Method Article

A Novel Serum-Free 2D and 3D Culture System Comprising Two Small Molecules for Culturing Mouse Lacrimal Gland Epithelial Cells

255 views

DOI:

10.3791/70438

February 10th, 2026

In This Article

Summary

A novel serum-free culture system using the small molecule combination 2C (Y27632 and SB431542) is introduced to efficiently expand lacrimal gland epithelial cells (LGECs) in both 2D and 3D cultures, enabling precise control of their proliferation and differentiation.

Abstract

Lacrimal gland (LG) dysfunction is a major cause of aqueous-deficient dry eye disease, and cell-based and tissue engineering therapies show significant potential for this condition. However, the limited availability of sufficient seed cells cultured under serum-free conditions has hindered their widespread application. In this study, we developed a novel serum-free culture system using two small molecules, Y27632 and SB431542 (2C), to efficiently expand LG epithelial cells (LGECs). For the 2D primary culture of LGECs, LGs were isolated from 6-8 weeks old mice and enzymatically digested using Dispase II and Collagenase A. The resulting cell suspension was seeded into culture dishes at a density of 7,500 cells/cm2 and cultured with 2C for 12-14 days. When the cell confluence reached 80-90%, subculture was initiated at a 1:2 ratio. For 3D culture, 10,000 P1 LGECs were resuspended in 10 µL of 2C and 10 µL of matrix gel, then seeded in the center of a 24-well plate. After a 30 min solidification period at 37 °C, 600 µL of 2C was added for continued culture. For differentiation, the 3D spheroids were cultured with 2C for 7 days, followed by removal of 2C and continued culture for an additional 7 days. LGECs cultured with 2C exhibited high proliferation, with elevated expression of stemness and proliferation markers (Ki67, K14, P63, K5, K15 [P = 0.0011, 0.0002, 0.0012, 0.0003, 0.0014, respectively]), and maintained morphology and proliferative capacity even after ten passages. Furthermore, under 3D conditions, LGECs formed spheroids with stem/progenitor characteristics, which further differentiated into microglandular structures containing multiple LG cell types (AQP5, K19, α-SMA-positive) and mature secretory functions after the removal of 2C. This approach is expected to provide a stable source of seed cells for tissue engineering and offers a new in vitro model to study LG physiology.

Introduction

The lacrimal gland (LG) is essential for producing the aqueous layer of the tear film, which is crucial for maintaining ocular surface homeostasis1. Dysfunction of the LG, caused by injury or inflammation, results in aqueous-deficient dry eye disease (ADDE). This condition can lead to severe ocular surface inflammation, chronic corneal disease, and, in severe cases, permanent vision loss2. Current treatments for ADDE primarily manage symptoms, without addressing the underlying glandular dysfunction, which limits their long-term efficacy1. The development of targeted therapies for LG dysfunction pr....

Access restricted. Please log in or start a trial to view this content.

Protocol

All experiments were performed in compliance with the regulations of the Association for Research in Vision and Ophthalmology (ARVO) and the Experimental Animal Ethics Committee of Jilin University and Xiamen University.

NOTE: All cell culture procedures were performed in a UV-sterilized biosafety cabinet in the cell operation room.

1. Primary culture of LGECs

  1. Isolation of LG tissue
    1. Euthanize anesthetized C57BL/6J mice (6-8 weeks old) by cervical dislocation and disinfect the ear region (around the LG) with 75% ethanol to avoid contamination.
    2. Make an incision fr....

Access restricted. Please log in or start a trial to view this content.

Results

Establish a serum-free LGECs culture system using 2C
In this protocol, the aim was to establish a simpler, more efficient culture system for expanding primary mouse LGECs. After extensive screening, a serum-free 2C combination, composed solely of Y27632 and SB431542, was successfully developed, enabling long-term in vitro expansion of LGECs. After mixed enzyme digestion, primary LGECs began to adhere and form multiple cell clones after 3 days of culture with 2C (data not shown). The first 3 .......

Access restricted. Please log in or start a trial to view this content.

Discussion

As described in the Introduction, several serum-free culture systems for LG cells have been developed in recent years10,11,12,13. However, many of these methods have limitations, including poor cell proliferation and the inability to achieve large-scale expansion in vitro10,11. Furthermore, recent serum-free culture systems for.......

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors declare no competing interests.

Acknowledgements

This work was supported by the National Natural Science Foundation of China (82471048, 82271045); the Shenzhen Science and Technology Program (JCYJ20240813145510014); the Health Research Talents Special Project of Jilin Province (2023SCZ63, 2024SCZ53, 2025SCZ65); and the Jilin Province Science and Technology Development Plan Project (YDZJ202601ZYTS389).

....

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
 -20°C Ultra-low temperature refrigeratorHaier
 -80°C Ultra-low temperature refrigeratorHaier
0.25% Trypsin-EDTAGibco25200056
1.5 mL micro centrifuge tube KirgenKG2211Rnase-free
35mm cell culture dishLABSELECT12111
4 °C RefrigeratorHaier
4% paraformaldehyde (PFA)ServicebioG1101
4',6-diamidino-2-phenylindole (DAPI)Yeasen708939ES03Store at -20 °C, stock at 1 mg/mL, 500x, dilute to 1x with 1x PBS
5 mL centrifuge tube ACMECAC17457
50mL centrifuge tube LABSELECTCT-002-50-SS
Anti-alpha smooth muscle actin rabbit antibodyAbcamab5694Dilute with the antibody dilution buffer at 1:100 
Anti-AQP5 rabbit antibody ABclonalA9927Dilute with the antibody dilution buffer at 1:100 
Anti-Cytokeratin 14 rabbit antibodyAbcamab181595Dilute with the antibody dilution buffer at 1:200 
Anti-Cytokeratin 19 rabbit antibodyAbcamab52625Dilute with the antibody dilution buffer at 1:400 
Anti-Ki67 rabbit antibodyAbcamab16667Dilute with the antibody dilution buffer at 1:200 
Biosafety cabinetSterilGARD
Bovine serum albumine (BSA) Yeasen36101ES60Store at 4°C
C57BL/6J miceLaboratory Animal Center of Xiamen University
Cell culture plateLABSELECT1131224-well
Cell incubatorEppendorf
CentrifugeEppendorf
ChloroformHUSHI10006818CAUTION, Performing operations in a fume hood
CO2 constant temperature incubatorEppendorf
Collagenase ARoche10103586001Store at -20 °C, stock at 200 mg/mL, 100x
Defined trypsin inhibitor solution(DTI)GibcoR007100
DermaLife K Keratinocyte Medium Complete Kit (Serum-free medium) Life LineLL-0007Store at 4 °C
D-HanksBiosharpBL559A Used for diluting Dispase II
Dimethylsulfoxide(DMSO)SigmaD4540Used for diluting Y27632 and SB431542
Dispase IISigmaD4693Store at -20 °C, stock at 200 mg/mL, 100x
DMEM basic (1X)GibcoC11995500BT
Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488InvitrogenA-21206Dilute with the antibody dilution buffer at 1:300
Dulbecco's Phosphate-bufferd Saline (DPBS)ServicebioG4200
Ethanol absoluteHUSHI10009218CAUTION, Use to prepare other Ethanol dilutions 
Freezing microtomeLeica
High-speed low-temperature grinderServicebio
Inverted fluorescence microscopeLeica
Inverted microscopeOlympus
Isopropanol HUSHI80109270
Laser Scanning Confocal Microscope FV3000OLYMPUS
Low temperature high speed centrifugeEppendorf
LTF enzyme-linked immunosorbent assay (ELISA) kit ElabscienceE-MSEL-M0047Store at -20 °C
Matrix gel (Matrigel)82703MogengelAliquot and store at -20 °C
MicropipettorEppendorf
Microplate readerThermo Fisher Scientific
Nuclease-free waterBiosharpBL510B
OCT compoundScigen4586
PBS,1× (pH7.4)ServicebioG4202
PCR amplifierBIO-RAD
Penicillin-StreptomycinBiosharpBL505A
Penicillin-Streptomycin-AmphotericinBiosharpBL142A
PerfectStart Green qPCR SuperMix kitTransGen BiotechAQ601-01-V2Store at -20 °C
PerfectStart Uni RT&qPCR KitTransGen BiotechAUQ-01Store at -20 °C
Pilocarpine AladdinP424663Store at -20 °C, 2500x
Primer AQP5  sequence:
Forward:CATGAACCCAGCCCGATC
TT
Reverse:CTTCTGCTCCCATCCCAT
CC
Sangon Biotech
Primer K14  sequence:
Forward:CCCACCTTTCATCTTCC
CAATT
Reverse: AAGCCTGAGCAGCATGTAGCAG
Sangon Biotech
Primer K15  sequence:
Forward:GAGGTGGCGTCTAACACA
GA
Reverse:TCTGAGCCTCCATCTCAC
AG
Sangon Biotech
Primer K19  sequence:
Forward:ATTACTGCCCTGAGGAGC
CA
Reverse:TTCAGCTCCTCAATCCGA
GC
Sangon Biotech
Primer K5  sequence:
Forward:CTCAGAGCTGAGGAACAT
GC
Reverse:AGCTCCGCATCAAAGAAC
AT
Sangon Biotech
Primer Ki67  sequence:
Forward:ACCATCATTGACCGCTCC
TT
Reverse:TTGACCTTCCCCATCAGG
GT
Sangon Biotech
Primer LTF  sequence:
Forward:CAGGAGCCAACAAATGTG
CC
Reverse:TTGTACTGGTCCCTTTCG
GC
Sangon Biotech
Primer P63  sequence:
Forward:ATGTCACCGAGGTTGTG
AAA
Reverse: GAATTCAGTGCCAACCTGTG
Sangon Biotech
Primer SOX10  sequence:
Forward:ATCAGCCACGAGGTAATG
TCCAAC
Reverse:ACTGCCCAGCCCGTAGCC
Sangon Biotech
Primer α-SMA  sequence:
Forward:CTCCCTGGAGAAGAGCTA
CG
Reverse:CGCTGACTCCATCCCAAT
GA
Sangon Biotech
Real-Time fluorescence quantitative PCR instrumentRoche
RNA isolater Total RNA Extraction ReagentVazymeR401-01CAUTION, Performing operations in a fume hood
SB431542 ApexbioA8249Store at -20 °C, stock at 20 mM, 2000x
Spectrophotometer NanoDrop 1000Thermo Fisher ScientificMeasure RNA concentration
SucroseMacklinS818046Dissolve with distilled water
Triton X-100SolarbioT8200
Ultra pure water purification systemMillipore
Universal antibody dilution bufferEpizymePS119Store at 4 °C
Y27632 ApexbioB1293Store at -20 °C, stock at 20 mM, 2000x

References

  1. Veernala, I., et al. Lacrimal gland regeneration: the unmet challenges and promise for dry eye therapy. Ocul Surf. 25, 129-141 (2022).
  2. Chen, X., Li, S., Zhang, Y., Ye, L. Pro....

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Lacrimal Gland CellsSerum Free Culture2D Cell Culture3D Cell CultureSmall Molecule CultureEpithelial Cell ExpansionSpheroid FormationStemness MarkersTissue Engineering
Video Coming Soon

Related Articles