Validation of Random Transgene Integration and Expression in Eimeria Parasites

Summary

Here, we present a standardized method for validating the integration and expression of foreign genes in transgenic Eimeria parasites. By integrating genomic and protein-level analyses, this workflow confirms stable gene insertion and expression. This approach facilitates the development of transgenic Eimeria for research and vaccine applications.

Abstract

Validation of transgenic Eimeria parasites is essential for confirming stable genomic integration and expression of exogenous genes. This protocol describes a comprehensive workflow for verifying transgene insertion and protein expression in Eimeria tenella. The procedure begins with genomic DNA extraction from sporulated oocysts, followed by PCR amplification to preliminarily verify the presence of the target fragment. To further confirm genomic integration, whole-genome resequencing is performed to identify insertion sites and evaluate the stability of the integrated construct in the parasite genome. Protein expression is subsequently examined by Western blotting of lysates prepared from purified sporozoites, enabling detection of the target recombinant protein. In addition, intracellular localization is visualized by indirect immunofluorescence assay (IFA) using infected host cells. Together, these assays provide a robust and reproducible framework for validating transgenic Eimeria lines. This workflow enables reliable confirmation of genomic integration and protein expression, thereby supporting downstream applications in genetic manipulation, functional genomics, and vaccine development targeting Eimeria parasites.

Introduction

Coccidiosis, caused by Eimeria species, represents one of the most economically significant parasitic diseases in poultry, leading to reduced weight gain, poor feed conversion, and global financial losses estimated in the billions of dollars each year^1,2,3. Genetic manipulation of Eimeria parasites has become a powerful tool for both fundamental research and vaccine development^4,5,6. Stable transfection enables the integration and expression of exogenous genes, such as fluorescent reporters or protective antigens, allowing real-time visualization of parasite development and targeted evaluation of vaccine candidates^7,8,9.

A previous publication by Duan et al. provided a standardized protocol for nucleofection and in vivo propagation of transgenic Eimeria, establishing an efficient method for generating and enriching recombinant parasite lines¹⁰. However, no unified workflow currently exists for confirming stable genomic integration and functional expression of transgenes. Such validation is critical to ensure the authenticity, stability, and reproducibility of transgenic lines used for downstream biological studies or vaccine applications.

This article presents a complete, step-by-step protocol for validating transgene integration and expression in Eimeria tenella, using a transgenic E. tenella line expressing the infectious bursal disease virus (IBDV) VP2 antigen (Et-VP2) as a model¹¹. The expression plasmid p5′AMic2linkerVP2m3′A, carrying the VP2 gene and an mCherry reporter, was transfected into wild E. tenella sporozoites (Et-WT). Red fluorescent oocysts were isolated by fluorescence-activated cell sorting (FACS) and serially passaged in coccidia-free chickens. This workflow demonstrates procedures for genomic DNA extraction, PCR-based preliminary integration analysis, whole-genome resequencing to identify insertion sites, Western blotting to verify protein expression, and indirect immunofluorescence assay (IFA) to visualize intracellular localization of the recombinant protein. Together, these methods provide a reproducible and comprehensive framework for confirming the authenticity of transgenic Eimeria lines, enabling their reliable use in functional genomics research and vaccine development.

Protocol

All animal experiments involving chickens were approved by the Institutional Animal Care and Use Committee of China Agricultural University (approval number: CAU20160628-2). All husbandry and experimental procedures were conducted in accordance with the guidelines of the Institutional Animal Care and Use Committee of China Agricultural University and complied with the International Guiding Principles for Biomedical Research Involving Animals. Seven-day-old male specific pathogen-free (SPF) White Leghorn chickens were used in this study. The birds were maintained under standard husbandry conditions with free access to feed and water throughout the experimental period. The reagents and the equipment used are listed in the Table of Materials.

1. Extraction of genomic DNA from sporulated oocysts of Eimeria spp.

1. Transfer 1 mL of an oocyst suspension (≥1 × 10⁷/mL) into a 1.5 mL microcentrifuge tube. Add an equal volume of 1 mm glass beads corresponding to the oocyst pellet. Disrupt the oocysts using a tissue homogenizer by vigorous bead beating at 60 Hz for 5 min until the oocyst walls are completely broken and the contents are released.
2. Collect the mixture (excluding the glass beads) into a new tube and centrifuge at 12,000 x g for 1 min. Discard the supernatant, add 500 µL CTAB buffer and 40 µL proteinase K, and incubate the mixture at 60 °C for 30 min.
3. Add 500 µL phenol:chloroform:isoamyl alcohol (25:24:1), vortex for 10 s, and centrifuge at 12,000 x g for 5 min. Transfer the upper aqueous phase into a new tube.
   NOTE: Tightly cap and discard the tube containing the organic layer to prevent contamination of the environment. (Optional) If protein contamination remains high, repeat step 1.3 1–2 additional times.
4. Add 500 µL chloroform: isoamyl alcohol (24:1), vortex for 10 s, and centrifuge at 12,000 x g for 5 min. Transfer the aqueous phase into a new tube and add an equal volume of isopropanol. Mix by inversion until DNA precipitates appear.
   NOTE: Precipitation at −20 °C for ≥1 h or overnight enhances yield.
5. Centrifuge at 12,000 x g for 10 min to pellet DNA. Wash the pellet with 70% ethanol, centrifuge at 12,000 x g for 5 min, and discard the supernatant. Carefully remove residual liquid with a vacuum pump and air-dry the pellet at room temperature or 37 °C.
6. Dissolve the dried DNA pellet in RNase-containing ddH₂O or TE buffer. Incubate at 37 °C for ≥1 h or at 4 °C overnight to remove residual RNA. Store the purified DNA at −20 °C.
   NOTE: For long-term preservation, undissolved DNA pellets can be stored directly at −20 °C or −80 °C. Evaluate DNA integrity and concentration by agarose gel electrophoresis prior to downstream applications.

2. PCR verification of the presence of the Et-VP2 construct in the parasite genome

1. Design primer pairs (Table 1) to verify genomic integration of the Et-VP2 construct.
   NOTE: Primer sequences were designed using Primer-BLAST, with typical parameters of 18–24 bp primer length, a melting temperature of approximately 55–60 ℃, and minimal secondary structure formation. The specificity of each primer pair was further checked against the Eimeria tenella genome to avoid nonspecific amplification.
2. Prepare a 50 µL reaction mixture containing 25 µL of 2× Taq Master Mix, 21 µL ddH₂O, 1 µL each of forward and reverse primers, and 2 µL of DNA template.
3. Perform amplification using the following thermal cycling conditions: initial denaturation at 95 °C for 5 min; 30 cycles of 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min; followed by a final extension at 72 °C for 10 min.
   NOTE: Ensure that all reagents are thoroughly mixed before thermal cycling. Use freshly prepared DNA templates to achieve optimal amplification efficiency.

3. Resequencing of the transgenic parasite line (Et-VP2)

1. Sample submission and library construction
   1. Submit a 1 mL oocyst suspension (≥1 × 10⁷/mL) to a commercial sequencing service provider for next-generation resequencing analysis.
   2. Following quality assessment of the genomic DNA, fragment the DNA by mechanical disruption using ultrasound. Purify the fragmented DNA, perform end repair, add an adenine (A) base to the 3′ ends, and ligate sequencing adapters.
   3. Select DNA fragments of the desired size using agarose gel electrophoresis and perform PCR amplification to construct the sequencing library.
   4. Subject the constructed library to quality inspection. Perform paired-end sequencing on the Illumina NovaSeq platform using a read length of 150 bp. Maintain a sequencing depth of 100× to ensure data accuracy, generating at least 6 GB of raw data with a minimum quality score of Q20 >90%.
      ​NOTE: Handle all reagents and DNA samples using aseptic techniques to prevent contamination. Verify that sequencing parameters meet the required depth and quality metrics before proceeding to data analysis.
2. Data analysis
   1. Filter the raw sequencing data using Fastp software (v0.23.2) according to the following criteria¹²:
      1. Remove the adapter sequences.
      2. Set the low-quality threshold to Q20 and remove reads in which low-quality bases account for more than 30% of the total read length.
      3. Remove reads shorter than 50 bp.
   2. Align the quality-controlled reads to the E. tenella reference genome (https://www.ncbi.nlm.nih.gov/assembly/GCA_905310635.1) using Bowtie2 software (v2.4.5)¹³. The randomness of next-generation sequencing data is evaluated based on coverage depth and uniformity.
   3. Ensure that the sequencing reads are aligned to the transgenic vector sequence. Remove the reads that do not map the T-DNA region to obtain chimeric reads, in which one end maps to the T-DNA and the other end maps to the E. tenella reference genome.
   4. Based on the sequences of the chimeric reads, perform alignment using ToxoDB (release 64) to determine the specific location of potential T-DNA insertion sites. Analyze sequencing depth across homologous regions between the vector and the Eimeria genome (i.e., the 5′ and 3′ regulatory regions) using Mosdepth software (v0.3.3)¹⁴.
   5. Identify potential integration sites of the transgenic plasmid within the E. tenella genome and verify them by PCR using the reaction system described in step 2.1.
      NOTE: Ensure consistent use of software versions and parameter settings throughout the analysis to maintain data accuracy and reproducibility.

4. Western blotting of transgenic Eimeria proteins

1. Collect a PBS suspension containing at least 5 × 10⁶ sporozoites in a 1.5 mL centrifuge tube and centrifuge at 2500 x g for 5 min. Resuspend the pellet in 100 µL RIPA lysis buffer and incubate on ice for 1 h. Add 20 µL of 6× protein loading buffer and heat the mixture at 100 °C for 10 min.
2. Prepare SDS-PAGE gels using a 1.5 mm glass plate. Adjust the acrylamide concentration according to the molecular weight of the target protein. During polymerization, overlay the separating gel with distilled water to ensure an even surface before adding the stacking gel.
3. Centrifuge the lysate at 10,000 x g for 5 min and load 40 µL of supernatant into each sample lane. Load 10 µL of protein marker into a separate lane, and fill any remaining lanes with 40 µL of 1× loading buffer as controls.
4. Perform electrophoresis in 1× running buffer at 70 V for 20 min, followed by 120 V for 60–90 min, until the dye front reaches the bottom of the gel.
5. Excise the gel according to the expected protein size. Pre-activate a PVDF membrane in methanol for 1 min and assemble the transfer sandwich in the following order: sponge, filter paper, gel (cathode side), PVDF membrane, filter paper, sponge. Remove any air bubbles, and transfer proteins at 70 V for 3 h in transfer buffer.
6. Wash the membrane three times with PBST (5 min each) and block with 5% nonfat milk for 1 h at room temperature or overnight at 4 °C. Wash the membrane twice with PBST to remove residual blocking solution.
7. Incubate the membrane with primary antibodies diluted in antibody buffer: mouse polyclonal anti-Flag (1:2000) and mouse monoclonal anti-GAPDH (1:2000). Incubate for 1 h at room temperature or overnight at 4 °C with gentle shaking. Collect the antibody solution and wash the membrane five times with PBST (5 min each).
8. Incubate the membrane with HRP-conjugated goat anti-mouse IgG (1:2000) for 1 h at room temperature. Wash the membrane five times with PBST (5 min each).
9. Prepare an ECL substrate by mixing equal volumes of solution A and B. Apply the substrate evenly to the membrane and detect protein signals using a chemiluminescence imaging system.
   NOTE: Perform all steps involving protein samples on ice unless otherwise specified. Handle methanol and ECL substrates in a fume hood while wearing gloves and protective eyewear.

5. Intracellular Indirect Immunofluorescence Assay (IFA) of transgenic Eimeria

1. Purification of sporozoites using a chromatography column
   1. Connect the chromatography column to a peristaltic pump and adjust the flow rate to 50–60 Hz. Wash the column with distilled water and glycine solution.
   2. Add DE-52 cellulose suspension to the column while continuously adding glycine solution until the cellulose bed reaches approximately 1 cm in height.
   3. Load sporozoites purified by the Percoll method onto the column. Maintain a flow rate of 30–40 Hz using glycine solution and collect the flow-through in a 50 mL centrifuge tube.
   4. Monitor the eluate by placing drops onto a glass slide for microscopic observation. When no sporozoites are detected, stop the pump. Centrifuge the collected fraction at 2,500 x g for 5 min, discard the supernatant, and resuspend the pellet in PBS.
      ​NOTE: Perform all steps under sterile conditions to prevent microbial contamination. Dispose of glycine and Percoll waste according to institutional biosafety regulations.
2. Sporozoite infection of HFF cells
   1. Seed 1 × 10⁶ sporozoites into 24-well plates containing HFF cell monolayers. Add penicillin-streptomycin to a final concentration of 1× (100 U/mL penicillin and 100 µg/mL streptomycin), mix gently, and incubate at 37 °C for 4–6 h to allow invasion. Remove the medium, wash once with 1 mL PBS, and discard the supernatant.
   2. Carefully remove the glass coverslips from the wells using sterile forceps and transfer them to a fresh 24-well plate. Fix the samples in 1 mL of 4% paraformaldehyde for 30 min, wash once with 1 mL PBS, and discard the supernatant.
   3. Permeabilize the cells with 1 mL of 0.25% Triton X-100 for 30 min. Wash once with 1 mL PBS and discard the supernatant.
   4. Block the samples with 1 mL of 3% BSA for 30 min. Wash once with 1 mL PBS and discard the supernatant.
   5. Dilute mouse monoclonal anti-Flag antibody (1:200) in 3% BSA. Place drops of the diluted antibody on sealing film and invert the coverslips (cell side down) onto the drops. Incubate the coverslips in a humidified chamber at 37 °C for 1 h. Wash three times with 1 mL PBS (5 min each).
   6. Dilute FITC-conjugated goat anti-mouse IgG (1:200) and Hoechst 33258 (1:100) in 3% BSA. Place drops of the staining mixture on sealing film and invert the coverslips onto the drops. Incubate in a humidified chamber at 37 °C for 1 h, then wash five times with 1 mL PBS (5 min each).
   7. Mount the coverslips by placing 5 µL antifade mounting medium on a glass slide. Invert the coverslip (cell side down) onto the drop, avoiding air bubbles, and seal the edges. Store the mounted slides in a humidified chamber at 4 °C until imaging.
      NOTE: Handle paraformaldehyde and Triton X-100 in a chemical fume hood while wearing gloves and eye protection. Reagent formulations used in this procedure are listed in Table 2.

Results

Genomic PCR analysis confirmed the presence of the target fragment in the transgenic parasites, while no corresponding bands were detected in the wild-type control (Figure 1A). Whole-genome resequencing further demonstrated that the linearized plasmid was stably integrated into the parasite genome, and the predicted integration site was validated by PCR amplification across the junction region (Figure 1B).

Protein expression was verified by Western blotting, which revealed a distinct band corresponding to the expected molecular weight of the fusion protein in the transgenic strain. No signal was observed in the wild-type control (Figure 2).

Indirect immunofluorescence assay further revealed intracellular signals in sporozoites expressing the transgene, confirming its expression and localization, while the control group remained negative (Figure 3).

These findings demonstrate that the target construct is present in the parasite genome and that the encoded protein is stably expressed at the cellular level in transgenic E. tenella.

Figure 1: Verification of genomic integration of the VP2 transgene in the Et-VP2 strain. (A) Schematic diagram of the p5′AMic2linkerVP2m3′A expression cassette, showing primer positions for PCR1 (VP2) and PCR2 (mCherry). Genomic PCR analysis detected the expected 1,445 bp VP2 fragment and 728 bp mCherry fragment in the Et-VP2 strain, whereas no corresponding bands were present in the wild-type control (Et-WT). (B) Whole-genome resequencing identified a single insertion of the VP2 construct at position 2,705,529 of the E. tenella genome (accession no. HG994969.1). PCR amplification across the predicted junctions (PCR3 and PCR4) confirmed the integration event, with product sizes of 3,097 bp and 2,769 bp, respectively. M: DL5000 DNA marker; NC: negative control (Et-WT). Please click here to view a larger version of this figure.

Figure 2: Western blot confirmation of Mic2-linker-VP2 fusion protein expression in transgenic Eimeria. Protein lysates from purified sporozoites of Et-WT and Et-VP2 were analyzed by Western blot using an anti-Flag antibody. A distinct band at ~86 kDa, corresponding to the predicted size of the Mic2-linker-VP2 fusion protein, was detected in the Et-VP2 strain but absent in Et-WT. GAPDH served as a loading control. M: tri-color pre-stained protein marker. Please click here to view a larger version of this figure.

Figure 3: Intracellular localization of the VP2 fusion protein in transgenic E. tenella sporozoites by IFA. HFF cells infected with Et-WT or Et-VP2 sporozoites were stained with anti-Flag antibody (FITC, green), mCherry fluorescence (red), and DAPI (blue). Fluorescence microscopy (1000×) showed strong VP2-specific signals in the Et-VP2 strain, co-localizing with mCherry within sporozoite vesicles. No fluorescence was detected in Et-WT controls. Scale bars = 10 μm. Please click here to view a larger version of this figure.

Primer name	Primer sequence (5' to 3')		Fragment size/bp
PCR1-F	GGATTAAGACAGTGTGGCCTACAAG		1445
PCR1-R	GCCTGAAACGCATTTCCATGAC
PCR2-F	GAGCTGTACAAGGCTAGCAAGG		728
PCR2-R	GATCACGCTACACCGACCC
PCR3-F	CCGGAATTGCGAGAAAAGATTTGC		3097
PCR3-R	GGTTGTATGTGCTTGTCTCGC
PCR4-F	GGAGATTGTGACAAGCAAGAGC		2769
PCR4-R	GAAAAATTGGTTTAAGGGGCACCG

Table 1: Primers used for genomic identification of transgenic Eimeria parasites. The primer pairs listed in this table were designed to amplify specific regions of the parasite genome to verify transgene integration and confirm correct genomic insertion sites by PCR.

Buffer	Formulation
CTAB	Weigh 3 g of CTAB and 12.27 g of NaCl into a beaker, then add 15 mL of 1 mol/L Tris-HCl and 6 mL of 0.5 mol/L EDTA solution. Adjust the final volume to 150 mL with ddH₂O, mix thoroughly, and store at room temperature.
Proteinase K	200 mg proteinase K, ddH2O to 10 ml.
RNase	Dissolve 25 mg of RNase A in 2.5 mL of 0.01 mol/L sodium acetate (NaAc). Heat the solution in a 100 °C water bath for 10–15 min, then adjust the pH to 7.4 with 1 mol/L Tris-HCl. Store the prepared solution at −20 °C.
2×loading buffer	100 mM Tris (pH 6.8), 4% SDS, 2 mM EDTA, 2% glycerol, 6 M urea (for use: mix 900 μL of the above solution with 50 μL of 2 M DTT and 50 μL of 5% bromophenol blue.)
SDS running buffer	Add 100 mL of 10× SDS running buffer to ddH₂O and adjust the final volume to 1 L.(10× SDS running buffer: 144 g glycine, 30 g Tris base, 10 g SDS, dissolved in ddH₂O and adjusted to 1 L.)
Transfer Buffer	Mix 500 mL of 5× transfer buffer with 500 mL methanol, then add ddH₂O to a final volume of 2.5 L.(5× transfer buffer: 242 g Tris base, 144 g glycine, dissolved in ddH₂O and adjusted to 1 L.)
PBST	Combine 50 mL of 20× PBS, 30 mL of 10% Tween-20, and 920 mL of ddH₂O. (20× PBS: 260 g NaCl, 4 g KCl, 28.8 g Na₂HPO₄, 4.8 g KH₂PO₄, dissolved in ddH₂O and adjusted to 1 L. Sterilize by autoclaving and store at room temperature.)
Glycine solution	Dissolve 0.75 g glycine and 7.9 g NaCl in 500 mL of distilled water. Sterilize by autoclaving, then adjust the pH to 7.4–7.6 using 0.1 mol/L NaOH or 1 mol/L HCl.
DE-52 cellulose solution	Weigh 40 g of DE-52 cellulose powder into a beaker, add 200 mL of distilled water, stir well, and soak overnight. Discard the supernatant. Add 200 mL of 0.1 mol/L NaOH solution, stir well, soak for 4 h, and discard the supernatant. Add 200 mL of distilled water, stir well, soak for 2 h, and discard the supernatant; repeat once. Add 200 mL of 0.1 mol/L HCl solution, stir well, soak for 4 h, and discard the supernatant. Add 200 mL of distilled water, stir well, soak for 2 h, and discard the supernatant; repeat once. Finally, add 200 mL of glycine solution and stir well.

Table 2: Formulation of buffer. The table lists the composition and preparation of the buffers required for genomic DNA extraction, PCR analysis, and protein detection experiments.

Discussion

This protocol establishes a comprehensive workflow for validating genomic integration, protein expression, and intracellular localization of exogenous genes in transgenic E. tenella. Rather than relying on a single assay, the approach combines genomic and protein-level evidence, ensuring that transgene insertion is both structurally confirmed and functionally expressed.

Several critical steps in this protocol strongly influence the successful validation of transgenic lines. Technical issues may arise if these steps are not carefully optimized. High-quality genomic DNA extracted from purified parasite material is essential for reliable PCR amplification and subsequent sequencing analysis. Insufficient disruption of oocysts or contamination with host-cell material can reduce DNA quality, leading to low DNA yield and weak or inconsistent PCR amplification. These issues can be mitigated by extending the homogenization time or increasing bead-beating intensity. Accurate identification of integration sites also requires sufficient sequencing depth and reliable alignment to the reference genome. At the protein level, the sensitivity of Western blot detection depends on efficient protein extraction and the specificity of antibodies used for target recognition. Weak target-protein signals may occur when protein expression levels are low or when extraction efficiency is limited. Signal intensity can often be improved by increasing the amount of parasite lysate or optimizing lysis conditions. In addition, appropriate fixation, permeabilization, and antibody incubation conditions are essential for obtaining clear immunofluorescence staining and accurate subcellular localization. High background fluorescence in IFA experiments may result from insufficient blocking or excessive antibody concentrations, and can typically be reduced by optimizing antibody dilution ratios and washing conditions.

By combining genomic PCR, whole-genome resequencing, Western blotting, and indirect immunofluorescence assay (IFA), the procedure provides a reliable framework for confirming transgene authenticity and stability. PCR and resequencing verify integration of the linearized plasmid into the parasite genome, excluding episomal maintenance, while Western blotting and IFA confirm protein expression and subcellular localization, respectively. This integrated approach minimizes false-positive interpretations and enhances experimental confidence. Similar validation strategies have been successfully applied in other Eimeria species¹⁵. Guo et al. demonstrated VP2 expression in transgenic Eimeria acervulina (E. acervulina) using PCR, Western blotting, and IFA, leading to protective immunity against IBDV¹⁶. Likewise, a recombinant E. acervulina expressing multiple copies of the M2e antigen from avian influenza virus was validated using the same combination of assays, underscoring the reproducibility and adaptability of this approach¹⁷.

Despite its advantages, this validation workflow has several limitations. Identification of integration sites relies on high-quality sequencing data, and insertions located in highly repetitive genomic regions may be difficult to resolve precisely. In addition, the workflow confirms genomic integration and transgene protein expression but does not directly evaluate the biological function of the expressed protein. Additional functional assays are therefore required. Furthermore, transgene insertion in Eimeria currently relies on random integration, and accurate identification of insertion sites often requires whole-genome sequencing. The development of efficient site-specific integration systems in E. tenella would further improve the precision and efficiency of genetic manipulation¹⁸. To ensure the long-term stability of transgenic lines, parasite strains should be passaged for multiple generations and periodically revalidated by PCR or sequencing to confirm that the inserted gene remains stably maintained in the genome.

Overall, this standardized validation workflow can be readily applied to diverse transgenic Eimeria lines. It ensures accurate molecular confirmation of gene integration and expression, thereby supporting downstream functional genomics and vaccine development. The method offers a reproducible foundation for advancing Eimeria as both a biological model and a versatile vaccine vector.

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Antifade Mounting Medium	MCE	HYK1042	Fluorescent mounting medium to prevent photobleaching
BSA (3%)	Beyotime	ST023	Blocking buffer and antibody dilution buffer for IFA; block at room temperature for 30 min
Chloroform:isoamyl alcohol (24:1)	Sigma	C0549	Reagent for removing residual phenol during genomic DNA extraction
Coccidia-Free Chickens	Boehringer-Ingelheim	SPF	Used for in vivo passage and amplification of transgenic strains; approved by the Ethics Committee (approval number: CAU20160628-2)
CTAB (Cetyltrimethylammonium bromide)	Merck KGaA	H5882	Component of genomic DNA extraction buffer; formulation: 3 g CTAB + 12.27 g NaCl + 15 mL 1 mol/L Tris-HCl + 6 mL 0.5 mol/L EDTA, adjusted to a final volume of 150 mL with ddH2O
DE-52 Cellulose	Solarbio	C8350	Ion exchange chromatography medium for sporozoite purification; sequentially treated with NaOH, HCl, and distilled water, then equilibrated with glycine solution
ECL Substrate (Solution A + Solution B)	thermofisher	32106	Chemiluminescent detection reagent; mix equal volumes of Solution A and B before use
FITC-Conjugated Goat Anti-Mouse IgG	Sigma	AP124F	Fluorescent secondary antibody for IFA, dilution ratio 1:200
Glass beads	Sigma	Z250473-1PAK
Glycine Solution	Sigma	67419	Equilibration and elution buffer for chromatography columns; formulation: 0.75 g glycine + 7.9 g NaCl dissolved in 500 mL distilled water, pH adjusted to 7.4-7.6, autoclaved
Hoechst 33258	Sigma	94403	Nuclear staining reagent, dilution ratio 1:100; used for IFA localization
HRP-Conjugated Goat Anti-Mouse IgG	Sigma	12-349	Secondary antibody for Western blotting, dilution ratio 1:2000
Illumina NovaSeq Sequencing Platform	Personalbio Biotechnology Co., Ltd. (Shanghai, China)		Next-generation sequencing platform; paired-end sequencing (150 bp read length), sequencing depth 100×, generating ≥6 GB raw data (Q20>90%)
Low Speed Centrifuge	BEIJING ERA BEILI CENTRIFUGE	DT5-2
Mouse Monoclonal Anti-Flag Antibody	Sigma	F1804	Primary antibody, dilution ratio 1:200; used for IFA detection of Flag-tagged fusion protein
Mouse Monoclonal Anti-GAPDH Antibody	Sigma	G8795	Primary antibody, dilution ratio 1:2000; used as a loading control for Western blotting
Nonfat Milk (5%)	Beyotime	P0216	Blocking buffer for Western blotting; block at room temperature for 1 h or 4°C overnight
Paraformaldehyde (4%)	Merck KGaA	30525	Cell fixation solution; fix at room temperature for 30 min
PBS	Solarbio	P1010
Penicillin-Streptomycin (100×)	Yeasen	60162ES76	Antibiotic for cell culture; inhibits microbial contamination
Percoll (DG gradient stock	GE Healthcare	17-0891-09
Phenol:chloroform:isoamyl alcohol (25:24:1)	Merck KGaA	77617	Reagent for protein removal during genomic DNA extraction
Protein Loading Buffer (6×)	Beyotime	P0015F	Protein electrophoresis loading buffer; formulation: 100 mM Tris (pH 6.8), 4% SDS, 2 mM EDTA, 2% glycerol, 6 M urea; mix with 50 μL 2 M DTT and 50 μL 5% bromophenol blue before use
Proteinase K	Merck KGaA	39450-01-6	200 mg dissolved in 10 mL ddH2O, used for protein digestion during genomic DNA extraction
PVDF Membrane	thermofisher	88518	Protein transfer membrane; activated with methanol for 1 min before use
RIPA Lysis Buffer	Yeasen	20101	Lysis buffer for sporozoite protein extraction
RNase A	Merck KGaA	9001-99-4	25 mg dissolved in 2.5 mL 0.01 mol/L NaAc, heated at 100°C for 10-15 min, pH adjusted to 7.4 with 1 mol/L Tris-HCl; used for RNA removal from DNA samples
SDS-PAGE Gel Reagents (Acrylamide, Bis-acrylamide, Tris, SDS, APS, TEMED)	Bio	101	Reagents for SDS-PAGE gel preparation; acrylamide concentration adjusted according to the molecular weight of the target protein
Sodium taurodeoxycholate hydrate	Sigma	T0875
solution)
Taq Master Mix (2×)	Vazyme	P112-01/02/03	PCR amplification premix containing Taq polymerase, dNTPs, etc.
Triton X-100 (0.25%)	Merck KGaA	9036	Cell permeabilization solution; incubate at room temperature for 30 min
Trypsin	Solarbio	T8150
Vortex Mixer	Beijing North TZ-Biotech	HQ-60-II
Water Bath Thermostat	Grant Instruments (Cambridge)	GD120,GM0815010