A Digital Microfluidic Electroporation Platform for Low-input CRISPR Genome Editing and mRNA Transfection In Suspension T Cells and 3D Cell Models

Summary

This protocol describes miniaturized CRISPR–Cas9 genome editing of TCRα/β receptor in primary human T cells using ‘DMF-ection’, a digital microfluidic (DMF) electroporation platform. The method enables parallel, low-input gene editing with high viability and is further adaptable for mRNA delivery into multicellular 3D spheroids.

Abstract

Digital microfluidic (DMF) electroporation enables precise, low-volume genetic manipulation of mammalian cells while minimizing cellular input by up to 100x and preserving viability. This study presents a high-throughput DMF-based transfection workflow for CRISPR-mediated knockout of the TRAC locus in primary human suspension T cells and for mRNA transfection of three-dimensional HEK293T spheroids. Using spatially deposited CRISPR guide RNAs and on- cartridge ribonucleoprotein (RNP) assembly, efficient TRAC locus disruption was achieved in both CD4⁺ and CD8⁺ T-cell populations using only 10,000 cells per condition, with post-editing viabilities exceeding 85%. Biophysical characterization using flow-induced and Taylor dispersion analyses revealed that polymer additives stabilize Cas9–sgRNA complexes under electroporation buffer conditions, supporting reproducible editing at sub microliter volumes. The workflow was further adapted for 3D applications by delivering EGFP mRNA into intact HEK293T spheroids, resulting in robust and spatially uniform fluorescence without impairing spheroid growth or morphology. Together, these results demonstrate that DMF electroporation enables efficient genome editing and mRNA delivery across both suspension immune cells and multicellular spheroids. This platform provides a scalable and low-input solution for applications in CAR-T cell therapy, functional genomics, and advanced 3D cellular models.

Introduction

Gene editing in primary human cells is increasingly central to both therapeutic development and basic research, including applications in immuno-engineering, rare disease modeling, and functional genomics¹. Although electroporation enables highly efficient genome editing, conventional cuvette-based systems typically require up to millions of cells per condition, restricting their use for patient-derived samples and rare immune populations². In addition, these systems are poorly suited for large-scale screening due to limitations in throughput, automation, and reagent consumption³.

Protocol

Primary human T cells used in this protocol were obtained from commercial suppliers under informed donor consent and in compliance with applicable institutional, ethical, and regulatory guidelines. All handling of human-derived biological materials was conducted in accordance with institutional biosafety protocols. Researchers implementing this protocol are responsible for ensuring that their use of primary human cells complies with local institutional review board (IRB) or ethics committee requirements, applicable biosafety regulations, and any relevant national or regional legislation governing the use of human biological material. No patient-identifiable informatio....

Results

Expected outcomes
Electroporation of 10,000 activated T cells per condition typically results in >85% TRAC knockout efficiency with >95% viability 72 h post-transfection. Flow cytometry reveals a clear loss of TCRα/β staining in the TRAC-targeting condition relative to non-targeting sgRNA controls (NTC) and controls not exposed to any electric fields. Unless otherwise stated, n represents independent DMF-ection runs performed on separate days. Technical replicates from the same cartrid.......

Discussion

This protocol describes a miniaturized digital microfluidic electroporation workflow that enables efficient intracellular delivery into primary human T cells using nanoliter-scale droplets. A central advantage of this method is the ability to perform CRISPR–Cas9 genome editing using only 10,000 cells per reaction, dramatically reducing material requirements compared to conventional electroporation. The droplet-based architecture supports automation, ensuring reproducible reagent handling and reaction assembly acros.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
12 Channel VOYAGER Adjustable Tip Spacing Pipette	Integra	4732	Instrumentation
1x PBS	Gibco		Flow Buffer
96 Well Plate, Sphera Low-Attachment Surface	Thermo Fisher	174927	Spheroid protocol
96-well conical-bottom plate	Sarstedt	82.1583.001	Spheroid protocol
Alexa Fluor 647 anti-human CD4 Antibody	Biolegend	357421	1 in 200, Clone A161A1
Attune Flow Cytometer	ThermoFisher		Instrumentation
DMEM Media	Gibco	10564011	Media Supplement- Spheroid culture
DMF compatible buffer	DropGenie		Transfection
DropGenie Transfection System	DropGenie		Instrumentation
Echo Acoustic Dispenser 650 Series	Beckman Coulter Life Scienes
Echo Qualified 384-well Low Dead Volume	Beckman Coulter Life Scienes
EDTA	Invitrogen		Flow Buffer
EGFP mRNA	Trilink	L-7201
EVOS Fluorescent Microscope	ThermoFisher		Instrumentation
Fetal Bovine Serum	Gibco	16000044	Media Supplement- Spheroid culture
Fida 1 instrument and Fida Neo 480 nm detector	Fida Biosystems ApS		Instrumentation
Ghost Dye Violet 510	Cytek Biosciences	13-0870
HEK293T Cells	ATCC		Spheroid protocol
Human IL-2 Recombinant Protein,	Peprotech	200-02 50ug	T cell media supplement
Human Primary Pan CD3+ T Cells	All Cells		Peripheral Blood, Cryopreserved, pan CD3+ Helper T Cells, Negatively Selected
Immunocult CD3/CD28 Activator	StemCell Technologies	10970	T Cell Activation media
Immunocult Expansion Media	StemCell Technologies	10981	T Cell Activation media
Incucyte Live Cell Analysis System	Sartorius		Instrumentation
INTEGRA ASSIST PLUS pipetting robot	Integra	4505, 4-Position Portrait Deck (PN 4521),	Instrumentation
non targeting synthetic guide RNA	Synthego		5’ GCACTACCAGAGCTAACTCA 3'
NucleoCounter NC-202	Chemometec
PE anti-human TCR α/β Recombinant Antibody	Biolegend	380805	1 in 200, Clone QA20B12
PE-Cy 7 Anti-Human CD8	BD Pharmingen	557750	1 in 200, Clone RPA-T8
Penicillin-Streptomycin (10,000 U/mL)	Gibco	15140122	Media Supplement- Spheroid culture
Poly-L-glutamic Acid (PGA)	Sigma Aldrich	P4761-100MG	Use a at 100mg/ml
Prism version 8.0.0	GraphPad Software, Inc.		Software
sNLS-SpCas9-sNLS Nuclease	IDT	10017687
Spheroid Microplate	Corning	3830	Spheroid protocol
Surfactant F	DropGenie		Transfection- use at 1:20 in DMF compatible buffer to make compete Transfection buffer
TRAC synthetic guide RNA	Synthego		5’ AGAGTCTCTCAGCTGGTACA 3'
Trypsin-EDTA (0.05%), phenol red	Gibco	25-300-062	Spheroid protocol