Method Article

A Novel Serum-Free 2D and 3D Culture System Comprising Two Small Molecules for Culturing Mouse Lacrimal Gland Epithelial Cells

257 views

DOI:

10.3791/70438

February 10th, 2026

In This Article

Summary

A novel serum-free culture system using the small molecule combination 2C (Y27632 and SB431542) is introduced to efficiently expand lacrimal gland epithelial cells (LGECs) in both 2D and 3D cultures, enabling precise control of their proliferation and differentiation.

Abstract

Lacrimal gland (LG) dysfunction is a major cause of aqueous-deficient dry eye disease, and cell-based and tissue engineering therapies show significant potential for this condition. However, the limited availability of sufficient seed cells cultured under serum-free conditions has hindered their widespread application. In this study, we developed a novel serum-free culture system using two small molecules, Y27632 and SB431542 (2C), to efficiently expand LG epithelial cells (LGECs). For the 2D primary culture of LGECs, LGs were isolated from 6-8 weeks old mice and enzymatically digested using Dispase II and Collagenase A. The resulting cell suspension was seeded into culture dishes at a density of 7,500 cells/cm2 and cultured with 2C for 12-14 days. When the cell confluence reached 80-90%, subculture was initiated at a 1:2 ratio. For 3D culture, 10,000 P1 LGECs were resuspended in 10 µL of 2C and 10 µL of matrix gel, then seeded in the center of a 24-well plate. After a 30 min solidification period at 37 °C, 600 µL of 2C was added for continued culture. For differentiation, the 3D spheroids were cultured with 2C for 7 days, followed by removal of 2C and continued culture for an additional 7 days. LGECs cultured with 2C exhibited high proliferation, with elevated expression of stemness and proliferation markers (Ki67, K14, P63, K5, K15 [P = 0.0011, 0.0002, 0.0012, 0.0003, 0.0014, respectively]), and maintained morphology and proliferative capacity even after ten passages. Furthermore, under 3D conditions, LGECs formed spheroids with stem/progenitor characteristics, which further differentiated into microglandular structures containing multiple LG cell types (AQP5, K19, α-SMA-positive) and mature secretory functions after the removal of 2C. This approach is expected to provide a stable source of seed cells for tissue engineering and offers a new in vitro model to study LG physiology.

Introduction

The lacrimal gland (LG) is essential for producing the aqueous layer of the tear film, which is crucial for maintaining ocular surface homeostasis1. Dysfunction of the LG, caused by injury or inflammation, results in aqueous-deficient dry eye disease (ADDE). This condition can lead to severe ocular surface inflammation, chronic corneal disease, and, in severe cases, permanent vision loss2. Current treatments for ADDE primarily manage symptoms, without addressing the underlying glandular dysfunction, which limits their long-term efficacy1. The development of targeted therapies for LG dysfunction presents several challenges, including the lack of long-term, simple in vitro models, which limit the understanding of LG pathophysiology and hinder the development of effective therapies. While cell transplantation has shown potential in promoting LG regeneration, the limited expansion capacity of cells in vitro and the complexity of existing culture systems present significant obstacles to clinical application1,3. Therefore, establishing a simple, long-term culture system for adult mouse LGs is essential for advancing understanding of LG physiology and pathology, as well as providing a reliable source of LG stem/progenitor cells for LG injury repair and regeneration.

Existing in vitro culture systems for LG have made significant progress, but still face notable limitations. Many of these methods rely on serum-supplemented media, which introduces several issues such as batch-to-batch variability, undefined components, and the risk of fibroblast or mesenchymal cell contamination4,5,6,7,8. Moreover, serum-based systems are unsuitable for studying the pathogenic mechanisms of LG diseases and pose challenges for cell transplantation therapies due to potential immune rejection risks9. In response to these limitations, several serum-free methods have been developed for culturing LG epithelial cells (LGECs) from both mice and humans. For example, Ueda et al. successfully employed a serum-free method to culture LGECs from newborn mice10. However, this method was limited by the inability to pass the cells through subcultures and the need for a large number of neonatal glands to obtain sufficient LGECs. Similarly, Kobayashi et al. developed a serum-free culture system with cholera toxin, but faced difficulties in maintaining cellular morphology during passage11. Recent advancements include Zhang et al.'s development of a 3D culture system for mouse LG stem cells and Bannier-Hélaouët et al.'s LG organoid culture system for both mice and humans12,13,14,15. However, these systems rely on complex media formulations with multiple small molecules, growth factors, and additives, complicating the culture process and limiting scalability. These challenges highlight the need for a simplified, effective serum-free culture system that can facilitate the efficient expansion of LGECs, while maintaining their proliferative and stem/progenitor characteristics for further therapeutic applications and research.

In recent years, the rapid development of small molecule-mediated chemical reprogramming has introduced new strategies for maintaining and expanding primary adult cells in vitro16. By regulating intracellular signaling pathways, cell-matrix interactions, and cell adhesion, small molecules significantly enhance cell proliferation and plasticity, improving cell expansion efficiency and fate control17. Due to their controllable production, low immunogenicity, and non-genomic integration, small molecules are ideal for constructing in vitro systems for expanding adult epithelial cells16. Combinations of different small molecules have been shown to effectively maintain the in vitro expansion of various primary cell types, including skin, corneal, and conjunctival epithelial stem cells18,19,20. Therefore, developing a small molecule-based strategy for expanding LGECs shows potential for future applications in both research and therapeutic settings.

A simple and efficient serum-free culture system was developed in this protocol using two small molecules, Y27632 and SB431542 (2C), to support the expansion of LGECs. By combining the advantages of these two molecules, a serum-free system was established for both 2D and 3D cultures. LGECs cultured with 2C exhibited high proliferative capacity and stem/progenitor cell characteristics, maintaining typical epithelial cell morphology after at least 10 passages in vitro. In the 3D culture, LGECs not only retained stem/progenitor cell features but also exhibited the ability to further differentiate into secretory structures after the removal of 2C, forming microglandular structures with secretory function. This serum-free system is suitable for in vitro models of LG physiology and pathology, while also providing a substantial source of cells for LG tissue engineering and regenerative applications. However, the present protocol only provides a preliminary exploration of 3D culture. Long-term 3D culture is beyond the scope of this research at this stage. It is important to note that this method is designed specifically for adult mouse LGECs and may not be applicable to other species without further optimization.

Access restricted. Please log in or start a trial to view this content.

Protocol

All experiments were performed in compliance with the regulations of the Association for Research in Vision and Ophthalmology (ARVO) and the Experimental Animal Ethics Committee of Jilin University and Xiamen University.

NOTE: All cell culture procedures were performed in a UV-sterilized biosafety cabinet in the cell operation room.

1. Primary culture of LGECs

  1. Isolation of LG tissue
    1. Euthanize anesthetized C57BL/6J mice (6-8 weeks old) by cervical dislocation and disinfect the ear region (around the LG) with 75% ethanol to avoid contamination.
    2. Make an incision from the outer canthus to the skin beneath the ear to expose the LG. Using sterile smooth forceps and scissors, carefully separate the LG from the surrounding tissue (parotid glands and connective tissue) under a dissection microscope to obtain the LG.
    3. Place the LG in a pre-cooled tissue collection medium (DMEM with 10% Penicillin-Streptomycin-Amphotericin) in a 1.5 mL microcentrifuge tube, keeping the tissue on ice to minimize degradation.
  2. Tissue preparation
    1. Transfer the LGs into a new cold tissue collection medium in a 3.5 cm dish.
    2. Remove any residual mouse fur, then peel off the connective tissue capsule surrounding the LGs. Isolate the glandular tissue by using smooth forceps to remove the connective tissue between the lobules.
      NOTE: Ensure that the capsule on the surface of the LG and the connective tissue between the lobules are thoroughly removed to expose the ducts between the lobules, which will facilitate the penetration of the digestion solution during the subsequent digestion process.
    3. Transfer the tissue into a new collection medium and wash for 5-10 min to prevent contamination.
  3. Enzymatic digestion
    1. Place the LGs into a 1.5 mL microcentrifuge tube containing digestion solution (serum-free medium supplemented with 2 mg/mL Dispase II and 2 mg/mL Collagenase A). (Supplementary Table 1).
      NOTE: 1 mL of digestion solution is required for 4 LGs.
    2. Finely dissect the LG tissue using microscissors into small pieces (approximately 0.5-1 mm³) within the tube.
    3. Incubate the microcentrifuge tube at 37 °C with 5% CO2 for 2.5-3 h. Every 30-60 min, gently mix the tissue in the digestion solution to ensure thorough enzymatic digestion.
  4. LGECs isolation and harvesting
    1. Shake the microcentrifuge tube several times upon completion of the digestion time. Pipette the digestion solution several times to break the tissue into single cells or small cell clumps. Observe under a microscope to confirm the digestion progress.
      NOTE: When no visible particles remain in the digestion solution and large numbers of single cells, as well as duct-like cell aggregates, are observed under the microscope, stop the digestion process.
    2. Centrifuge the tube at 300 x g for 5 min at room temperature, then discard the digestion medium.
    3. Resuspend the cell pellet in 1 mL of sterile DPBS and centrifuge again at 1000 x g for 3 min at room temperature to remove any remaining digestive enzymes.
    4. Repeat step 1.4.3, remove the supernatant, and resuspend the cell pellet in 500 µL of serum-free medium.
  5. LGECs seeding and primary culture
    1. Prepare the LGECs culture medium by supplementing serum-free medium with 1% penicillin-streptomycin and 2C (10 µM Y27632 and 10 µM SB431542). (Supplementary Table 1)
    2. Seed the cells into standard, untreated 24-well culture plates at a density of 7.5 x 10³ cells/cm² using serum-free 2C medium.
    3. After seeding, gently tap the edges of the culture plate to ensure even cell distribution. Place the plate in a 37 °C incubator with 5% CO2.
    4. Change the culture medium for the first time 72 h after seeding. Thereafter, change the medium every 2-3 days.
      NOTE: Avoid disturbing the culture during the first 72 h. For the first medium change, do not wash the cells with DPBS. Simply remove the old medium and add fresh medium.

2. Subculturing of LGECs

NOTE: Subculture when the cell confluence reaches 80-90%, which typically occurs approximately 14 days after primary culture.

  1. Remove the culture medium and gently wash the cells twice with sterile DPBS.
  2. Add 250 µL of 0.25% Trypsin-EDTA and incubate at 37 °C with 5% CO2 for 10-15 min. Once the tight junctions dissociate and the cells round up, add an equal volume of defined Trypsin Inhibitor Solution to terminate digestion.
    NOTE: If flat and large adherent cells are observed during primary culture, treat the culture with 0.25% Trypsin-EDTA for 5 min to remove these heterogeneous cells. Then, treat the culture again with 0.25% Trypsin-EDTA for an additional 5 min to further digest and obtain a purer population of LGECs for subsequent passage.
  3. Mix the cell suspension by pipetting with a 1 mL pipette, then transfer to a 1.5 mL centrifuge tube and centrifuge at 1000 x g for 3 min at room temperature. Discard the supernatant.
  4. Wash the cells with sterile DPBS and centrifuge again to collect the LGECs.
  5. Resuspend the LGECs in 2C culture medium and seed at a 1:2 ratio for subculture. Gently mix the cells by shaking the culture plate and incubate at 37 °C with 5% CO2.
    NOTE: Subculturing at a 1:2 ratio means that, once cell confluence reaches 80-90%, the LGECs are digested from one well plate and evenly distributed into two new well plates.
  6. Change the medium on day 3 post-seeding, and then change the medium every 2-3 days, depending on cell condition.
  7. Observe cell morphology daily under an inverted phase contrast microscope and document with photographs.

3. Three-dimensional (3D) culture of LGECs

NOTE: The 3D culture experiment uses P1 LGECs. When the P1 LGECs reach 80-90% confluence after 7 days of culture with 2C, they are used for 3D culture.

  1. Preparation steps
    1. Transfer matrix gel (Supplementary Table 1) from the -20 °C freezer to a 4 °C refrigerator for overnight thawing.
    2. Place the required pipette tips in the -20 °C freezer to ensure proper pre-cooling.
    3. Preheat the 24-well culture plate by placing it in a 37 °C, 5% CO2 incubator 2 h before starting the 3D culture.
    4. Prepare an ice box and place several 1.5 mL microcentrifuge tubes in it for pre-cooling. Sterilize the ice box in a biosafety cabinet before use.
  2. 3D culture of LGECs
    1. Obtain P1 LGECs, as described in steps 2.1 to 2.4.
    2. Resuspend the cell pellet in 2C culture medium, and adjust the cell density to 1 × 10⁴ cells per 10 µL.
    3. Take the thawed matrix gel from the 4 °C refrigerator and the pre-cooled pipette tips from the -20 °C freezer, and place them in the ice box inside the biosafety cabinet.
    4. Remove the preheated 24-well culture plate from the incubator and place it in the biosafety cabinet.
    5. Add an appropriate volume of the cell suspension, mixed with matrix gel in a 1:1 ratio, using pre-cooled pipette tips. Mix gently to ensure uniform distribution.
    6. Pipette 20 µL of the mixture from step 3.2.5 carefully into the center of each well of the preheated 24-well plate.
    7. Invert the plate and incubate it in a 37 °C, 5% CO2 incubator for 30 min to allow the matrix gel to solidify.
    8. Once the matrix gel has solidified, add 600 µL of 2C culture medium to each well.
    9. Incubate the culture plate in a 37 °C, 5% CO2 incubator for 14 days. Change the medium on day 3 after seeding and every 2-3 days thereafter, depending on the cell condition.
    10. Observe 3D spheroid formation daily under an inverted phase contrast microscope and capture images for documentation.
  3. Differentiation of 3D LGEC spheroids
    1. Culture 3D LGEC spheroids as described in step 3.2.
    2. After 7 days of culture, remove the 2C culture medium and gently wash the cells twice with DPBS to remove residual 2C. Take care not to disturb the matrix gel.
    3. Add serum-free medium without 2C (Null) and continue culture for an additional 7 days to induce differentiation.
    4. Change the medium every 2-3 days during the culture period.
    5. Observe the morphological changes of the induced 3D spheroids daily under an inverted phase contrast microscope and capture images for documentation.

4. Embedding and frozen sectioning of differentiated 3D LGEC spheroids

NOTE: Differentiation of 3D spheroids is induced as described in section 3.3. After 7 days of differentiation, follow the steps below for optimal cutting temperature (OCT) embedding and frozen sectioning of the differentiated 3D spheroids.

  1. Aspirate the culture medium along the edges of the well. Gently wash the differentiated spheroids three times with sterile DPBS.
  2. Add 1 mL of 4% paraformaldehyde (PFA) to the well in a biosafety cabinet or fume hood and fix the spheroids at room temperature for 10 min.
  3. Wash the spheroids gently three times with sterile DPBS, each wash lasting 10 min, to remove the fixative.
  4. Use a spatula to carefully scrape the 3D spheroid-matrix gel dome-like structure and transfer it into a 5 mL microcentrifuge tube containing 20% sucrose solution.
  5. Incubate the tube overnight at 4 °C until the dome structure settles at the bottom of the tube.
  6. Remove the dome structure from the sucrose solution, carefully remove any residual sucrose, and embed it in OCT compound. Freeze in liquid nitrogen and store at -80 °C.
  7. Before staining, prepare 10 µm thick sections using a freezing microtome.

5. Secretion function detection of differentiated 3D LGEC spheroids

  1. Sample collection
    1. Induce differentiation of 3D spheroids as described in section 3.3.
    2. After 7 days of differentiation, remove the culture medium and wash the 3D spheroids three times with DPBS.
    3. Add 500 µL of serum-free medium without 2C and incubate at 37 °C with 5% CO2 for 2 h.
    4. Collect the culture medium and transfer it into a 1.5 mL microcentrifuge tube as a baseline sample to measure the lactoferrin (LTF) concentration before pilocarpine stimulation.
    5. Wash the 3D spheroids gently three times with sterile DPBS.
    6. Add 500 µL of serum-free medium containing 1 µg/mL pilocarpine and incubate the 3D spheroids at 37 °C with 5% CO2 for 24 h.
    7. After incubation, collect the culture medium into a 1.5 mL microcentrifuge tube (for measuring LTF concentration after pilocarpine stimulation).
    8. Centrifuge the collected culture medium samples at 4 °C at 1000 × g for 20 min. Collect the supernatant and store it at -80 °C for later use.
  2. Sample dilution
    1. Retrieve the samples from the -80 °C freezer and allow them to thaw completely at room temperature.
    2. Take 5 µL of the sample and dilute it with 495 µL of sample dilution buffer from the enzyme-linked immunosorbent assay (ELISA) kit to prepare a 100-fold dilution.
  3. Reagent preparation
    1. Bring all reagents of the ELISA kit to room temperature 20 min before use.
    2. Prepare the wash buffer: Calculate the required amount based on the number of samples, and dilute the concentrated washing buffer with distilled water (1:24).
    3. Prepare the standard working solution:
      1. Centrifuge the lyophilized standard at 10,000 × g for 1 min. Add 1 mL of Reference Standard and Sample Diluent, let it stand for 10 min, and invert gently several times.
      2. After it fully dissolves, mix thoroughly with a pipette. This reconstitution produces a working solution of 2000 pg/mL.
    4. Make serial dilutions according to the kit instructions to prepare the following standard concentration gradient: 2000, 1000, 500, 250, 125, 62.5, 31.25, 0 pg/mL.
    5. Prepare the biotinylated detection antibody working solution:
      1. Calculate the required volume for the assay (50 µL/well). Centrifuge the concentrated biotinylated detection antibody at 800 × g for 1 min, then dilute the 50× concentrated biotinylated detection antibody to a 1× working solution using biotinylated detection antibody diluent.
      2. Prepare the solution just before use, making slightly more than the calculated amount, typically adding 100-200 µL more than needed.
    6. Prepare the horseradish peroxidase (HRP) conjugate working solution:
      1. Calculate the required volume for the experiment (50 µL/well). Centrifuge the concentrated HRP conjugate at 800 × g for 1 min, then dilute it to a 1x working concentration using HRP conjugate diluent.
      2. Prepare the solution just before use, making slightly more than the calculated amount, typically adding 100-200 µL more than needed.
  4. ELISA assay procedure
    1. Determine the wells for the diluted standard, blank, and samples, with 3 replicates for each. Add 25 µL of the standard working solution, blank, or diluted sample solution into the corresponding wells. Cover the plate with the sealer provided in the kit and incubate at 37 °C for 90 min.
      NOTE: Solutions should be added to the bottom of the micro ELISA plate well. Avoid touching the inside wall and causing foaming as much as possible.
    2. Decant the liquid from the wells without washing. Immediately add 50 µL of the biotinylated detection antibody working solution to each well. Cover the plate with a new sealer and incubate at 37 °C for 60 min.
    3. Decant the liquid from the wells and add 350 µL of prepared wash buffer to each well. Soak for 1 min, then aspirate or decant the liquid from each well and pat it dry with clean absorbent paper. Repeat this wash step 3 times.
      NOTE: Do not allow the wells to dry out during the washing process.
    4. Add 50 µL of the prepared HRP conjugate working solution to each well. Cover the plate with a new sealer and incubate at 37 °C for 30 min.
    5. Decant the liquid from the wells and repeat the wash process five times with wash buffer as described in step 5.4.3.
    6. Add 50 µL of substrate reagent to each well. Cover the plate with a new sealer and incubate at 37 °C in the dark for 15 min.
    7. Add 25 µL of stop solution to each well to terminate the reaction. Ensure the stop solution is added in the same order as the substrate solution.
    8. Determine the optical density (OD value) of each well immediately at 450 nm using a microplate reader.

6. RNA isolation

  1. Sample collection
    1. For LG tissue
      1. Isolate the extraorbital LG tissue from adult mice as described in section 1.1.2-1.1.2.
      2. Immerse the freshly isolated LG tissue in PBS to wash off any blood.
      3. Blot the surface moisture of the LG with filter paper and place the tissue into a 1.5 mL microcentrifuge tube containing 1 mL of RNA Extraction Reagent (Supplementary Table 1), keeping the tube on ice.
        NOTE: Perform grinding steps before RNA extraction to ensure complete lysis of the tissue.
      4. Add two clean steel grinding beads to the microcentrifuge tube, then place the tube in a pre-cooled high-speed low-temperature grinder.
      5. Set the grinder parameters: frequency 70 Hz, grinding time 45 s, pause time 15 s, and repeat for 10 cycles. Tighten the grinder's cap handle and start grinding.
      6. Place the tube on ice or store it at -80 °C for subsequent RNA extraction once the grinding process is complete.
    2. For LGECs
      1. Remove the culture medium and wash the cells three times with sterile DPBS when the LGECs reach 80-90% confluence.
      2. Add 600 µL of RNA extraction reagent to each well (for a 24-well plate) and incubate at room temperature for 5-10 min.
      3. Use a 1 mL pipette to repeatedly pipette the RNA extraction reagent solution in each well to ensure complete cell lysis.
      4. Transfer the solution into a 1.5 mL microcentrifuge tube.
      5. Place the tube on ice or store it at -80 °C for subsequent RNA extraction.
    3. For 3D LGEC spheroids
      1. Collect undifferentiated and differentiated 3D LGEC spheroids cultured for 14 days as described in steps 3.2-3.3. Add 1 mL of digestion solution (serum-free medium containing 1 mg/mL Dispase II) to each well, ensuring the 3D spheroid-matrix gel dome-like structure is fully covered. Incubate at 37 °C with 5% CO2 for 30 min.
      2. Transfer the digestion solution containing the 3D spheroids into a 1.5 mL microcentrifuge tube using a 1 mL pipette. Centrifuge at 1000 × g for 3 min to collect the spheroid pellet.
      3. Wash the pellet with 1 mL of DPBS and centrifuge at 1000 × g for 3 min to collect the pellet again.
      4. Add 600 µL of RNA extraction reagent (per 20 µL of matrix gel) and incubate at room temperature for 5-10 min.
      5. Mix thoroughly using a 1 mL pipette to ensure complete lysis of the 3D spheroids.
      6. Place the tube on ice or store it at -80 °C for subsequent RNA extraction.
  2. RNA extraction
    NOTE: Wear appropriate personal protective equipment (lab coat, gloves, mask) and perform all procedures involving chloroform and isopropanol in a fume hood. Dispose of chemical waste streams in designated hazardous waste containers labeled for hazardous waste generation, following institutional waste disposal protocols.
    1. Add chloroform (1/5 volume of RNA extraction reagent) to the centrifuge tube containing the RNA sample in RNA Extraction Reagent (from step 6.1).
      NOTE: Perform the procedure in a fume hood.
    2. Mix thoroughly using a vortex and incubate at room temperature for 10 min until phase separation.
    3. Centrifuge at 14,000 x g for 10 min at 4 °C.
      NOTE: After centrifugation, the liquid will separate into three layers, with RNA in the uppermost transparent aqueous phase.
    4. Prepare a new 1.5 mL RNase-free centrifuge tube and add isopropanol (1/2 the volume of RNA extraction reagent) in a fume hood.
    5. Pipette the uppermost transparent aqueous phase (1/2 the volume of RNA extraction reagent) carefully into the new RNase-free tube.
      NOTE: Be careful to avoid contaminating the middle layer when pipetting.
    6. Invert the tube several times to mix and incubate at room temperature for 10 min. Then centrifuge again at 14,000 x g for 10 min at 4 °C.
    7. Discard the supernatant and add 500 µL of 75% ethanol to wash the pellet by inverting the tube. Centrifuge again at 14,000 x g for 5 min at 4 °C.
    8. Repeat step 6.2.7. Discard the supernatant and perform a quick centrifugation to remove any residual liquid.
    9. Place the tube on ice in the fume hood, open the lid, and allow it to air dry for 10-20 min until the white pellet becomes semi-transparent.
    10. Add 20 µL of RNase-free water to dissolve the pellet. Measure RNA concentration and purity using a spectrophotometer.
      NOTE: If the RNA concentration is too high, dilute with an appropriate amount of RNase-free water.
    11. Place the RNA solution on ice or store it at -80 °C for the subsequent reverse transcription process.

7. Quantitative RT-PCR (qRT-PCR)

  1. Reverse transcription
    1. Add the following components in sequence to the PCR reaction tube according to the manufacturer's instructions: 800 ng of total RNA (calculate the volume based on its concentration), 4 µL of 5x All-in-One SuperMix for q-PCR, 1 µL of gDNA remover, and RNase-free water to bring the total volume to 20 µL.
    2. Gently mix the components. Set the PCR machine to the following conditions: 55 °C for 6 min, 80 °C for 1 min, and then 12 °C indefinitely.
    3. Store the cDNA at -20 °C or keep it on ice for the qRT-PCR process after the reverse transcription reaction is complete.
  2. qRT-PCR
    1. Prepare the qRT-PCR pre-mix solution for targeting different genes as follows: 5 µL of 2x Green qPCR SuperMix, 0.2 µL of Forward Primer (10 µM), 0.2 µL of Reverse Primer (10 µM), and 3.6 µL of nuclease-free water. Mix gently and place on ice.
    2. Add 9 µL of the qRT-PCR pre-mix (prepared in step 7.2.1) and 1 µL of cDNA (prepared in step 7.1) into the qRT-PCR tubes according to the experimental design.
    3. Centrifuge the tubes at 1000 × g at room temperature for 2 min.
    4. Place the tubes into the fluorescence quantitative PCR machine for detection.
      NOTE: Use a three-step method with the following program according to the reagent manufacturer's instructions: 94 °C for 30 s, 94 °C for 5 s, 60 °C for 15 s, and 72 °C for 10 s. Start cycling from step 2 for 40-45 cycles.
    5. Perform quantitative analysis using the comparative CT method (2-ΔΔCt).
      NOTE: Each dataset should be repeated at least three independent times to ensure the reliability of the results.

8. Immunofluorescence staining

NOTE: Immunofluorescence staining is performed on LGECs cultured in 24-well plates with confluence rates of 70-80% or on frozen sections of differentiated LGECs 3D structures.

  1. For LGECs
    1. Remove the culture medium from the wells and wash the cells three times with PBS.
    2. Add 500 µL of 4% PFA to each well in a biosafety cabinet or fume hood and incubate at room temperature for 15 min to fix the cells.
    3. Wash the cells three times with PBS, each wash lasting 5 min.
    4. Add 500 µL of 0.2% Triton X-100 to cover the cells and incubate at room temperature for 20 min to permeabilize the cell membrane.
    5. Wash the cells three times with PBS, each wash lasting 10 min.
    6. Remove the PBS and use an immunohistochemistry marker to draw a circle around each well of the 24-well plate. Add 50 µL of 2% BSA to each well to cover the cells. Incubate at room temperature for 1 h for blocking.
    7. Remove the BSA and add 50 µL of the diluted primary antibody (Supplementary Table 1) to cover the LGECs. Incubate at 4 °C for 16-18 h.
    8. Remove the primary antibody and repeat step 8.1.5.
    9. Add 50 µL of fluorescent secondary antibody to each well to cover the LGECs. Incubate at room temperature in the dark for 1 h.
    10. Repeat step 8.1.5, avoiding exposure to light.
    11. Add 50 µL of 4',6-diamidino-2-phenylindole (DAPI) solution to cover the LGECs and observe the staining under a fluorescence microscope.
  2. For 3D LGEC spheroids
    1. Prepare the 3D LGEC spheroid frozen sections as described in step 4. Perform the immunofluorescence staining as outlined in steps 8.1.2-8.1.11.

Access restricted. Please log in or start a trial to view this content.

Results

Establish a serum-free LGECs culture system using 2C
In this protocol, the aim was to establish a simpler, more efficient culture system for expanding primary mouse LGECs. After extensive screening, a serum-free 2C combination, composed solely of Y27632 and SB431542, was successfully developed, enabling long-term in vitro expansion of LGECs. After mixed enzyme digestion, primary LGECs began to adhere and form multiple cell clones after 3 days of culture with 2C (data not shown). The first 3 ...

Access restricted. Please log in or start a trial to view this content.

Discussion

As described in the Introduction, several serum-free culture systems for LG cells have been developed in recent years10,11,12,13. However, many of these methods have limitations, including poor cell proliferation and the inability to achieve large-scale expansion in vitro10,11. Furthermore, recent serum-free culture systems for...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors declare no competing interests.

Acknowledgements

This work was supported by the National Natural Science Foundation of China (82471048, 82271045); the Shenzhen Science and Technology Program (JCYJ20240813145510014); the Health Research Talents Special Project of Jilin Province (2023SCZ63, 2024SCZ53, 2025SCZ65); and the Jilin Province Science and Technology Development Plan Project (YDZJ202601ZYTS389).

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
 -20°C Ultra-low temperature refrigeratorHaier
 -80°C Ultra-low temperature refrigeratorHaier
0.25% Trypsin-EDTAGibco25200056
1.5 mL micro centrifuge tube KirgenKG2211Rnase-free
35mm cell culture dishLABSELECT12111
4 °C RefrigeratorHaier
4% paraformaldehyde (PFA)ServicebioG1101
4',6-diamidino-2-phenylindole (DAPI)Yeasen708939ES03Store at -20 °C, stock at 1 mg/mL, 500x, dilute to 1x with 1x PBS
5 mL centrifuge tube ACMECAC17457
50mL centrifuge tube LABSELECTCT-002-50-SS
Anti-alpha smooth muscle actin rabbit antibodyAbcamab5694Dilute with the antibody dilution buffer at 1:100 
Anti-AQP5 rabbit antibody ABclonalA9927Dilute with the antibody dilution buffer at 1:100 
Anti-Cytokeratin 14 rabbit antibodyAbcamab181595Dilute with the antibody dilution buffer at 1:200 
Anti-Cytokeratin 19 rabbit antibodyAbcamab52625Dilute with the antibody dilution buffer at 1:400 
Anti-Ki67 rabbit antibodyAbcamab16667Dilute with the antibody dilution buffer at 1:200 
Biosafety cabinetSterilGARD
Bovine serum albumine (BSA) Yeasen36101ES60Store at 4°C
C57BL/6J miceLaboratory Animal Center of Xiamen University
Cell culture plateLABSELECT1131224-well
Cell incubatorEppendorf
CentrifugeEppendorf
ChloroformHUSHI10006818CAUTION, Performing operations in a fume hood
CO2 constant temperature incubatorEppendorf
Collagenase ARoche10103586001Store at -20 °C, stock at 200 mg/mL, 100x
Defined trypsin inhibitor solution(DTI)GibcoR007100
DermaLife K Keratinocyte Medium Complete Kit (Serum-free medium) Life LineLL-0007Store at 4 °C
D-HanksBiosharpBL559A Used for diluting Dispase II
Dimethylsulfoxide(DMSO)SigmaD4540Used for diluting Y27632 and SB431542
Dispase IISigmaD4693Store at -20 °C, stock at 200 mg/mL, 100x
DMEM basic (1X)GibcoC11995500BT
Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488InvitrogenA-21206Dilute with the antibody dilution buffer at 1:300
Dulbecco's Phosphate-bufferd Saline (DPBS)ServicebioG4200
Ethanol absoluteHUSHI10009218CAUTION, Use to prepare other Ethanol dilutions 
Freezing microtomeLeica
High-speed low-temperature grinderServicebio
Inverted fluorescence microscopeLeica
Inverted microscopeOlympus
Isopropanol HUSHI80109270
Laser Scanning Confocal Microscope FV3000OLYMPUS
Low temperature high speed centrifugeEppendorf
LTF enzyme-linked immunosorbent assay (ELISA) kit ElabscienceE-MSEL-M0047Store at -20 °C
Matrix gel (Matrigel)82703MogengelAliquot and store at -20 °C
MicropipettorEppendorf
Microplate readerThermo Fisher Scientific
Nuclease-free waterBiosharpBL510B
OCT compoundScigen4586
PBS,1× (pH7.4)ServicebioG4202
PCR amplifierBIO-RAD
Penicillin-StreptomycinBiosharpBL505A
Penicillin-Streptomycin-AmphotericinBiosharpBL142A
PerfectStart Green qPCR SuperMix kitTransGen BiotechAQ601-01-V2Store at -20 °C
PerfectStart Uni RT&qPCR KitTransGen BiotechAUQ-01Store at -20 °C
Pilocarpine AladdinP424663Store at -20 °C, 2500x
Primer AQP5  sequence:
Forward:CATGAACCCAGCCCGATC
TT
Reverse:CTTCTGCTCCCATCCCAT
CC
Sangon Biotech
Primer K14  sequence:
Forward:CCCACCTTTCATCTTCC
CAATT
Reverse: AAGCCTGAGCAGCATGTAGCAG
Sangon Biotech
Primer K15  sequence:
Forward:GAGGTGGCGTCTAACACA
GA
Reverse:TCTGAGCCTCCATCTCAC
AG
Sangon Biotech
Primer K19  sequence:
Forward:ATTACTGCCCTGAGGAGC
CA
Reverse:TTCAGCTCCTCAATCCGA
GC
Sangon Biotech
Primer K5  sequence:
Forward:CTCAGAGCTGAGGAACAT
GC
Reverse:AGCTCCGCATCAAAGAAC
AT
Sangon Biotech
Primer Ki67  sequence:
Forward:ACCATCATTGACCGCTCC
TT
Reverse:TTGACCTTCCCCATCAGG
GT
Sangon Biotech
Primer LTF  sequence:
Forward:CAGGAGCCAACAAATGTG
CC
Reverse:TTGTACTGGTCCCTTTCG
GC
Sangon Biotech
Primer P63  sequence:
Forward:ATGTCACCGAGGTTGTG
AAA
Reverse: GAATTCAGTGCCAACCTGTG
Sangon Biotech
Primer SOX10  sequence:
Forward:ATCAGCCACGAGGTAATG
TCCAAC
Reverse:ACTGCCCAGCCCGTAGCC
Sangon Biotech
Primer α-SMA  sequence:
Forward:CTCCCTGGAGAAGAGCTA
CG
Reverse:CGCTGACTCCATCCCAAT
GA
Sangon Biotech
Real-Time fluorescence quantitative PCR instrumentRoche
RNA isolater Total RNA Extraction ReagentVazymeR401-01CAUTION, Performing operations in a fume hood
SB431542 ApexbioA8249Store at -20 °C, stock at 20 mM, 2000x
Spectrophotometer NanoDrop 1000Thermo Fisher ScientificMeasure RNA concentration
SucroseMacklinS818046Dissolve with distilled water
Triton X-100SolarbioT8200
Ultra pure water purification systemMillipore
Universal antibody dilution bufferEpizymePS119Store at 4 °C
Y27632 ApexbioB1293Store at -20 °C, stock at 20 mM, 2000x

References

  1. Veernala, I., et al. Lacrimal gland regeneration: the unmet challenges and promise for dry eye therapy. Ocul Surf. 25, 129-141 (2022).
  2. Chen, X., Li, S., Zhang, Y., Ye, L. Progress and prospects in the treatment of lacrimal gland dysfunction diseases: from traditional treatment methods to stem cell and organoid therapies. Stem Cells Int. 2025, 6334284(2025).
  3. Hirayama, M., Kawakita, T., Tsubota, K., Shimmura, S. Challenges and strategies for regenerating the lacrimal gland. Ocul Surf. 14 (2), 135-143 (2016).
  4. Ackermann, P., et al. Isolation and investigation of presumptive murine lacrimal gland stem cells. Invest Ophthalmol Vis Sci. 56 (8), 4350-4363 (2015).
  5. Gromova, A., et al. Lacrimal gland repair using progenitor cells. Stem Cells Transl Med. 6 (1), 88-98 (2017).
  6. Millar, T. J., Herok, G., Koutavas, H., Martin, D. K., Anderton, P. J. Immunohistochemical and histochemical characterisation of epithelial cells of rabbit lacrimal glands in tissue sections and cell cultures. Tissue Cell. 28 (3), 301-312 (1996).
  7. Oliver, C. Isolation and maintenance of differentiated exocrine gland acinar cells in vitro. In Vitro. 16 (4), 297-305 (1980).
  8. Hann, L. E., Tatro, J. B., Sullivan, D. A. Morphology and function of lacrimal gland acinar cells in primary culture. Invest Ophthalmol Vis Sci. 30 (1), 145-158 (1989).
  9. Yoshida, K., et al. Serum-free medium enhances the immunosuppressive and antifibrotic abilities of mesenchymal stem cells utilized in experimental renal fibrosis. Stem Cells Transl Med. 7 (12), 893-905 (2018).
  10. Ueda, Y., et al. Purification and characterization of mouse lacrimal gland epithelial cells and reconstruction of an acinar-like structure in three-dimensional culture. Invest Ophthalmol Vis Sci. 50 (5), 1978-1987 (2009).
  11. Kobayashi, S., et al. Characterization of cultivated murine lacrimal gland epithelial cells. Mol Vis. 18, 1271-1277 (2012).
  12. Xiao, S., Zhang, Y. Establishment of long-term serum-free culture for lacrimal gland stem cells aiming at lacrimal gland repair. Stem Cell Res Ther. 11 (1), 20(2020).
  13. Bannier-Hélaouët, M., et al. Exploring the human lacrimal gland using organoids and single-cell sequencing. Cell Stem Cell. 28 (7), 1221-1232.e7 (2021).
  14. Bannier-Hélaouët, M., et al. Establishment, maintenance, differentiation, genetic manipulation, and transplantation of mouse and human lacrimal gland organoids. J Vis Exp. (192), e65040(2023).
  15. Chen, H., Huang, P., Zhang, Y. Three-dimensional, serum-free culture system for lacrimal gland stem cells. J Vis Exp. (184), e63585(2022).
  16. Wang, J., Sun, S., Deng, H. Chemical reprogramming for cell fate manipulation: methods, applications, and perspectives. Cell Stem Cell. 30 (9), 1130-1147 (2023).
  17. Rehman, A., et al. Role of small molecules as drug candidates for reprogramming somatic cells into induced pluripotent stem cells: a comprehensive review. Comput Biol Med. 177, 108661(2024).
  18. Zhang, C., et al. Long-term in vitro expansion of epithelial stem cells enabled by pharmacological inhibition of pak1-rock-myosin II and TGF-β signaling. Cell Rep. 25 (3), 598-610.e5 (2018).
  19. An, X., et al. Novel cell culture paradigm prolongs mouse corneal epithelial cell proliferative activity in vitro and in vivo. Front Cell Dev Biol. 9, 675998(2021).
  20. Xu, L., et al. A cocktail of small molecules maintains the stemness and differentiation potential of conjunctival epithelial cells. Ocul Surf. 30, 107-118 (2023).
  21. Zeng, B., et al. Distinctive small molecules blend: promotes lacrimal gland epithelial cell proliferation in vitro and accelerates lacrimal gland injury repair in vivo. Ocul Surf. 34, 283-295 (2024).
  22. Zhou, Q., et al. inhibitor Y-27632 increases the cloning efficiency of limbal stem/progenitor cells by improving their adherence and ROS-scavenging capacity. Tissue Eng Part C Methods. 19 (7), 531-537 (2013).
  23. Reynolds, S. D., et al. Airway progenitor clone formation is enhanced by Y-27632-dependent changes in the transcriptome. Am J Respir Cell Mol Biol. 55 (3), 323-336 (2016).
  24. Bai, H., Gao, Y., Hoyle, D. L., Cheng, T., Wang, Z. Z. Suppression of transforming growth factor-β signaling delays cellular senescence and preserves the function of endothelial cells derived from human pluripotent stem cells. Stem Cells Transl Med. 6 (2), 589-600 (2017).
  25. Natarajan, E., et al. A keratinocyte hypermotility/growth-arrest response involving laminin 5 and p16INK4a activated in wound healing and senescence. Am J Pathol. 168 (6), 1821-1837 (2006).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Lacrimal Gland CellsSerum Free Culture2D Cell Culture3D Cell CultureSmall Molecule CultureEpithelial Cell ExpansionSpheroid FormationStemness MarkersTissue Engineering
Video Coming Soon

Related Articles