlaid with the prepared gel. Protein transfer was performed at a constant current of 300 mA, with transfer time adjusted according to molecular weight (± 10 min). After transfer, the PVDF membrane was placed in an incubation box, rinsed with TBST buffer for 5 min, and then blocked with 5% skimmed milk at room temperature on a shaker for 2 h. The membrane was subsequently washed 3x with TBST buffer for 5 min each before incubation with primary antibodies, including GAPDH (1:2000), Tubulin (1:2000), NRG1 (1:1000), ErbB4 (1:1000), and MBP (1:1000), overnight at 4 °C with gentle shaking. On the following day, the membrane was washed 3x with TBST buffer for 5 min each, then incubated with secondary antibody, goat anti-rabbit (1:4000), at room temperature on a shaker for 2 h. After washing with TBST, protein bands were visualized using chemiluminescence. Import the WB image into ImageJ software and perform background subtraction using a rolling ball radius of 50 pixels. For tilted bands, use the Segmented Line tool to straighten the bands. Use the Rectangle tool to select the target bands and generate a density profile by selecting Plot Lanes to visualize the grayscale values of the bands. Use the Magic Wand tool to segment the peaks and extract the grayscale values. After saving the data, use GraphPad Prism software to create bar graphs.

Immunofluorescence

Paraffin sections were dewaxed 2x with xylene for 10 min each and rehydrated through a graded ethanol series. Antigen retrieval was performed by boiling the sections in 5% citric acid solution for 15 min, followed by blocking with 10% goat serum for 2 h. The sections were then incubated overnight at 4 °C with the following primary antibodies: mouse monoclonal NRG-1 (1:200), rabbit monoclonal ErbB4 (1:300), and human monoclonal MBP (1:300). Following three washes with phosphate-buffered saline containing 0.1% Triton X-100 (PBST) for 10 min each, the sections were incubated for 1 h in the dark with the following secondary antibodies: FITC-labeled goat anti-mouse IgG (1:500), FITC-labeled goat anti-rabbit IgG (1:500), and FITC-labeled goat anti-human IgG (1:500). The sections were washed 3x with PBST for 10 min each, then fixed and mounted with antifade reagent to preserve fluorescent signals. The slides were stored at 4 °C in the dark. After locating the target cells under a 10x objective lens using a fluorescence microscope, switch to a 40x lens to capture the fluorescence image.

Real-time Polymerase Chain Reaction (RT-PCR)

Primers for ErbB4 and the reference gene GAPDH were designed using the NCBI website. The sequences of the primers were as follows: ErbB4 forward primer: ACAGCCCTCCTCCTGCCTAC; ErbB4 reverse primer: ATCTCAGCCGTTGCACCCT; GAPDH forward primer: CCCAGCTTAGGTTCATCATCAGGT; GAPDH reverse primer: TACGCCAAATCCGTTCACA. Approximately soybean-sized spinal cord tissue was placed into a 1.5 mL centrifuge tube, and 600 µL of total RNA extraction reagent was added. The tissue was thoroughly homogenized and incubated on ice for 5 min, followed by centrifugation at 12,000 x g for 5 min at 4 °C. The supernatant was transferred to a new 1.5 mL tube, and 400 µL of chloroform was added. The mixture was thoroughly mixed and centrifuged at 12,000 x g for 5 min at 4 °C. The supernatant was transferred again to a new tube, and 400 µL of isopropanol was added. The solution was incubated at room temperature for 10 min, followed by centrifugation at 12,000 x g for 10 min. The supernatant was discarded, and the RNA pellet was washed with 400 µL of 75% ethanol. After centrifugation at 7,500 x g for 5 min at 4 °C, the supernatant was discarded, and the tube was inverted to air-dry on a clean surface. The RNA pellet was dissolved in 60 µL of RNA-free water, mixed thoroughly, and the RNA concentration was measured. The purity and concentration of the RNA were recorded by measuring absorbance at 260 nm and 280 nm, ensuring the 260/280 ratio was around 2.0. For cDNA synthesis, Reaction 1 (containing gDNA Eraser, etc.) and Reaction 2 (containing reverse transcriptase, etc.) were thoroughly mixed, and the mixture was incubated at 95 °C for 15 min. The fluorescence PCR reaction system was prepared according to the cDNA synthesis kit instructions. A 2 µL sample was added to 23 µL of PCR reaction mix, and amplification was performed according to the fluorescence quantitative PCR kit protocol. The annealing temperature was set to 60 °C, and the amplification conditions were as follows: Pre-denaturation: 95 °C for 30 s, 1 cycle; PCR reaction: 95 °C for 3 s, 60 °C for 30 s, 40 cycles; The dissociation curve analysis was performed as follows: 95 °C for 5 s, 60 °C for 30 s, followed by a gradual increase from 60 °C to 95 °C with continuous fluorescence signal acquisition. Ct values were measured and calculated using the Bio-Rad computer software, and relative mRNA levels were determined using the 2^-ΔΔCt method.

Safety and handling guidelines

Paraformaldehyde fixation: Use paraformaldehyde exclusively in a well-ventilated fume hood. Always wear appropriate personal protective equipment (PPE), including a mask, gloves, a lab coat, and safety goggles. Store paraformaldehyde solution in a tightly sealed container, away from direct sunlight and heat sources. Dispose of waste paraformaldehyde in accordance with the laboratory safety guidelines of Kunming Medical University by placing it in a hazardous waste container.

DMSO solution: DMSO can be absorbed through the skin and enter the body. Wear appropriate PPE, including gloves and safety goggles, during handling. Store DMSO in a sealed container at room temperature, away from strong oxidizing agents. Dispose of waste DMSO in accordance with the laboratory safety guidelines of Kunming Medical University by placing it in a hazardous waste container.

Pentobarbital anesthesia: Pentobarbital is a controlled substance and should only be handled by authorized personnel. Avoid accidental exposure during handling and ensure proper ventilation while using. Wear appropriate protective equipment. Store pentobarbital in a locked cabinet at room temperature, under the supervision of authorized personnel. Dispose of pentobarbital waste in compliance with Kunming Medical University's guidelines for controlled substances, ensuring proper usage authorization and waste disposal procedures.

General waste disposal: All hazardous chemicals and reagents must be disposed of according to the laboratory management guidelines of Kunming Medical University. Ensure that all waste materials are properly labeled and placed in suitable containers for safe disposal.

Statistical analysis

All experiments were conducted in triplicate or more. The band density values of the target proteins were normalized to those of the control group to facilitate comparisons between groups. Data are presented as median (interquartile range) or mean ± standard deviation, with n representing the number of rats. For normally distributed data, significant differences between groups were assessed using one-way analysis of variance (ANOVA). For non-normally distributed data, the Kruskal-Wallis H test was applied to compare groups. Statistical significance was set at p < 0.05.

Results

H&E staining and BBB scoring demonstrate the protective effects of EA on SCI rats

H&E staining was used to examine the morphology and structure of the posterior horn cells of the spinal cord (Figure 2D). The H&E results revealed that in group S, the posterior horn cells were neatly arranged, with well-defined cell outlines and centrally located nuclei. In contrast, the number of posterior horn cells was reduced in group M, with disorga...

Discussion

This study demonstrates that EA treatment alleviates spinal cord cavitation and demyelination after SCI, promoting remyelination through upregulation of MBP protein expression, and consequently improves hindlimb motor function in rats. Furthermore, we identified the NRG-1/ErbB4 signaling pathway as a critical mediator of neuronal remyelination and a potential therapeutic mechanism through which EA promotes remyelination and recovery of hindlimb motor function in SCI rats.

Nerve conduction in S...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
BCA Protein Detection Kit	Beyotime Biotechnology	P0012S	Quantitative protein analysis
Electroacupuncture device	Huatuo Electroacupuncture Instrument, SDZ-V, Suzhou	—	Therapeutic equipment
FITC-labeled goat anti-human IgG	Beyotime	A0556	Fluorescent secondary antibody
FITC-labeled goat anti-mouse IgG	Beyotime	A0568	Fluorescent secondary antibody
FITC-labeled goat anti-rabbit IgG	Beyotime	A0562	Fluorescent secondary antibody
Fluorescence microscope	Olympus	—	—
Human monoclonal MBP	Abcam	ab209328	specific antibody
LFB myelin staining solution	Solarbio	G3240	myelin sheath staining
Millipore ECL	Millipore	WBKLS0100	Detection reagents
Mouse monoclonal NRG-1	Santa Cruz	SC-57384	specific antibody
Nanodrop ND-1000	LabTech	—
NRG1-1 beta	Novoprotein Technology Co	C753	Recombinant human NRG1-1 beta
PD158780	GlpBio Technology	GC15925	The epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor
PE-10 conduit	Becton, Dickinson and Company	427401	intrathecal injection
Penicillin sodium for injection	Harbin Zhongjing Biotechnology Co	80451182	Postoperative anti-infection therapy
Rabbit monoclonal ErbB4	Abcam	ab109273	specific antibody
RNAiso Plus Kit	Takara	9109	RT-PCR reagents
RT Reagent Kit	Takara	RR037A	RT-PCR reagents
Secondary antibody	Beyotime Biotechnology	—	specific antibody
Sodium pentobarbital	Sigma-Aldrich	69020100	Animal anesthesia
Yasargil aneurysm clip	Rebstock Instruments GmbH	—	Construction of a rat spinal cord injury model