Name: Generation of GABAergic Neurons from Human Induced Pluripotent Stem Cells Using Doxycycline-Inducible ASCL1/DLX2 Expression at AAVS1 (Video) | JoVE Journal
Uploaded: 2026-07-31T12:55:00.000+00:00
Duration: 9 min 14 s
Description: Learn CRISPR/Cas9-mediated knock-in of ASCL1/DLX2 at AAVS1 using doxycycline-inducible expression in hiPSCs. This protocol enables efficient generation of GABAergic neurons for neurological disease modeling.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

playerTrialDesktop

Support was provided by the Canadian Stem Cell Network Jump Start ECR Program and the Fonds UdeM pour le partenariat CHU Sainte-Justine -Institut Imagine en &#233;pilepsie de l&#8217;enfant. Th&#233;o Rabin is supported by the Odis&#233; network.

CAUTION: Human hiPSC cultures should be handled as potentially biohazardous material under institutional biosafety procedures. Perform all human hiPSC culture procedures in a certified Class II biological safety cabinet using sterile technique. All waste containing human cells, media exposed to human cells, and CRISPR/Cas9 plasmid material should be decontaminated in accordance with local biosafety guidelines before disposal. Doxycycline, puromycin, DMSO, and other chemical reagents should be handled with gloves and appropriate eye and skin protection, and waste should be discarded according to institutional chemical-waste procedures. Basement membrane extract (BME) should be handled using sterile technique and stored on ice before use to prevent premature polymerization. Liquid nitrogen storage and cryovial handling should be performed with appropriate cryogenic gloves, face protection, and caution to avoid cold burns or vial explosion during thawing.
NOTE: Before CRISPR/Cas9-mediated editing and neuronal differentiation, hiPSC cultures should meet predefined quality-control criteria. Cells must be confirmed negative for mycoplasma, display a normal karyotype or acceptable genomic integrity profile, and maintain robust expression of pluripotency markers, including OCT4, SOX2, NANOG, TRA-1-60, and/or SSEA4. Cultures should exhibit typical compact hiPSC colony morphology, with a high nuclear-to-cytoplasmic ratio, defined colony borders, and minimal spontaneous differentiation. Only actively proliferating cultures within the recommended passage range should be used, and cells should not exceed the laboratory-defined maximum passage number, typically below passage 40, unless otherwise validated. Cultures showing abnormal morphology, excessive spontaneous differentiation, poor growth, confirmed contamination, or evidence of genomic instability should be excluded from editing and differentiation experiments. All materials required for this protocol, including media recipes, are listed in the Table of Materials.
1. Preparation of reagents and culture plates
<ol>
	<li>Prepare the freezing medium by combining 40 mL of knock-out serum replacement (KOSR) and 10 mL of dimethyl sulfoxide (DMSO) in a 50 mL conical tube.</li>
	<li>Homogenize the freezing medium by pipetting up and down 10 times. Store the solution at 4 &#176;C for up to 1 month.</li>
	<li>Dilute the basement membrane extract (BME) in Dulbecco&#39;s Modified Eagle Medium/F12 (DMEM/F12) medium at a final concentration of 80 &#181;g/mL. 
	NOTE: Before dilution, verify the concentration of the received BME solution using the lot number on the vendor&#39;s website.</li>
	<li>Add 1 mL of the diluted BME per well to a 6-well plate. Immediately return the stock BME to 4 &#176;C for up to 1 month.</li>
	<li>Tilt the plate to distribute the solution evenly across the entire surface of the wells. Ensure there are no uncoated areas.</li>
	<li>Incubate the plate for a minimum of 30 min at 37 &#176;C before use. 
	NOTE: There is no maximum incubation time. If incubating for more than 1 day, ensure that the DMEM/F-12 does not evaporate. The BME solution used for one well can be reused only once to coat a second well. Manipulation of BME at room temperature should be brief due to its rapid polymerization.</li>
</ol>
2. Maintenance and passaging of hiPSCs
NOTE: In this protocol, hiPSC maintenance medium refers to mTeSR plus. mTeSR plus is the recommended medium for routine maintenance, passaging, recovery after nucleofection, and puromycin selection.
<ol>
	<li>Perform hiPSC passaging approximately every 4&#8211;6 days when the cells reach 60% confluence.</li>
	<li>Aspirate the culture medium from the wells using an aspirating pipette.</li>
	<li>Add 1 mL of ReLeSR to the well and incubate for 30 s at room temperature.</li>
	<li>Aspirate the dissociation reagent and incubate the plate for 8 min at 37 &#176;C.</li>
	<li>Gently add 1 mL of hiPSC maintenance medium using a 5 mL pipette. Collect the cell suspension in a 50 mL tube.</li>
	<li>Mix 10 &#181;L of the cell suspension with 10 &#181;L of trypan blue in a microcentrifuge tube. Load 10 &#181;L of the mixture onto a cell counter slide to determine the viable cell concentration.</li>
	<li>Aspirate the BME coating from a previously prepared well. Add 2 mL of hiPSC maintenance medium supplemented with Rho-associated coiled-coil kinase (ROCK) inhibitor (Y-27632; 10 &#956;M final).</li>
	<li>Seed 100,000 hiPSCs into the well, aiming for a &#62;90% viability. Move the plate in a figure-eight motion to ensure a homogeneous distribution of cells.</li>
	<li>Incubate the cells at 37 &#176;C with 5% CO2.</li>
	<li>After 24 h, replace the medium with 2 mL of fresh mTeSR plus medium without ROCK inhibitor. 
	NOTE: A transient change in cell morphology (cell elongation) is expected in the presence of the ROCK inhibitor. Verify that cells regain their characteristic morphology after their removal.</li>
</ol>
3. Nucleofection of hiPSCs
<ol>
	<li>Pass the cells when the confluence reaches around 60%. 
	NOTE: In this protocol, approximately 60% confluence corresponds to actively growing hiPSC colonies covering slightly more than half of the well surface, with visible space between colonies and minimal spontaneous differentiation. Colonies should not be overgrown, extensively merged, or exhibit dense, multilayered centers at the time of nucleofection.</li>
	<li>Ensure the nucleofection device is turned on and the nucleofection supplement is added to the nucleofection solution P3. Prepare an ice bucket.</li>
	<li>Add 110 &#181;L of the nucleofection solution P3 to a microcentrifuge tube placed on ice.</li>
	<li>Add 1 &#181;g of the CRISPR/Cas9 plasmid and 1 &#181;g of the donor plasmid containing the doxycycline-inducible ASCL1-P2A-DLX2. cassette, fluorescent reporter, and puromycin-resistance cassette to the tube. Mix gently without introducing bubbles.</li>
	<li>Prepare the destination plate by aspirating the BME from two coated wells. Add 2 mL of hiPSC maintenance medium containing a ROCK inhibitor to each well, and incubate the plate at 37 &#176;C.</li>
	<li>Dissociate hiPSCs at 60% confluence from a well of a 6-well plate as described in steps 2.2 to 2.5. Transfer the suspension to a sterile tube and centrifuge for 5 min at 500 x g. at room temperature.</li>
	<li>Discard the supernatant and resuspend the cell pellet in the 110 &#181;L of nucleofection solution P3 containing the plasmids. Pipette gently to avoid bubble formation.</li>
	<li>Transfer 100 &#181;L of the cell suspension into a nucleofection cuvette placed on ice.</li>
	<li>Insert the cuvette into the nucleofector device and run the CB-150 program for hiPSCs.</li>
	<li>Immediately retrieve the cells using a plastic Pasteur pipette. Transfer equal volumes of the cell suspension into the two previously prepared wells.</li>
	<li>Distribute the cells using a figure-eight motion and incubate at 37 &#176;C.</li>
	<li>After 24 h, replace the medium with mTeSR plus medium lacking ROCK inhibitor. Verify nucleofection efficiency by observing fluorescence if applicable.</li>
</ol>
4. Antibiotic selection
CAUTION: Puromycin is toxic. Handle with appropriate personal protective equipment and dispose of waste in accordance with institutional guidelines.
NOTE: Before selecting edited hiPSCs, determine the optimal puromycin concentration for each hiPSC line. Seed unedited hiPSCs at 100,000 cells per well in a BME-coated 6-well plate in hiPSC maintenance medium supplemented with ROCK inhibitor. After 24 h, replace the medium with fresh hiPSC maintenance medium containing puromycin at 0, 0.2, 0.4, 0.6, 0.8, 1.0, and 1.5 &#181;g/mL. Replace puromycin-containing medium daily and monitor cell morphology and survival by brightfield microscopy for 5 days. The selected concentration should eliminate all unedited hiPSCs within 3&#8211;5 days while minimizing excessive toxicity. In this protocol, the optimal puromycin concentration is typically 0.4&#8211;0.6 &#181;g/mL.
<ol>
	<li>Wait for 3 passages post-nucleofection, typically approximately 1&#8211;2 weeks depending on recovery and growth rate, to allow for the loss of non-integrated plasmids before initiating selection.</li>
	<li>Perform a cell passage and seed 100,000 cells per well.</li>
	<li>After 24 h, add puromycin at the concentration determined by the kill curve, typically 0.4&#8211;0.6 &#181;g/mL.&#160;</li>
	<li>Maintain the puromycin selection for the predetermined duration, generally about 5 days.</li>
	<li>Validate the selected population by fluorescence microscopy or flow cytometry to estimate the proportion of reporter-positive cells. 
	NOTE: Proceed only with pooled populations showing broadly homogeneous reporter expression, ideally &#62;80&#8211;90% reporter-positive cells. If reporter expression remains mosaic, extend selection, repeat enrichment, or consider clonal isolation before differentiation.</li>
	<li>Confirm correct AAVS1. targeting by junction PCR before initiating neuronal differentiation.</li>
	<li>When rigorous validation is required, verify PCR products by Sanger sequencing and assess transgene copy number by qPCR, ddPCR, or another appropriate copy-number assay.</li>
	<li>Evaluate random integration using PCR-based assays for plasmid backbone sequences or broader genome-wide integration analysis, depending on the intended downstream application.</li>
	<li>Confirm that the selected hiPSC population remains mycoplasma-negative, retains typical hiPSC colony morphology, and maintains robust growth after puromycin selection.</li>
	<li>Reassess genomic integrity by karyotyping, SNP array, or another validated assay, particularly when edited cells will be used for disease modeling, functional assays, or long-term studies.</li>
	<li>Assess potential CRISPR/Cas9 off-target effects by targeted sequencing of predicted off-target sites or, when required, broader genomic approaches. 
	NOTE: Do not use cultures for differentiation if they show abnormal morphology, poor recovery after selection, persistent mosaic reporter expression, confirmed genomic abnormalities, or failed AAVS1 integration. In this protocol, selected engineered hiPSCs are used as a pooled population and can be cryopreserved before doxycycline induction, once reporter expression, AAVS1. targeting, morphology, and growth have been validated. Cryopreservation after doxycycline induction or during neuronal maturation is not part of the standard workflow and should be empirically validated before use.</li>
</ol>
5. Differentiation into GABAergic neurons
<ol>
	<li>Prepare the necessary number of BME-coated wells. Note that one well seeded on Day 0 will yield one well of GABAergic neurons.</li>
	<li>Prepare 6.9 mL of neuro-induction medium per well, supplementing it with doxycycline (1 &#181;g/mL). Include a 15% excess volume to account for evaporation or pipetting errors. 
	NOTE: Doxycycline is used at a final concentration of 1 &#181;g/mL, starting on Day 0, and maintained throughout differentiation and maturation. Fresh doxycycline-containing medium is prepared at each medium change to maintain consistent transgene induction. This dose was selected because it produced robust reporter expression and efficient neuronal conversion in our hands. A formal doxycycline dose-response was not performed in this protocol; therefore, laboratories adapting the method may empirically test 0.1&#8211;2 &#181;g/mL doxycycline if transgene induction appears suboptimal.</li>
	<li>On Day 0, dissociate the engineered hiPSCs and seed 200,000 cells into the prepared BME-coated wells. Incubate at 37 &#176;C.</li>
	<li>On Days 1, 2, and 3, aspirate the medium and add 2 mL of fresh neuro-induction medium containing doxycycline. 
	NOTE: By Day 3, cell expansion should markedly decrease, and dendritic-like structures may begin to appear. If experimental confirmation of cell-cycle exit is required, Ki-67 immunostaining or EdU/BrdU incorporation can be performed at Day 3&#8211;4.</li>
	<li>On Day 4, prepare neuro-maturation medium containing brain-derived neurotrophic factor (BDNF), glial cell line-derived neurotrophic factor (GDNF), and neurotrophin-3 (NT-3), each at a final concentration of 10 ng/mL, doxycycline at 1 &#181;g/mL, and PluriSln at 20 &#181;M.</li>
	<li>Aspirate the neuro-induction medium. Carefully add 2 mL of the neuro-maturation medium drop-by-drop along the wall of the well to avoid disturbing the newly formed neurons.</li>
	<li>On Day 7, aspirate the medium and gently add 2 mL of neuro-maturation medium containing the neurotrophins and doxycycline, but omitting the pluripotent cell survival inhibitor.</li>
	<li>For long-term maintenance, replace the neuro-maturation medium completely every 3 to 4 days, adapting the frequency based on cell density. 
	NOTE: Day 21 is the standard endpoint for assessing GABAergic neuronal identity. By Day 21, cells should display GABAergic neuronal features, including DLX1 .expression, and continue to mature their axonal networks. A seeding density of 200,000 cells/well was empirically selected to produce well-spaced colonies while avoiding overcrowding and maturation-associated cell death. Densities of 150,000&#8211;300,000 cells/well are compatible, with lower densities preferred for morphology and higher densities for material recovery. To reduce detachment, perform more frequent half-medium changes using a 1,000 &#181;L pipette at low flow without tilting the plate. If needed, cells may be replated once after the 3-day doxycycline induction, before the addition of maturation medium, using enhanced coatings such as poly-L-lysine/laminin or laminin-521. Further passaging after maturation begins should be avoided.</li>
	<li>Cultures may be maintained beyond Day 21 for extended maturation if networks remain attached, viable, and free of proliferating hiPSC-like colonies. After Day 21, perform half-medium changes every 3&#8211;4 days with fresh neuro-maturation medium containing doxycycline and neurotrophic factors. 
	NOTE: Use cultures for downstream assays once neuronal morphology and neurite networks are stable, detachment is minimal, and no undifferentiated colonies are visible. In our hands, cultures are typically used between Day 21 and Day 35.</li>
</ol>

<ol>
	<li>Mertens J, Marchetto MC, Bardy C, Gage FH. Evaluating cell reprogramming, differentiation, and conversion technologies in neuroscience. Nat Rev Neurosci. 2016 Jul;17(7):424-37.</li>
	<li>Barabino A, Flamier A, Hanna R, H&#233;on E, Freedman BS, Bernier G. Deregulation of Neuro-Developmental Genes and Primary Cilium Cytoskeleton Anomalies in iPSC Retinal Sheets from Human Syndromic Ciliopathies. Stem Cell Reports. 2020 Mar 10;14(3):357-73.</li>
	<li>Katbe A, Hanna R, Flamier A, Serhani D, Hamam R, Barabino A, et al. Epigenomic alterations and neural development anomalies in induced pluripotent stem cells from sporadic Alzheimer&#8217;s disease. Development. 2026 Jan 1;153(1):dev204910.</li>
	<li>Liu Y, Flamier A, Bell GW, Diao AJ, Whitfield TW, Wang HC, et al. MECP2 directly interacts with RNA polymerase II to modulate transcription in human neurons. Neuron. 2024 Jun;112(12):1943-1958.e10.</li>
	<li>Flamier A, Bisht P, Richards A, Tomasello DL, Jaenisch R. Human iPS cell-derived sensory neurons can be infected by SARS-CoV-2. iScience. 2023 Sep 15;26(9).</li>
	<li>Wogram E, S&#252;mpelmann F, Khalil A, Flamier A, Fu D, Bell GW, et al. Human iPSC-Derived Microglia Integrate Into Cerebral Organoids and Assume an In&#160;Vivo-Like Phenotype. Eur J Neurosci. 2025 Nov;62(9):e70281.</li>
	<li>Mar&#237;n O. Interneuron dysfunction in psychiatric disorders. Nat Rev Neurosci. 2012 Jan 18;13(2):107&#8211;20. PubMed PMID: 22251963.</li>
	<li>Yang N, Ng YH, Pang ZP, S&#252;dhof TC, Wernig M. Induced neuronal cells: how to make and define a neuron. Cell Stem Cell. 2011 Dec 2;9(6):517-25.</li>
	<li>Busskamp V, Lewis NE, Guye P, Ng AHM, Shipman SL, Byrne SM, et al. Rapid neurogenesis through transcriptional activation in human stem cells. Mol Syst Biol. 2014 Nov 17;10(11):760.</li>
	<li>Barretto N, Zhang H, Powell SK, Fernando MB, Zhang S, Flaherty EK, et al. ASCL1- and DLX2-induced GABAergic neurons from hiPSC-derived NPCs. J Neurosci Methods. 2020 Mar 15;334:108548.</li>
	<li>Gu J, Rollo B, Liu Z, O&#8217;Brien TJ, Kwan P, Cromer B, et al. Forward programming of human pluripotent stem cells to generate glutamatergic and GABAergic neurons in a tri-culture model with astrocytes. Stem Cell Res Ther. 2026 Feb 25;17(1):125.</li>
</ol>

The authors declare no competing financial interests.

The successful generation of GABAergic neurons relies heavily on several critical steps within this protocol. Maintaining high-quality, undifferentiated hiPSCs is paramount; spontaneous differentiation prior to nucleofection drastically reduces integration efficiency and downstream neuronal purity8. Furthermore, precise determination of the puromycin kill curve is essential to ensure complete elimination of non-integrated cells without undue stress on properly engineered clones. During the differe...

Human induced pluripotent stem cells (hiPSCs) provide a unique platform to model human neurological diseases in vitro. and to investigate the complex molecular mechanisms that drive development and degeneration1. This technology enables the generation of patient-specific cellular models to investigate a wide array of conditions, ranging from early neurodevelopmental anomalies in syndromic ciliopathies2 to subtle epigenomic alterations observed in sporadic Alzheimer&#39;s disease3. Consequently, directed differentiation of hiPSCs has become a cornerstone of modern molecular neuroscience.
To effectively capture the nuances of human neurological processes, generating highly specific and pure neuronal subtypes is essential. For example, defined neuronal populations are required to elucidate the specific transcriptional roles of proteins like MECP2 in human neurons4, or to assess the targeted vulnerabilities of peripheral sensory neurons to viral infections, such as SARS-CoV-25. Furthermore, constructing complex, physiologically relevant microenvironments, like incorporating functional microglia into 3D cerebral organoids, relies fundamentally on the robust, predictable generation of distinct neural and glial lineages6. Among these subtypes, GABAergic neurons are of particular interest due to their crucial inhibitory role in the central nervous system and their implication in various neurological and psychiatric disorders7. The overall goal of this method is to provide a reliable, efficient, and reproducible protocol for the directed differentiation of hiPSCs into induced neurons expressing GABAergic lineage markers. Traditional directed differentiation protocols for GABAergic neurons, which rely on extrinsic signaling molecules, can be time-consuming, highly variable, and result in heterogeneous cell populations8.
To overcome these limitations, transcription factor-mediated forward programming has emerged as a powerful alternative9. This protocol uses a doxycycline-inducible expression system to drive expression of the proneural transcription factors ASCL1 and DLX210. By targeting these transgenes to the adeno-associated virus integration site 1 (AAVS1.) safe-harbor locus using CRISPR/Cas9, this method circumvents the common issue of transgene silencing associated with random lentiviral integration10. The donor construct includes a fluorescent reporter, such as mCherry, to monitor transgene-positive cells after selection. This strategy is intended to support more homogeneous transgene expression than random integration approaches, although expression stability and differentiation reproducibility should be validated for each engineered line. This standardized method generates enriched populations of induced neurons expressing GABAergic lineage markers in approximately 21 days, a timeframe shorter than that of traditional small-molecule approaches8,10. This protocol is highly appropriate for researchers who require scalable, consistent neuronal populations for downstream applications such as high-content microscopy, single-cell transcriptomics, or functional physiological assays.

<table><tbody><tr><td>4D-Nucleofector&amp;trade; Core Unit</td><td>Lonza</td><td>AAF-1002B</td><td>For electroporation/nucleofection of hiPSCs.</td></tr><tr><td>6-well culture plates</td><td>Sarstedt</td><td>83.3920300</td><td>Tissue culture-treated plates for hiPSC maintenance and differentiation.</td></tr><tr><td>BDNF (Brain-Derived Neurotrophic Factor)</td><td>STEMCELL Technologies</td><td>78005</td><td>Recombinant human protein for neuronal maturation; prepare according to manufacturer instructions and use at 10 ng/mL final concentration.</td></tr><tr><td>Cell counter (Countess)</td><td>Thermo Fisher Scientific</td><td>C10283</td><td>Used for cell counting.</td></tr><tr><td>Centrifuge</td><td>VWR</td><td>76468-134</td><td>For cell pelleting.</td></tr><tr><td>CO&lt;sub&gt;2&lt;/sub&gt; incubator</td><td>Thermo Fisher Scientific</td><td>Heracell VIOS 160i or equivalent</td><td>Cell culture incubator maintaining 37 &amp;deg;C, humidified atmosphere, and 5% CO&lt;sub&gt;2&lt;/sub&gt;.</td></tr><tr><td>Cryotubes</td><td>Thermo Fisher Scientific</td><td>5000-0020</td><td>Sterile cryogenic vials for freezing hiPSCs; equivalent externally threaded 1.8&amp;ndash;2.0 mL cryovials may be used.</td></tr><tr><td>Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract</td><td>Bio-Techne</td><td>BME001-05</td><td>Standard BME coating matrix used in the protocol. Verify the lot-specific stock concentration from the Bio-Techne certificate of analysis and dilute in DMEM/F-12 to 80 &amp;micro;g/mL working concentration.</td></tr><tr><td>DMEM/F-12</td><td>Wisent</td><td>319-090-CL</td><td>Basal medium used for diluting BME.</td></tr><tr><td>DMSO (Dimethyl sulfoxide)</td><td>Sigma-Aldrich</td><td>D2650</td><td>Cryoprotectant used in the preparation of freezing medium.</td></tr><tr><td>Donor plasmid: inducible ASCL1-P2A-DLX2 AAVS1 targeting cassette</td><td>Custom plasmid</td><td>Addgene accession pending</td><td>Custom AAVS1 donor plasmid containing doxycycline-inducible ASCL1-P2A-DLX2 cassette and selection/reporter elements. Provide plasmid map and full sequence as supplementary file or upon request.</td></tr><tr><td>Doxycycline hyclate</td><td>Sigma-Aldrich</td><td>D9891</td><td>Used to induce ASCL1-P2A-DLX2 expression. Prepare sterile stock solution, aliquot, protect from light, store frozen, and use at 1 &amp;micro;g/mL final concentration.</td></tr><tr><td>Ethanol (70%)</td><td>Commercial Alcohols / Greenfield Global</td><td>P016EAAN</td><td>For sterilization inside the biological safety cabinet; use institutional approved 70% ethanol or equivalent.</td></tr><tr><td>Fluorescence microscope</td><td>ECHO</td><td>Revolve R4</td><td>Microscope used for phase-contrast and fluorescence imaging of reporter expression and neuronal morphology.</td></tr><tr><td>GDNF (Glial-Derived Neurotrophic Factor)</td><td>STEMCELL Technologies</td><td>78058</td><td>Recombinant human protein for neuronal maturation; prepare according to manufacturer instructions and use at 10 ng/mL final concentration.</td></tr><tr><td>hiPSC line PGP1</td><td>EditCo Bio</td><td>PGP1 human iPSC line</td><td>Commercially available open-consent human iPSC line used in this protocol; record passage number and QC status before editing and differentiation.</td></tr><tr><td>Image-analysis software</td><td>ImageJ/Fiji</td><td>Open-source; version used should be reported</td><td>For fluorescence quantification and representative image processing.</td></tr><tr><td>KnockOut&amp;trade; Serum Replacement (KOSR)</td><td>Thermo Fisher Scientific</td><td>10828028</td><td>Used in the preparation of freezing medium.</td></tr><tr><td>Laminin-521</td><td>STEMCELL Technologies</td><td>200-0117</td><td>Optional troubleshooting reagent only. Not part of the standard coating protocol; may be used as an alternative or double-coating matrix if neuronal detachment persists.</td></tr><tr><td>Liquid nitrogen dewar</td><td>Thermo Fisher Scientific</td><td>Locator 6 Plus or equivalent</td><td>Long-term storage of frozen hiPSCs in vapor-phase or liquid nitrogen according to institutional cryogenic safety procedures.</td></tr><tr><td>Mr. Frosty&amp;trade; Freezing Container</td><td>Thermo Fisher Scientific</td><td>5100-0001</td><td>For controlled-rate freezing of cells at -80 &amp;deg;C.</td></tr><tr><td>mTeSR&amp;trade; Plus</td><td>STEMCELL Technologies</td><td>100-0276</td><td>Feeder-free maintenance medium for hiPSCs.</td></tr><tr><td>Neuro-induction medium</td><td>STEMCELL Technologies</td><td>08582</td><td>Commercial neuro-induction medium used for early neuronal induction.</td></tr><tr><td>Neuro-maturation base medium (BrainPhys&amp;trade; Neuronal Medium)</td><td>STEMCELL Technologies</td><td>05790</td><td>Base medium for neuronal maturation; supplement with BDNF, GDNF, NT-3, doxycycline, and PluriSln-1 as described in the protocol.</td></tr><tr><td>NT-3 (Neurotrophic Factor 3)</td><td>STEMCELL Technologies</td><td>78074</td><td>Recombinant human protein for neuronal maturation; prepare according to manufacturer instructions and use at 10 ng/mL final concentration.</td></tr><tr><td>P3 Primary Cell 4D-Nucleofector&amp;trade; X Kit</td><td>Lonza</td><td>V4XP-3024</td><td>Kit containing Solution P3 and cuvettes for hiPSC nucleofection.</td></tr><tr><td>Penicillin-Streptomycin (10,000 U/mL)</td><td>Thermo Fisher Scientific</td><td>15140122</td><td>Optional antibiotic to reduce bacterial contamination risk.</td></tr><tr><td>Plasmocin&amp;trade; prophylactic</td><td>InvivoGen</td><td>ant-mpp</td><td>Optional antibiotic to prevent mycoplasma contamination.</td></tr><tr><td>PluriSIn-1</td><td>STEMCELL Technologies</td><td>72822</td><td>Pluripotent cell survival inhibitor to eliminate undifferentiated hiPSCs; prepare stock according to manufacturer instructions and use at 20 &amp;micro;M final concentration.</td></tr><tr><td>Puromycin Dihydrochloride</td><td>Thermo Fisher Scientific</td><td>A1113803</td><td>Antibiotic used for selection; prepare sterile stock solution, aliquot, store frozen, and determine final working concentration by kill curve, typically 0.4&amp;ndash;0.6 &amp;micro;g/mL.</td></tr><tr><td>pX330-U6-Chimeric_BB-CBh-hSpCas9 AAVS1 gRNA plasmid</td><td>Addgene</td><td>85802</td><td>CRISPR/Cas9 plasmid used for AAVS1 targeting; include the AAVS1 gRNA sequence in the plasmid map or supplementary information.</td></tr><tr><td>qPCR analysis software</td><td>Applied Biosystems / Thermo Fisher Scientific</td><td>QuantStudio Design &amp;amp; Analysis Software or equivalent</td><td>For Ct extraction and RT-qPCR analysis; report software version used.</td></tr><tr><td>qPCR master mix</td><td>Thermo Fisher Scientific</td><td>PowerUp SYBR Green Master Mix, A25742</td><td>For RT-qPCR quantification of neuronal and GABAergic markers.</td></tr><tr><td>qPCR primers: DLX1</td><td>Custom oligonucleotides</td><td>Sequence provided in comments</td><td>Forward: 5&#039; ATGCACTGTTTACACTCGGC 3&#039;; Reverse: 5&#039; GACTGCACCGAACTGATGTAG 3&#039;. Used to assess GABAergic lineage induction at Day 21.</td></tr><tr><td>qPCR primers: GAD2</td><td>Custom oligonucleotides</td><td>Sequence provided in comments</td><td>Forward: 5&#039; TGGCGTTTCTGCAAGATGTTA 3&#039;; Reverse:5&#039; TTGGTCTGCCAATTCCCAATTAT 3&#039;. GABAergic neuron marker.</td></tr><tr><td>qPCR primers: GAD67</td><td>Custom oligonucleotides</td><td>Sequence provided in comments</td><td>Forward: 5&#039; GCTTCCGGCTAAGAACGGT 3&#039;; Reverse: 5&#039; TTGCGGACATAGTTGAGGAGT 3&#039;. GABAergic neuron marker.</td></tr><tr><td>qPCR primers: RPLP0</td><td>Custom oligonucleotides</td><td>Sequence to be provided</td><td>Reference gene primers for &amp;Delta;&amp;Delta;Ct normalization. Primer sequences should be listed in the table or supplementary information. Forward: 5&#039; AGCCCAGAACACTGGTCTC 3&#039;; Reverse: 5&#039; ACTCAGGATTTCAATGGTGCC 3&#039;.</td></tr><tr><td>qPCR primers: SLC17A6</td><td>Custom oligonucleotides</td><td>Sequence provided in comments</td><td>Forward: 5&#039; GGGAGACAATCGAGCTGACG 3&#039;; Reverse: 5&#039;TGCAGCGGATACCGAAGGA3&#039;. Glutamatergic neuron marker.</td></tr><tr><td>qPCR primers: SLC17A7</td><td>Custom oligonucleotides</td><td>Sequence provided in comments</td><td>Forward: 5&#039; CAGAGTTTTCGGCTTTGCTATTG 3&#039;; Reverse: 5&#039; GCGACTCCGTTCTAAGGGTG 3&#039;. Glutamatergic neuron marker.</td></tr><tr><td>ReLeSR&amp;trade;</td><td>STEMCELL Technologies</td><td>100-0484</td><td>Enzyme-free reagent for dissociation and passaging of hiPSCs.</td></tr><tr><td>Reverse-transcription kit</td><td>Thermo Fisher Scientific</td><td>SuperScript IV VILO Master Mix, 11756050</td><td>For cDNA synthesis prior to RT-qPCR.</td></tr><tr><td>RNA extraction kit</td><td>QIAGEN</td><td>RNeasy Kit (74104)</td><td>Kit used for total RNA extraction before RT-qPCR. Record the exact RNeasy kit format and catalog number used in the final Materials table.</td></tr><tr><td>Statistical software</td><td>GraphPad Software</td><td>GraphPad Prism, version 11</td><td>For graphing and statistical analysis of RT-qPCR data.</td></tr><tr><td>Trypan Blue Solution (0.4%)</td><td>Thermo Fisher Scientific</td><td>15250061</td><td>Vital stain used to assess cell viability during counting.</td></tr><tr><td>Y-27632 (ROCK Inhibitor)</td><td>STEMCELL Technologies</td><td>72302</td><td>Used at 10 &amp;micro;M final concentration to improve survival during passaging and nucleofection.</td></tr></tbody></table>

generation of gabaergic neurons from human induced pluripotent stem cells using doxycycline-inducible ascl1/dlx2 expression at aavs1

Generation of GABAergic Neurons from Human Induced Pluripotent Stem Cells Using Doxycycline-Inducible ASCL1/DLX2 Expression at AAVS1

Human induced pluripotent stem cells (hiPSCs) offer an unprecedented opportunity to model human neurological diseases in vitro. Reliable generation of defined neuronal populations, such as gamma-aminobutyric acid (GABAergic) neurons, is essential for these studies. This protocol details a robust method for differentiating hiPSCs into GABAergic neurons using a doxycycline-inducible system. The approach relies on the stable integration of transgenes encoding the transcription factors ASCL1 and DLX2 into the safe-harbor adeno-associated virus integration site 1 (AAVS1.) locus via CRISPR/Cas9-mediated knock-in. This targeted integration avoids the transgene silencing often observed with random lentiviral integration. The protocol covers the maintenance of hiPSCs, the nucleofection process for transgene integration, puromycin selection to enrich successfully engineered cells, and the step-by-step differentiation procedure. Upon induction with doxycycline, the engineered hiPSCs rapidly exit the cell cycle, acquire neuronal morphology, and express GABAergic lineage markers within 21 days. Key steps include neuro-induction and subsequent maturation using specific growth factors, as well as potential approaches to improve cellular adhesion during maturation. This standardized method yields enriched populations of induced neurons expressing GABAergic lineage markers, providing a valuable tool for neuroscience research and cellular modeling.

Successful application of this protocol results in an enriched population of induced neurons with GABAergic molecular features. The strategy is based on targeted insertion of a doxycycline-inducible ASCL1-P2A-DLX2 cassette into the AAVS1 locus (Figure 1A). Following selection of engineered hiPSCs, doxycycline induction is used to drive GABAergic neuronal differentiation, as outlined in the timeline shown in Figure 1B. Following nucleof...

This protocol describes a method for generating GABAergic neurons from human induced pluripotent stem cells by integrating doxycycline-inducible transgenes into the AAVS1. safe harbor locus. The stable, homogeneous transgene expression provides an efficient approach for direct differentiation into GABAergic neurons while limiting transgene silencing, a common issue with lentiviral approaches.

Human induced pluripotent stem cells (hiPSCs) offer an unprecedented opportunity to model human neurological diseases in vitro. Reliable generation of ...

generation-gabaergic-neurons-from-human-induced-pluripotent-stem

Research

JoVE Journal

Neuroscience

The Stemgent Dox Inducible Mouse TF Lentivirus Set can reprogram mouse embryonic fibroblasts (MEFs) to induced pluripotent stem (iPS) cells.  Here we demonstrate the protocol for DOX-inducible expression of mouse reprogramming transcription factors Oct4, Sox2, Klf4 and c-Myc to generate iPS colonies that express common mES pluripotency markers.

Generation of Induced Pluripotent Stem Cells by Reprogramming Mouse Embryonic Fibroblasts with a Four Transcription Factor, Doxycycline Inducible Lentiviral Transduction System

We have established a protocol for induction of neuroblasts direct from pluripotent human embryonic stem cells maintained under defined conditions with small molecules, which enables derivation of a large supply of human neuronal progenitors and neuronal cell types in the developing CNS for neural repair.

Efficient Derivation of Human Neuronal Progenitors and Neurons from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

This video demonstrates the process of differentiating embryoid bodies (EBs) into neuroepithelial aggregates and their subsequent division into neuronal and glial cells. This method allows the efficient generation of neuronal and glial cells in vitro, which serve as test systems for toxicity testing as well as assessment of different pathways involved in neurotoxicity.

Generating Neurons and Glial Cells from Human Induced Pluripotent Stem Cell-Derived Embryoid Bodies

This video demonstrates the process of inducing human pluripotent stem cells to differentiate into neurons by transfecting them with engineered lentiviruses carrying a neurogenic transcription factor gene under the control of  tetracycline-responsive element, followed by treatment with a tetracycline derivative and maturation medium.

Human Pluripotent Stem Cell Differentiation in Neurons Using Engineered Lentiviruses

This procedure yields telencephalic neurons by going through checkpoints which are similar to those observed during human development. The cells are allowed to spontaneously differentiate, are exposed to factors which push them towards the neural lineage, are isolated, and are plated onto coverslips to allow for terminal differentiation and maturation.

The Specification of Telencephalic Glutamatergic Neurons from Human Pluripotent Stem Cells

This procedure shows how to target interneurons in the developing mouse forebrain by means of in utero electroporation. This technique was particularly efficient to achieve selective gene expression in interneuron subtypes destined to the superficial layers of the cortex.

Subtype-selective Electroporation of Cortical Interneurons

We, based on knowledge from developmental biology and published research, developed an optimized protocol to efficiently generate A9 midbrain dopaminergic neurons from both human embryonic stem cells and human induced pluripotent stem cells, which would be useful for disease modeling and cell replacement therapy for Parkinson’s disease.

Directed Dopaminergic Neuron Differentiation from Human Pluripotent Stem Cells

Modeling human brain development has been hindered due to the unprecedented complexity of neural epithelial tissue. Here, a method for the robust generation of brain organoids to delineate early events of human brain development and to model microcephaly in vitro is described.

Generation of iPSC-derived Human Brain Organoids to Model Early Neurodevelopmental Disorders

This protocol describes a method for generating cortical interneuron progenitors and post-mitotic interneuron precursors from mouse embryonic stem cells using a modified embryoid body-to-monolayer method. These progenitors/precursors can be used in vitro or fluorescently sorted and transplanted into neonatal neocortex for studying fate determination, or used in therapeutic applications.

Differentiation of Mouse Embryonic Stem Cells into Cortical Interneuron Precursors

The neuron-glial interactions in neurodegeneration are not well understood due to inadequate tools and methods. Here, we describe optimized protocols to obtain induced neurons, oligodendrocyte precursor cells, and oligodendrocytes from human pluripotent stem cells and provide examples of the values of these methods in understanding cell-type-specific contributions in Alzheimer’s disease.

Generation of Human Neurons and Oligodendrocytes from Pluripotent Stem Cells for Modeling Neuron-Oligodendrocyte Interactions

Transplantation of human pluripotent stem cell-derived GABAergic neurons generated by neuronal programming could be a potential treatment approach for neurodevelopmental disorders. This protocol describes the generation and transplantation of human stem cell-derived GABAergic neuronal precursors into the brains of neonatal mice, allowing long-term investigation of grafted neurons and evaluation of their therapeutic potential.

Transplantation of Human Stem Cell-Derived GABAergic Neurons into the Early Postnatal Mouse Hippocampus to Mitigate Neurodevelopmental Disorders

Learn CRISPR/Cas9-mediated knock-in of ASCL1/DLX2 at AAVS1 using doxycycline-inducible expression in hiPSCs. This protocol enables efficient generation of GABAergic neurons for neurological disease modeling.

Generation of GABAergic Neurons from Human Induced Pluripotent Stem Cells Using Doxycycline-Inducible ASCL1/DLX2 Expression at AAVS1 (Video) | JoVE Journal

Generation of GABAergic Neurons from Human Induced Pluripotent Stem Cells Using Doxycycline-Inducible ASCL1/DLX2 Expression at AAVS1

Explore More Videos