A Novel Serum-Free 2D and 3D Culture System Comprising Two Small Molecules for Culturing Mouse Lacrimal Gland Epithelial Cells

Summary

A novel serum-free culture system using the small molecule combination 2C (Y27632 and SB431542) is introduced to efficiently expand lacrimal gland epithelial cells (LGECs) in both 2D and 3D cultures, enabling precise control of their proliferation and differentiation.

Abstract

Lacrimal gland (LG) dysfunction is a major cause of aqueous-deficient dry eye disease, and cell-based and tissue engineering therapies show significant potential for this condition. However, the limited availability of sufficient seed cells cultured under serum-free conditions has hindered their widespread application. In this study, we developed a novel serum-free culture system using two small molecules, Y27632 and SB431542 (2C), to efficiently expand LG epithelial cells (LGECs). For the 2D primary culture of LGECs, LGs were isolated from 6-8 weeks old mice and enzymatically digested using Dispase II and Collagenase A. The resulting cell suspension was seeded into culture dishes at a density of 7,500 cells/cm² and cultured with 2C for 12-14 days. When the cell confluence reached 80-90%, subculture was initiated at a 1:2 ratio. For 3D culture, 10,000 P1 LGECs were resuspended in 10 µL of 2C and 10 µL of matrix gel, then seeded in the center of a 24-well plate. After a 30 min solidification period at 37 °C, 600 µL of 2C was added for continued culture. For differentiation, the 3D spheroids were cultured with 2C for 7 days, followed by removal of 2C and continued culture for an additional 7 days. LGECs cultured with 2C exhibited high proliferation, with elevated expression of stemness and proliferation markers (Ki67, K14, P63, K5, K15 [P = 0.0011, 0.0002, 0.0012, 0.0003, 0.0014, respectively]), and maintained morphology and proliferative capacity even after ten passages. Furthermore, under 3D conditions, LGECs formed spheroids with stem/progenitor characteristics, which further differentiated into microglandular structures containing multiple LG cell types (AQP5, K19, α-SMA-positive) and mature secretory functions after the removal of 2C. This approach is expected to provide a stable source of seed cells for tissue engineering and offers a new in vitro model to study LG physiology.

Introduction

The lacrimal gland (LG) is essential for producing the aqueous layer of the tear film, which is crucial for maintaining ocular surface homeostasis¹. Dysfunction of the LG, caused by injury or inflammation, results in aqueous-deficient dry eye disease (ADDE). This condition can lead to severe ocular surface inflammation, chronic corneal disease, and, in severe cases, permanent vision loss². Current treatments for ADDE primarily manage symptoms, without addressing the underlying glandular dysfunction, which limits their long-term efficacy¹. The development of targeted therapies for LG dysfunction pr....

Protocol

All experiments were performed in compliance with the regulations of the Association for Research in Vision and Ophthalmology (ARVO) and the Experimental Animal Ethics Committee of Jilin University and Xiamen University.

NOTE: All cell culture procedures were performed in a UV-sterilized biosafety cabinet in the cell operation room.

1. Primary culture of LGECs

1. Isolation of LG tissue
   1. Euthanize anesthetized C57BL/6J mice (6-8 weeks old) by cervical dislocation and disinfect the ear region (around the LG) with 75% ethanol to avoid contamination.
   2. Make an incision fr....

Results

Establish a serum-free LGECs culture system using 2C
In this protocol, the aim was to establish a simpler, more efficient culture system for expanding primary mouse LGECs. After extensive screening, a serum-free 2C combination, composed solely of Y27632 and SB431542, was successfully developed, enabling long-term in vitro expansion of LGECs. After mixed enzyme digestion, primary LGECs began to adhere and form multiple cell clones after 3 days of culture with 2C (data not shown). The first 3 .......

Discussion

As described in the Introduction, several serum-free culture systems for LG cells have been developed in recent years^10,11,12,13. However, many of these methods have limitations, including poor cell proliferation and the inability to achieve large-scale expansion in vitro^10,11. Furthermore, recent serum-free culture systems for.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
-20°C Ultra-low temperature refrigerator	Haier
-80°C Ultra-low temperature refrigerator	Haier
0.25% Trypsin-EDTA	Gibco	25200056
1.5 mL micro centrifuge tube	Kirgen	KG2211	Rnase-free
35mm cell culture dish	LABSELECT	12111
4 °C Refrigerator	Haier
4% paraformaldehyde (PFA)	Servicebio	G1101
4',6-diamidino-2-phenylindole (DAPI)	Yeasen	708939ES03	Store at -20 °C, stock at 1 mg/mL, 500x, dilute to 1x with 1x PBS
5 mL centrifuge tube	ACMEC	AC17457
50mL centrifuge tube	LABSELECT	CT-002-50-SS
Anti-alpha smooth muscle actin rabbit antibody	Abcam	ab5694	Dilute with the antibody dilution buffer at 1:100
Anti-AQP5 rabbit antibody	ABclonal	A9927	Dilute with the antibody dilution buffer at 1:100
Anti-Cytokeratin 14 rabbit antibody	Abcam	ab181595	Dilute with the antibody dilution buffer at 1:200
Anti-Cytokeratin 19 rabbit antibody	Abcam	ab52625	Dilute with the antibody dilution buffer at 1:400
Anti-Ki67 rabbit antibody	Abcam	ab16667	Dilute with the antibody dilution buffer at 1:200
Biosafety cabinet	SterilGARD
Bovine serum albumine (BSA)	Yeasen	36101ES60	Store at 4°C
C57BL/6J mice	Laboratory Animal Center of Xiamen University
Cell culture plate	LABSELECT	11312	24-well
Cell incubator	Eppendorf
Centrifuge	Eppendorf
Chloroform	HUSHI	10006818	CAUTION, Performing operations in a fume hood
CO2 constant temperature incubator	Eppendorf
Collagenase A	Roche	10103586001	Store at -20 °C, stock at 200 mg/mL, 100x
Defined trypsin inhibitor solution(DTI)	Gibco	R007100
DermaLife K Keratinocyte Medium Complete Kit (Serum-free medium)	Life Line	LL-0007	Store at 4 °C
D-Hanks	Biosharp	BL559A	Used for diluting Dispase II
Dimethylsulfoxide(DMSO)	Sigma	D4540	Used for diluting Y27632 and SB431542
Dispase II	Sigma	D4693	Store at -20 °C, stock at 200 mg/mL, 100x
DMEM basic (1X)	Gibco	C11995500BT
Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488	Invitrogen	A-21206	Dilute with the antibody dilution buffer at 1:300
Dulbecco's Phosphate-bufferd Saline (DPBS)	Servicebio	G4200
Ethanol absolute	HUSHI	10009218	CAUTION, Use to prepare other Ethanol dilutions
Freezing microtome	Leica
High-speed low-temperature grinder	Servicebio
Inverted fluorescence microscope	Leica
Inverted microscope	Olympus
Isopropanol	HUSHI	80109270
Laser Scanning Confocal Microscope FV3000	OLYMPUS
Low temperature high speed centrifuge	Eppendorf
LTF enzyme-linked immunosorbent assay (ELISA) kit	Elabscience	E-MSEL-M0047	Store at -20 °C
Matrix gel (Matrigel)	82703	Mogengel	Aliquot and store at -20 °C
Micropipettor	Eppendorf
Microplate reader	Thermo Fisher Scientific
Nuclease-free water	Biosharp	BL510B
OCT compound	Scigen	4586
PBS,1× (pH7.4)	Servicebio	G4202
PCR amplifier	BIO-RAD
Penicillin-Streptomycin	Biosharp	BL505A
Penicillin-Streptomycin-Amphotericin	Biosharp	BL142A
PerfectStart Green qPCR SuperMix kit	TransGen Biotech	AQ601-01-V2	Store at -20 °C
PerfectStart Uni RT&qPCR Kit	TransGen Biotech	AUQ-01	Store at -20 °C
Pilocarpine	Aladdin	P424663	Store at -20 °C, 2500x
Primer AQP5  sequence: Forward:CATGAACCCAGCCCGATC TT Reverse:CTTCTGCTCCCATCCCAT CC	Sangon Biotech
Primer K14  sequence: Forward:CCCACCTTTCATCTTCC CAATT Reverse: AAGCCTGAGCAGCATGTAGCAG	Sangon Biotech
Primer K15  sequence: Forward:GAGGTGGCGTCTAACACA GA Reverse:TCTGAGCCTCCATCTCAC AG	Sangon Biotech
Primer K19  sequence: Forward:ATTACTGCCCTGAGGAGC CA Reverse:TTCAGCTCCTCAATCCGA GC	Sangon Biotech
Primer K5  sequence: Forward:CTCAGAGCTGAGGAACAT GC Reverse:AGCTCCGCATCAAAGAAC AT	Sangon Biotech
Primer Ki67  sequence: Forward:ACCATCATTGACCGCTCC TT Reverse:TTGACCTTCCCCATCAGG GT	Sangon Biotech
Primer LTF  sequence: Forward:CAGGAGCCAACAAATGTG CC Reverse:TTGTACTGGTCCCTTTCG GC	Sangon Biotech
Primer P63  sequence: Forward:ATGTCACCGAGGTTGTG AAA Reverse: GAATTCAGTGCCAACCTGTG	Sangon Biotech
Primer SOX10  sequence: Forward:ATCAGCCACGAGGTAATG TCCAAC Reverse:ACTGCCCAGCCCGTAGCC	Sangon Biotech
Primer α-SMA  sequence: Forward:CTCCCTGGAGAAGAGCTA CG Reverse:CGCTGACTCCATCCCAAT GA	Sangon Biotech
Real-Time fluorescence quantitative PCR instrument	Roche
RNA isolater Total RNA Extraction Reagent	Vazyme	R401-01	CAUTION, Performing operations in a fume hood
SB431542	Apexbio	A8249	Store at -20 °C, stock at 20 mM, 2000x
Spectrophotometer NanoDrop 1000	Thermo Fisher Scientific		Measure RNA concentration
Sucrose	Macklin	S818046	Dissolve with distilled water
Triton X-100	Solarbio	T8200
Ultra pure water purification system	Millipore
Universal antibody dilution buffer	Epizyme	PS119	Store at 4 °C
Y27632	Apexbio	B1293	Store at -20 °C, stock at 20 mM, 2000x