Generation of GABAergic Neurons from Human Induced Pluripotent Stem Cells Using Doxycycline-Inducible ASCL1/DLX2 Expression at AAVS1

Summary

This protocol describes a method for generating GABAergic neurons from human induced pluripotent stem cells by integrating doxycycline-inducible transgenes into the AAVS1. safe harbor locus. The stable, homogeneous transgene expression provides an efficient approach for direct differentiation into GABAergic neurons while limiting transgene silencing, a common issue with lentiviral approaches.

Abstract

Human induced pluripotent stem cells (hiPSCs) offer an unprecedented opportunity to model human neurological diseases in vitro. Reliable generation of defined neuronal populations, such as gamma-aminobutyric acid (GABAergic) neurons, is essential for these studies. This protocol details a robust method for differentiating hiPSCs into GABAergic neurons using a doxycycline-inducible system. The approach relies on the stable integration of transgenes encoding the transcription factors ASCL1 and DLX2 into the safe-harbor adeno-associated virus integration site 1 (AAVS1.) locus via CRISPR/Cas9-mediated knock-in. This targeted integration avoids the transgene silencing often observed with random lentiviral integration. The protocol covers the maintenance of hiPSCs, the nucleofection process for transgene integration, puromycin selection to enrich successfully engineered cells, and the step-by-step differentiation procedure. Upon induction with doxycycline, the engineered hiPSCs rapidly exit the cell cycle, acquire neuronal morphology, and express GABAergic lineage markers within 21 days. Key steps include neuro-induction and subsequent maturation using specific growth factors, as well as potential approaches to improve cellular adhesion during maturation. This standardized method yields enriched populations of induced neurons expressing GABAergic lineage markers, providing a valuable tool for neuroscience research and cellular modeling.

Introduction

Human induced pluripotent stem cells (hiPSCs) provide a unique platform to model human neurological diseases in vitro. and to investigate the complex molecular mechanisms that drive development and degeneration¹. This technology enables the generation of patient-specific cellular models to investigate a wide array of conditions, ranging from early neurodevelopmental anomalies in syndromic ciliopathies² to subtle epigenomic alterations observed in sporadic Alzheimer's disease³. Consequently, directed differentiation of hiPSCs has become a cornerstone of modern molecular neuroscience.

To effectively capture the nuances of human neurological processes, generating highly specific and pure neuronal subtypes is essential. For example, defined neuronal populations are required to elucidate the specific transcriptional roles of proteins like MECP2 in human neurons⁴, or to assess the targeted vulnerabilities of peripheral sensory neurons to viral infections, such as SARS-CoV-2⁵. Furthermore, constructing complex, physiologically relevant microenvironments, like incorporating functional microglia into 3D cerebral organoids, relies fundamentally on the robust, predictable generation of distinct neural and glial lineages⁶. Among these subtypes, GABAergic neurons are of particular interest due to their crucial inhibitory role in the central nervous system and their implication in various neurological and psychiatric disorders⁷. The overall goal of this method is to provide a reliable, efficient, and reproducible protocol for the directed differentiation of hiPSCs into induced neurons expressing GABAergic lineage markers. Traditional directed differentiation protocols for GABAergic neurons, which rely on extrinsic signaling molecules, can be time-consuming, highly variable, and result in heterogeneous cell populations⁸.

To overcome these limitations, transcription factor-mediated forward programming has emerged as a powerful alternative⁹. This protocol uses a doxycycline-inducible expression system to drive expression of the proneural transcription factors ASCL1 and DLX2¹⁰. By targeting these transgenes to the adeno-associated virus integration site 1 (AAVS1.) safe-harbor locus using CRISPR/Cas9, this method circumvents the common issue of transgene silencing associated with random lentiviral integration¹⁰. The donor construct includes a fluorescent reporter, such as mCherry, to monitor transgene-positive cells after selection. This strategy is intended to support more homogeneous transgene expression than random integration approaches, although expression stability and differentiation reproducibility should be validated for each engineered line. This standardized method generates enriched populations of induced neurons expressing GABAergic lineage markers in approximately 21 days, a timeframe shorter than that of traditional small-molecule approaches^8,10. This protocol is highly appropriate for researchers who require scalable, consistent neuronal populations for downstream applications such as high-content microscopy, single-cell transcriptomics, or functional physiological assays.

Protocol

CAUTION: Human hiPSC cultures should be handled as potentially biohazardous material under institutional biosafety procedures. Perform all human hiPSC culture procedures in a certified Class II biological safety cabinet using sterile technique. All waste containing human cells, media exposed to human cells, and CRISPR/Cas9 plasmid material should be decontaminated in accordance with local biosafety guidelines before disposal. Doxycycline, puromycin, DMSO, and other chemical reagents should be handled with gloves and appropriate eye and skin protection, and waste should be discarded according to institutional chemical-waste procedures. Basement membrane extract (BME) should be handled using sterile technique and stored on ice before use to prevent premature polymerization. Liquid nitrogen storage and cryovial handling should be performed with appropriate cryogenic gloves, face protection, and caution to avoid cold burns or vial explosion during thawing.

NOTE: Before CRISPR/Cas9-mediated editing and neuronal differentiation, hiPSC cultures should meet predefined quality-control criteria. Cells must be confirmed negative for mycoplasma, display a normal karyotype or acceptable genomic integrity profile, and maintain robust expression of pluripotency markers, including OCT4, SOX2, NANOG, TRA-1-60, and/or SSEA4. Cultures should exhibit typical compact hiPSC colony morphology, with a high nuclear-to-cytoplasmic ratio, defined colony borders, and minimal spontaneous differentiation. Only actively proliferating cultures within the recommended passage range should be used, and cells should not exceed the laboratory-defined maximum passage number, typically below passage 40, unless otherwise validated. Cultures showing abnormal morphology, excessive spontaneous differentiation, poor growth, confirmed contamination, or evidence of genomic instability should be excluded from editing and differentiation experiments. All materials required for this protocol, including media recipes, are listed in the Table of Materials.

1. Preparation of reagents and culture plates

1. Prepare the freezing medium by combining 40 mL of knock-out serum replacement (KOSR) and 10 mL of dimethyl sulfoxide (DMSO) in a 50 mL conical tube.
2. Homogenize the freezing medium by pipetting up and down 10 times. Store the solution at 4 °C for up to 1 month.
3. Dilute the basement membrane extract (BME) in Dulbecco's Modified Eagle Medium/F12 (DMEM/F12) medium at a final concentration of 80 µg/mL.
   NOTE: Before dilution, verify the concentration of the received BME solution using the lot number on the vendor's website.
4. Add 1 mL of the diluted BME per well to a 6-well plate. Immediately return the stock BME to 4 °C for up to 1 month.
5. Tilt the plate to distribute the solution evenly across the entire surface of the wells. Ensure there are no uncoated areas.
6. Incubate the plate for a minimum of 30 min at 37 °C before use.
   NOTE: There is no maximum incubation time. If incubating for more than 1 day, ensure that the DMEM/F-12 does not evaporate. The BME solution used for one well can be reused only once to coat a second well. Manipulation of BME at room temperature should be brief due to its rapid polymerization.

2. Maintenance and passaging of hiPSCs

NOTE: In this protocol, hiPSC maintenance medium refers to mTeSR plus. mTeSR plus is the recommended medium for routine maintenance, passaging, recovery after nucleofection, and puromycin selection.

1. Perform hiPSC passaging approximately every 4–6 days when the cells reach 60% confluence.
2. Aspirate the culture medium from the wells using an aspirating pipette.
3. Add 1 mL of ReLeSR to the well and incubate for 30 s at room temperature.
4. Aspirate the dissociation reagent and incubate the plate for 8 min at 37 °C.
5. Gently add 1 mL of hiPSC maintenance medium using a 5 mL pipette. Collect the cell suspension in a 50 mL tube.
6. Mix 10 µL of the cell suspension with 10 µL of trypan blue in a microcentrifuge tube. Load 10 µL of the mixture onto a cell counter slide to determine the viable cell concentration.
7. Aspirate the BME coating from a previously prepared well. Add 2 mL of hiPSC maintenance medium supplemented with Rho-associated coiled-coil kinase (ROCK) inhibitor (Y-27632; 10 μM final).
8. Seed 100,000 hiPSCs into the well, aiming for a >90% viability. Move the plate in a figure-eight motion to ensure a homogeneous distribution of cells.
9. Incubate the cells at 37 °C with 5% CO₂.
10. After 24 h, replace the medium with 2 mL of fresh mTeSR plus medium without ROCK inhibitor.
    NOTE: A transient change in cell morphology (cell elongation) is expected in the presence of the ROCK inhibitor. Verify that cells regain their characteristic morphology after their removal.

3. Nucleofection of hiPSCs

1. Pass the cells when the confluence reaches around 60%.
   NOTE: In this protocol, approximately 60% confluence corresponds to actively growing hiPSC colonies covering slightly more than half of the well surface, with visible space between colonies and minimal spontaneous differentiation. Colonies should not be overgrown, extensively merged, or exhibit dense, multilayered centers at the time of nucleofection.
2. Ensure the nucleofection device is turned on and the nucleofection supplement is added to the nucleofection solution P3. Prepare an ice bucket.
3. Add 110 µL of the nucleofection solution P3 to a microcentrifuge tube placed on ice.
4. Add 1 µg of the CRISPR/Cas9 plasmid and 1 µg of the donor plasmid containing the doxycycline-inducible ASCL1-P2A-DLX2. cassette, fluorescent reporter, and puromycin-resistance cassette to the tube. Mix gently without introducing bubbles.
5. Prepare the destination plate by aspirating the BME from two coated wells. Add 2 mL of hiPSC maintenance medium containing a ROCK inhibitor to each well, and incubate the plate at 37 °C.
6. Dissociate hiPSCs at 60% confluence from a well of a 6-well plate as described in steps 2.2 to 2.5. Transfer the suspension to a sterile tube and centrifuge for 5 min at 500 x g. at room temperature.
7. Discard the supernatant and resuspend the cell pellet in the 110 µL of nucleofection solution P3 containing the plasmids. Pipette gently to avoid bubble formation.
8. Transfer 100 µL of the cell suspension into a nucleofection cuvette placed on ice.
9. Insert the cuvette into the nucleofector device and run the CB-150 program for hiPSCs.
10. Immediately retrieve the cells using a plastic Pasteur pipette. Transfer equal volumes of the cell suspension into the two previously prepared wells.
11. Distribute the cells using a figure-eight motion and incubate at 37 °C.
12. After 24 h, replace the medium with mTeSR plus medium lacking ROCK inhibitor. Verify nucleofection efficiency by observing fluorescence if applicable.

4. Antibiotic selection

CAUTION: Puromycin is toxic. Handle with appropriate personal protective equipment and dispose of waste in accordance with institutional guidelines.

NOTE: Before selecting edited hiPSCs, determine the optimal puromycin concentration for each hiPSC line. Seed unedited hiPSCs at 100,000 cells per well in a BME-coated 6-well plate in hiPSC maintenance medium supplemented with ROCK inhibitor. After 24 h, replace the medium with fresh hiPSC maintenance medium containing puromycin at 0, 0.2, 0.4, 0.6, 0.8, 1.0, and 1.5 µg/mL. Replace puromycin-containing medium daily and monitor cell morphology and survival by brightfield microscopy for 5 days. The selected concentration should eliminate all unedited hiPSCs within 3–5 days while minimizing excessive toxicity. In this protocol, the optimal puromycin concentration is typically 0.4–0.6 µg/mL.

1. Wait for 3 passages post-nucleofection, typically approximately 1–2 weeks depending on recovery and growth rate, to allow for the loss of non-integrated plasmids before initiating selection.
2. Perform a cell passage and seed 100,000 cells per well.
3. After 24 h, add puromycin at the concentration determined by the kill curve, typically 0.4–0.6 µg/mL. 
4. Maintain the puromycin selection for the predetermined duration, generally about 5 days.
5. Validate the selected population by fluorescence microscopy or flow cytometry to estimate the proportion of reporter-positive cells.
   NOTE: Proceed only with pooled populations showing broadly homogeneous reporter expression, ideally >80–90% reporter-positive cells. If reporter expression remains mosaic, extend selection, repeat enrichment, or consider clonal isolation before differentiation.
6. Confirm correct AAVS1. targeting by junction PCR before initiating neuronal differentiation.
7. When rigorous validation is required, verify PCR products by Sanger sequencing and assess transgene copy number by qPCR, ddPCR, or another appropriate copy-number assay.
8. Evaluate random integration using PCR-based assays for plasmid backbone sequences or broader genome-wide integration analysis, depending on the intended downstream application.
9. Confirm that the selected hiPSC population remains mycoplasma-negative, retains typical hiPSC colony morphology, and maintains robust growth after puromycin selection.
10. Reassess genomic integrity by karyotyping, SNP array, or another validated assay, particularly when edited cells will be used for disease modeling, functional assays, or long-term studies.
11. Assess potential CRISPR/Cas9 off-target effects by targeted sequencing of predicted off-target sites or, when required, broader genomic approaches.
    NOTE: Do not use cultures for differentiation if they show abnormal morphology, poor recovery after selection, persistent mosaic reporter expression, confirmed genomic abnormalities, or failed AAVS1 integration. In this protocol, selected engineered hiPSCs are used as a pooled population and can be cryopreserved before doxycycline induction, once reporter expression, AAVS1. targeting, morphology, and growth have been validated. Cryopreservation after doxycycline induction or during neuronal maturation is not part of the standard workflow and should be empirically validated before use.

5. Differentiation into GABAergic neurons

1. Prepare the necessary number of BME-coated wells. Note that one well seeded on Day 0 will yield one well of GABAergic neurons.
2. Prepare 6.9 mL of neuro-induction medium per well, supplementing it with doxycycline (1 µg/mL). Include a 15% excess volume to account for evaporation or pipetting errors.
   NOTE: Doxycycline is used at a final concentration of 1 µg/mL, starting on Day 0, and maintained throughout differentiation and maturation. Fresh doxycycline-containing medium is prepared at each medium change to maintain consistent transgene induction. This dose was selected because it produced robust reporter expression and efficient neuronal conversion in our hands. A formal doxycycline dose-response was not performed in this protocol; therefore, laboratories adapting the method may empirically test 0.1–2 µg/mL doxycycline if transgene induction appears suboptimal.
3. On Day 0, dissociate the engineered hiPSCs and seed 200,000 cells into the prepared BME-coated wells. Incubate at 37 °C.
4. On Days 1, 2, and 3, aspirate the medium and add 2 mL of fresh neuro-induction medium containing doxycycline.
   NOTE: By Day 3, cell expansion should markedly decrease, and dendritic-like structures may begin to appear. If experimental confirmation of cell-cycle exit is required, Ki-67 immunostaining or EdU/BrdU incorporation can be performed at Day 3–4.
5. On Day 4, prepare neuro-maturation medium containing brain-derived neurotrophic factor (BDNF), glial cell line-derived neurotrophic factor (GDNF), and neurotrophin-3 (NT-3), each at a final concentration of 10 ng/mL, doxycycline at 1 µg/mL, and PluriSln at 20 µM.
6. Aspirate the neuro-induction medium. Carefully add 2 mL of the neuro-maturation medium drop-by-drop along the wall of the well to avoid disturbing the newly formed neurons.
7. On Day 7, aspirate the medium and gently add 2 mL of neuro-maturation medium containing the neurotrophins and doxycycline, but omitting the pluripotent cell survival inhibitor.
8. For long-term maintenance, replace the neuro-maturation medium completely every 3 to 4 days, adapting the frequency based on cell density.
   NOTE: Day 21 is the standard endpoint for assessing GABAergic neuronal identity. By Day 21, cells should display GABAergic neuronal features, including DLX1 .expression, and continue to mature their axonal networks. A seeding density of 200,000 cells/well was empirically selected to produce well-spaced colonies while avoiding overcrowding and maturation-associated cell death. Densities of 150,000–300,000 cells/well are compatible, with lower densities preferred for morphology and higher densities for material recovery. To reduce detachment, perform more frequent half-medium changes using a 1,000 µL pipette at low flow without tilting the plate. If needed, cells may be replated once after the 3-day doxycycline induction, before the addition of maturation medium, using enhanced coatings such as poly-L-lysine/laminin or laminin-521. Further passaging after maturation begins should be avoided.
9. Cultures may be maintained beyond Day 21 for extended maturation if networks remain attached, viable, and free of proliferating hiPSC-like colonies. After Day 21, perform half-medium changes every 3–4 days with fresh neuro-maturation medium containing doxycycline and neurotrophic factors.
   NOTE: Use cultures for downstream assays once neuronal morphology and neurite networks are stable, detachment is minimal, and no undifferentiated colonies are visible. In our hands, cultures are typically used between Day 21 and Day 35.

Results

Successful application of this protocol results in an enriched population of induced neurons with GABAergic molecular features. The strategy is based on targeted insertion of a doxycycline-inducible ASCL1-P2A-DLX2 cassette into the AAVS1 locus (Figure 1A). Following selection of engineered hiPSCs, doxycycline induction is used to drive GABAergic neuronal differentiation, as outlined in the timeline shown in Figure 1B. Following nucleof...

Discussion

The successful generation of GABAergic neurons relies heavily on several critical steps within this protocol. Maintaining high-quality, undifferentiated hiPSCs is paramount; spontaneous differentiation prior to nucleofection drastically reduces integration efficiency and downstream neuronal purity⁸. Furthermore, precise determination of the puromycin kill curve is essential to ensure complete elimination of non-integrated cells without undue stress on properly engineered clones. During the differe...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
4D-Nucleofector™ Core Unit	Lonza	AAF-1002B	For electroporation/nucleofection of hiPSCs.
6-well culture plates	Sarstedt	83.3920300	Tissue culture-treated plates for hiPSC maintenance and differentiation.
BDNF (Brain-Derived Neurotrophic Factor)	STEMCELL Technologies	78005	Recombinant human protein for neuronal maturation; prepare according to manufacturer instructions and use at 10 ng/mL final concentration.
Cell counter (Countess)	Thermo Fisher Scientific	C10283	Used for cell counting.
Centrifuge	VWR	76468-134	For cell pelleting.
CO2 incubator	Thermo Fisher Scientific	Heracell VIOS 160i or equivalent	Cell culture incubator maintaining 37 °C, humidified atmosphere, and 5% CO2.
Cryotubes	Thermo Fisher Scientific	5000-0020	Sterile cryogenic vials for freezing hiPSCs; equivalent externally threaded 1.8–2.0 mL cryovials may be used.
Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract	Bio-Techne	BME001-05	Standard BME coating matrix used in the protocol. Verify the lot-specific stock concentration from the Bio-Techne certificate of analysis and dilute in DMEM/F-12 to 80 µg/mL working concentration.
DMEM/F-12	Wisent	319-090-CL	Basal medium used for diluting BME.
DMSO (Dimethyl sulfoxide)	Sigma-Aldrich	D2650	Cryoprotectant used in the preparation of freezing medium.
Donor plasmid: inducible ASCL1-P2A-DLX2 AAVS1 targeting cassette	Custom plasmid	Addgene accession pending	Custom AAVS1 donor plasmid containing doxycycline-inducible ASCL1-P2A-DLX2 cassette and selection/reporter elements. Provide plasmid map and full sequence as supplementary file or upon request.
Doxycycline hyclate	Sigma-Aldrich	D9891	Used to induce ASCL1-P2A-DLX2 expression. Prepare sterile stock solution, aliquot, protect from light, store frozen, and use at 1 µg/mL final concentration.
Ethanol (70%)	Commercial Alcohols / Greenfield Global	P016EAAN	For sterilization inside the biological safety cabinet; use institutional approved 70% ethanol or equivalent.
Fluorescence microscope	ECHO	Revolve R4	Microscope used for phase-contrast and fluorescence imaging of reporter expression and neuronal morphology.
GDNF (Glial-Derived Neurotrophic Factor)	STEMCELL Technologies	78058	Recombinant human protein for neuronal maturation; prepare according to manufacturer instructions and use at 10 ng/mL final concentration.
hiPSC line PGP1	EditCo Bio	PGP1 human iPSC line	Commercially available open-consent human iPSC line used in this protocol; record passage number and QC status before editing and differentiation.
Image-analysis software	ImageJ/Fiji	Open-source; version used should be reported	For fluorescence quantification and representative image processing.
KnockOut™ Serum Replacement (KOSR)	Thermo Fisher Scientific	10828028	Used in the preparation of freezing medium.
Laminin-521	STEMCELL Technologies	200-0117	Optional troubleshooting reagent only. Not part of the standard coating protocol; may be used as an alternative or double-coating matrix if neuronal detachment persists.
Liquid nitrogen dewar	Thermo Fisher Scientific	Locator 6 Plus or equivalent	Long-term storage of frozen hiPSCs in vapor-phase or liquid nitrogen according to institutional cryogenic safety procedures.
Mr. Frosty™ Freezing Container	Thermo Fisher Scientific	5100-0001	For controlled-rate freezing of cells at -80 °C.
mTeSR™ Plus	STEMCELL Technologies	100-0276	Feeder-free maintenance medium for hiPSCs.
Neuro-induction medium	STEMCELL Technologies	08582	Commercial neuro-induction medium used for early neuronal induction.
Neuro-maturation base medium (BrainPhys™ Neuronal Medium)	STEMCELL Technologies	05790	Base medium for neuronal maturation; supplement with BDNF, GDNF, NT-3, doxycycline, and PluriSln-1 as described in the protocol.
NT-3 (Neurotrophic Factor 3)	STEMCELL Technologies	78074	Recombinant human protein for neuronal maturation; prepare according to manufacturer instructions and use at 10 ng/mL final concentration.
P3 Primary Cell 4D-Nucleofector™ X Kit	Lonza	V4XP-3024	Kit containing Solution P3 and cuvettes for hiPSC nucleofection.
Penicillin-Streptomycin (10,000 U/mL)	Thermo Fisher Scientific	15140122	Optional antibiotic to reduce bacterial contamination risk.
Plasmocin™ prophylactic	InvivoGen	ant-mpp	Optional antibiotic to prevent mycoplasma contamination.
PluriSIn-1	STEMCELL Technologies	72822	Pluripotent cell survival inhibitor to eliminate undifferentiated hiPSCs; prepare stock according to manufacturer instructions and use at 20 µM final concentration.
Puromycin Dihydrochloride	Thermo Fisher Scientific	A1113803	Antibiotic used for selection; prepare sterile stock solution, aliquot, store frozen, and determine final working concentration by kill curve, typically 0.4–0.6 µg/mL.
pX330-U6-Chimeric_BB-CBh-hSpCas9 AAVS1 gRNA plasmid	Addgene	85802	CRISPR/Cas9 plasmid used for AAVS1 targeting; include the AAVS1 gRNA sequence in the plasmid map or supplementary information.
qPCR analysis software	Applied Biosystems / Thermo Fisher Scientific	QuantStudio Design & Analysis Software or equivalent	For Ct extraction and RT-qPCR analysis; report software version used.
qPCR master mix	Thermo Fisher Scientific	PowerUp SYBR Green Master Mix, A25742	For RT-qPCR quantification of neuronal and GABAergic markers.
qPCR primers: DLX1	Custom oligonucleotides	Sequence provided in comments	Forward: 5' ATGCACTGTTTACACTCGGC 3'; Reverse: 5' GACTGCACCGAACTGATGTAG 3'. Used to assess GABAergic lineage induction at Day 21.
qPCR primers: GAD2	Custom oligonucleotides	Sequence provided in comments	Forward: 5' TGGCGTTTCTGCAAGATGTTA 3'; Reverse:5' TTGGTCTGCCAATTCCCAATTAT 3'. GABAergic neuron marker.
qPCR primers: GAD67	Custom oligonucleotides	Sequence provided in comments	Forward: 5' GCTTCCGGCTAAGAACGGT 3'; Reverse: 5' TTGCGGACATAGTTGAGGAGT 3'. GABAergic neuron marker.
qPCR primers: RPLP0	Custom oligonucleotides	Sequence to be provided	Reference gene primers for ΔΔCt normalization. Primer sequences should be listed in the table or supplementary information. Forward: 5' AGCCCAGAACACTGGTCTC 3'; Reverse: 5' ACTCAGGATTTCAATGGTGCC 3'.
qPCR primers: SLC17A6	Custom oligonucleotides	Sequence provided in comments	Forward: 5' GGGAGACAATCGAGCTGACG 3'; Reverse: 5'TGCAGCGGATACCGAAGGA3'. Glutamatergic neuron marker.
qPCR primers: SLC17A7	Custom oligonucleotides	Sequence provided in comments	Forward: 5' CAGAGTTTTCGGCTTTGCTATTG 3'; Reverse: 5' GCGACTCCGTTCTAAGGGTG 3'. Glutamatergic neuron marker.
ReLeSR™	STEMCELL Technologies	100-0484	Enzyme-free reagent for dissociation and passaging of hiPSCs.
Reverse-transcription kit	Thermo Fisher Scientific	SuperScript IV VILO Master Mix, 11756050	For cDNA synthesis prior to RT-qPCR.
RNA extraction kit	QIAGEN	RNeasy Kit (74104)	Kit used for total RNA extraction before RT-qPCR. Record the exact RNeasy kit format and catalog number used in the final Materials table.
Statistical software	GraphPad Software	GraphPad Prism, version 11	For graphing and statistical analysis of RT-qPCR data.
Trypan Blue Solution (0.4%)	Thermo Fisher Scientific	15250061	Vital stain used to assess cell viability during counting.
Y-27632 (ROCK Inhibitor)	STEMCELL Technologies	72302	Used at 10 µM final concentration to improve survival during passaging and nucleofection.