Genetik İfade Profilleri Belirlenmesi C. elegans Mikroarray ve Real-time PCR

Biology
 

Summary

Mikroarray analizi genetik ekspresyon profillerini belirlemek için yapıldı

Cite this Article

Copy Citation | Download Citations

Guthmueller, K. L., Yoder, M. L., Holgado, A. M. Determining Genetic Expression Profiles in C. elegans Using Microarray and Real-time PCR. J. Vis. Exp. (53), e2777, doi:10.3791/2777 (2011).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Sinapslar hedef hücre sinyalizasyon hücre ve postsinaptik terminal presinaptik aktif bir bölge oluşur. Durumda kimyasal sinaps, mesajlar presinaptik terminaller salınan ve postsinaptik hücreleri üzerindeki reseptörler tarafından alınan nörotransmitterler tarafından yapılmaktadır. Caenorhabditis elegans Bizim daha önceki araştırma, olumsuz VSM-1 ekzositoz düzenleyen göstermiştir . Ayrıca, VSM-1 mutant sinaps analizi göstermiştir ki tamamen işlevsel bir VSM-1 artmıştır sinaptik bağlantı yoksun hayvanlar. Bu ön bulgulara dayanarak, hipotez olduğunu C. elegans VSM-1 sinaptogenez önemli bir rol oynayabilir. Bu hipotezi test etmek için, çift etiketli mikroarray analizi yapıldı ve gen ekspresyon profilleri belirlendi. İlk olarak, total RNA izole edildi, ters cDNA transkripsiyonu ve DNA mikrodizilerinin melezleşmiştir. Sonra,-siliko floresan prob hibridizasyon analizi en büyük sperm protein ailesi (MSP) üyeleri kodlayan birçok genin mutant gelişmiş sinaptogenez önemli indüksiyon saptandı. MSP C. sperm en önemli bileşeni elegans ve nematod oosit olgunlaşması ve ovulasyon sinyal görünür. Meyve sinekleri, Chai ve arkadaşları 1 MSP-benzeri moleküller, nöromüsküler kavşakta presinaptik bouton sayısını ve boyutunu düzenleyen olduğunu göstermiştir . Ayrıca, Tsuda ve arkadaşları tarafından yapılan analiz 2 MSP Efesliler reseptörleri ve tetik tirozin kinaz sinyal kaskadlar ligandlar olarak hareket edebilir önerdi. Son olarak, gerçek zamanlı PCR analizi MSP-32 kodlayan gen VSM-1 (ok1468) mutantlar indüklenen olduğunu doğruladı. Birlikte ele alındığında, laboratuvar tarafından yapılan araştırma, VSM-1 mutantlar sinyalizasyon MSP-32 aracılı olabilir sinaptik yoğunluğunda önemli bir artış olduğunu göstermiştir .

Protocol

1. Total RNA izolasyonu

  1. Sağlıklı senkronize nematod, plaka başına 2-3 ml kullanarak, oda sıcaklığı M9 orta tabak yıkama tarafından hasat edildi. Yeniden süspanse nematod, 4 ° C'de santrifüj, 3200 g 4 dakika için 15 ml konik tüpler ve pelet aşağı transfer edildi. Hasat nematod 0.1M NaCl 7 ml ve 7 ml buz% 60 w / v sakaroz pelet resuspending yüzen bakteri temizlendi. Yeniden süspanse karışım sakaroz çözeltisini üzerinden, 4 dakika boyunca karışımı 4 ° C'de 3200 g santrifüj sonra toplandı swim-up, 15 dakika ve temiz nematod için buz üzerinde inkübe edildi. Bakteri-ücretsiz solucanlar steril pipetler kullanarak yeni bir konik tüpüne aktarılır ve 3200 g santrifüj 4 ° C 'de 2 dakika süreyle 15 ml kadar RNaz içermeyen su ile iki kez yıkandı. Temiz gevşek sıkıştırılmış pelet 1,5 ml mikrosantrifüj tüpüne aktarılır ve 30 saniye süreyle maksimum hızda (yaklaşık 10.000 g) santrifüj edildi. Son olarak, en RNaz içermeyen su çıkarıldı ve RNAlater 10 ciltlik pelet eklendi ve 4 saklanan ° C Devam etmek için hazır olana kadar.
  2. Toplam RNA örnekleri hazırlamak için, hasat nematod maksimum hız (yaklaşık 10.000 g) 4 dakika santrifüj edildi ve RNAlater atılmıştır. Sonra, bir tutam Moleküler Taşlama Reçine (biyobilim G) pelet eklendi ve karışım sıvı azot kullanılarak donduruldu. Dondurulmuş solucan süspansiyon havaneli ve sıvı azot ile ince bir toz haline öğütülmüş toz soğuk tutmak için gerekli eklendi. Taşlama sonra, özü, 5 dakika buz üzerinde tutuldu ve daha sonra 700 ul RLT / BME (ratio RLT 100 hacmi: 1 hacim BME) ile karıştırılır (Qiagen) ve 472 ul% 100 etanol.
  3. Total RNA RNeasy Mini Kiti (Qiagen) kullanılarak ve üreticinin tavsiye protokol izole edilmiştir. Izole RNA son hacim başına 60 ul biyolojik örnek oldu.

2. DNA Dijestiyon ve RNA Temizleme

  1. Potansiyel olarak genomik DNA ile kontamine total RNA 50 mg DNaz I (Qiagen) ile sindirilir. 0.1 U DNaz / 1 mg RNA ve 1X Buffer RDP içeren Digest reaksiyonların, oda sıcaklığında 10 dakika inkübe edildi.
  2. RNA örnekleri DNaz ile temizlenmiş RNeasy MinElute Temizlik Kiti (Qiagen) kullanılarak tedavi edildi. Üretici tarafından önerilen protokoller takip edildi ve 60 ul final yıkandı, hacmi elde edildi.

3. RNA Kalitatif ve Kantitatif Analiz

  1. RNA konsantrasyonu UV spektrofotometre Nanodrop (Thermo Scientific) kullanılarak tespit edildi.
  2. RNA örnekleri Bütünlüğü agaroz elektroforez kullanılarak değerlendirilmiştir. Kısaca,% 1 RNaz-agaroz jel 1X Kuzey Max Gly Jel Hazırlık / Tampon Koşu (Ambion),% 1 RNaz ücretsiz Agaroz LE (Ambion) ve 0.5 mg / ml etidyum bromür kullanılarak hazırlanmıştır. Jel polimerize iken, RNA örnekleri Boya / numune ve kuluçka örnekleri yükleme 50 ° C'de 30 dakika süreyle Glyoxyl Örnek 5 ul ekleyerek glyoxylated. RNA merdiven glyoxylated ve boyut karşılaştırması için yüklenmişti.

4. cDNA sentezi

  1. Her sentez reaksiyon için, 8.4 mikrogram RNA örnek 1 ul RT astar (1 pmole / ml) ile karıştırıldı. Bir örnek (WT ya da mutant) Cy5 yakalama RT astar aldı; diğer örnek Cy3 yakalama RT astar (Array 350 Etiketleme-Algılama Takımı, Genisphere) aldı. Örnek karışımları 75-80 ısıtmalı ° C'de 10 dakika ve 2-3 dakika buz transfer edildi.
  2. RNA örnekleri inkübe Mastermix (Genisphere) aşağıdaki gibi hazırlanmıştır: Her RT reaksiyon için, RT 4 ul 5X Reaksiyon Tamponu, 1 ul dNTP (10 mM her dATP dCTP, dGTP, dTTP), 1 ul Superase kombine -RNaz İnhibitör (Array 350 Etiketleme-Algılama Takımı, Genisphere), 1 ul RT Enzim (200 u / ml). Son 7 ul Mastermix, hafifçe karıştırılır, her bir RNA örnek eklendi (vorteks) ve 42 az 2 saat inkübe ° C

5. RNA bozunması ve cDNA Örnekleri saflaştırılması

  1. cDNA sentezi 3.5 ul 0.5M NaOH/50mM EDTA (son konsantrasyon) ekleyerek durdu ve 65 ° C'de 15 dakika inkübe edildi. Daha sonra, tepkiler nihai konsantrasyonu 850 mM Tris-HCl ulaşmak için 1M Tris-HCl, pH 8.0 ile nötralize edildi. Son olarak, WT ve mutant cDNAs bir mikrosantrifüj tüp içine kombine edilmiştir. Boş tüp 73 ul 1X TE tampon ile durulanır ve cDNA içeren tüp ekledi; kombine cDNAs tüpün son hacmi 130 ul.
  2. Karışık cDNA aşağıdaki üretici protokol ve QIAquick PCR Arıtma Kiti (Qiagen) saflaştırılmış oldu. CDNA saflaştırılmış çıkan yıkandı, hacmi 60 ul oldu.

6. İlk Mikroarray Hibridizasyon

  1. C. elegans mikroarray GCAT (Aktif Öğretim Genom Konsorsiyumu) ​​yoluyla elde edilen slaytlar bloke edildi0.1 mg / ml 3X SSC sonicated somon sperm DNA,% 0.1 SDS kullanarak 1 saat oda sıcaklığında bekletin. Engellenen slaytlar ddH2O ve alt KimWipe 50 ml konik tüpler 2.000 g az 1 dakika süreyle santrifüj spin-kurutulmuş daldırma yöntemi ile durulanır.
  2. Daha sonra, 2X formamid tabanlı hibridizasyon tamponu (Genisphere) 55 ° C de 10 dakika, kristallerin çözünmesi için iyice karıştırılır ve 10.000 az 1 dakika süreyle santrifüj g. inkübe Sonra, 25 ul cDNA örnek 2X formamid tabanlı hibridizasyon tamponu 25 ul ile hafifçe vurarak yavaşça karıştırılır oldu. Seyreltilmiş cDNA örneği 15 saniye boyunca yanıp dönmeye tarafından toplanan ve 80 ° C'de 10 dakika inkübe edildi.
  3. Son cDNA slayt slayt dokunmadan dikkatlice tüm ısıtmalı cDNA örnek pipetleme mikroarray melezleşmiştir oldu. Örnek düzgün bir şırınga iğnesi kullanarak bir kapak kayma hafifçe düşürerek mikroarray üzerine yayıldı. Kapak kayma tamamen düşürülmüştür önce, kapağı kayma sonra tekrar iğne ile indirdi, yedekleme çekti ve nazikçe düşmesine izin, hava kabarcıklarının oluşumunu en aza indirir. Ayarlarım ilk melezleme slayt altında 50 ul GKD 2 O ile 50 ml konik tüp yatay slayt koyarak sonuçlandı ve 37 ° C'de bir gece inkübe

7. İkinci Hibridizasyon

  1. Melezleşmiş mikroarray'ler çeşitli sıcaklıklarda 2X SSC ile yıkandı. İlk olarak, mikroarray slaytlar oda sıcaklığında 2X SSC ve% 0.2 SDS içeren konik tüpler transfer edildi ve kapağını fişleri kaldırmak için hafifçe sarhoş. Sonra, mikroarray slaytlar 55 ° C 2X SSC ve% 0.2 SDS içeren konik tüplere transfer ve 15 dakika boyunca 55 ° C'de inkübe edildi. Sonra, slaytlar, hafifçe periyodik sallayarak 15 dakika boyunca oda sıcaklığında SSC 2X aktarılır ve inkübe edildi. Son slaytlar 0,2 X SSC transfer edildi ve düzenli aralıklarla hafifçe sallayarak, oda sıcaklığında 15 dakika inkübe. Yıkanmış slaytlar alt KimWipe 50 ml konik tüpler slaytlar etiketli yüzü aşağı getirerek spin-kurutulmuş ve 2,000 g. 1 dakika santrifüj
  2. Sonra, ikinci hibridizasyon karışımı 2X formamid tabanlı hibridizasyon tamponu (Genisphere) kullanılarak hazırlanmıştır. Hibridizasyon tamponu 10 dakika boyunca 55 ° C'de inkübe edildi ve 10.000 g. 1 dakika boyunca santrifüj Floresan reaktifler Yakalama (Cy3 ve Cy5) ve anti-solmaya reaktif oda sıcaklığında çözülmüş ve photobleaching reaktifleri korumak için folyo ile kaplı. Aşağıdaki hibridizasyon adımları minimize ışığa maruz kalma karanlıkta yapıldı. 2X formamid tabanlı hibridizasyon tampon 150 ul anti-fade-tedavi hibridizasyon karışımı yapmak için 1.5 ul solmaya anti-reaktif ile birlikte oldu.
  3. Yakalama Cy3 ve 3 saniye için Cy5 vortekslenmiş ve 15 saniye boyunca santrifüj edildi reaktifler, 10.000 g. İkinci hibridizasyon karışımı 75 ul anti-fade-tedavi hibridizasyon karışımı, 60 ul nükleaz içermeyen su, 7.5 ul Cy3 yakalama reaktif ve 7.5 ul Cy5 yakalama reaktif birleştirerek hazırlanmıştır. İkinci hibridizasyon karışımı, 75 ° C ve ısıtmalı karışımı 50 ul / kurutulmuş yıkanmış mikroarray slayt üzerine çok dikkatli pipetlenir 10 dakika inkübe edildi. Örnek mikroarray üzerine eşit yaymak için, bir kapak kayma hafifçe bir şırınga iğnesi kullanarak düşürülmüştür. Kapak kayma tamamen düşürülmüştür önce, kapağı kayma sonra tekrar iğne ile indirdi, yedekleme çekti ve nazikçe düşmesine izin, hava kabarcıklarının oluşumunu en aza indirir. Mikroarray slayt literatürde folyo ile kaplanmış ve GKD 2 O 50 ul 50 ml konik tüp yatay konmuş nemli bir oda oluşturmak için slayt altında eklendi. İkinci hibridizasyon 2-5 saat 37 ° C'de inkübe edildi.
  4. İkinci literatürde mikroarray karanlık oda sıcaklığında 2X SSC,% 0.2 SDS, 1 mM DTT yıkanır ve kapağını kayma kaldırmak için hafifçe sarhoş oldu. Sonra, mikroarray 55 ° C 2X SSC,% 0.2 SDS, 1 mM DTT içeren kaplı konik tüp aktarılır ve 55 ° C'de 15 dakika inkübe Sonraki, slayt periyodik hafifçe sallayarak 2X SSC, 1 mM DTT ve oda sıcaklığında 15 dakika inkübe içeren kaplı konik tüp nakledildi. Son olarak, slayt, 1 mM DTT 0,2 X SSC aktarılır ve yavaşça periyodik titreme, oda sıcaklığında 15 dakika inkübe edildi. Mikroarray slayt, 1 dakika, 2.000 g, alt KimWipe ile kaplı 50 ml konik boru slayt etiket tarafı aşağı santrifüj kurutuldu. Kuru mikroarray slaytlar Davidson College'da GenePix Kişisel Tarayıcı modeli 4100A ile tarandı.

8. Mikroarray Analizi

  1. Davidson College'da Laurie Heyer ve onun lisans öğrencileri tarafından geliştirilen MAGICTool Yazılımı kullanarak taradıktan sonra elde edilen görüntüler incelendi. Kısaca, "Proje" sekmesi altında, "Yeni Proje" oluşturulmuş ve kaydedilmiş oldu. "Build İfade Profil" sekmesine altında, "Load Image Çifti" seçili ve kırmızı görüntü dosyası (_635.tif) "Kırmızı" olarak yüklenen ve yeşil görüntü dosyası (_532.tif) "Yeşil" olarak yüklenen. Sonra, "İfade Yapı Profil" sekmesini seçin ve "Load Gen Listesi", C. elegans gen listesi dosyasını GCAT web sitesinden elde yüklendi.
  2. Mikroarray görüntü "İfade Yapı Profil" sekmesini seçin ve "Oluştur / Düzenle Grid" seçeneği kullanılarak ele alınması ve ızgara oldu. "Grid Setup" diyalog kutusunu Izgara sayısı "48" ile düzenlenebilir, noktalar "Yukardan aşağıya" 22 satır ve her ızgara için "22 sütunları" "Soldan Sağa" sayılı ve. Tek tek noktalar kolayca ayırt edilinceye kadar "Yüzde Kontrast Değiştir" artmış ve ızgara üzerinde yakınlaştırılmış. Izgaralar ilk sol panelde "Set Top Sol Spot" seçerek oluşturulmuştur. Daha sonra, sol üst spot merkezi, sağ üst spot ve alt satırda "Grid 1" tıklandığı. Soldan sağa ve yukarıdan aşağıya geçmeden, her biri için 48 ızgaraları Bu gridding prosedürü tekrarlandı. Gridding tamamlandığında, mevcut grid "Şu Izgara" olarak kaydet "File" altında kurtarıldı. Izgara başarıyla kaydedildi "Bitmiş" sekmesine seçildi.
  3. Analiz herhangi bir ilgisi olmayan noktalar ortadan kaldırmak için, "Build İfade Profil" sekmesine açıldı. Altında seçenek "İşaretlenmesi Nokta" gridding hitaben "seçildi. Kesikli noktalar veya eşiğe bayraklı ve "Dosya Sekmesi" altında "Şu Bayraklar Kaydet" seçerek tarafından kaydedilir.
  4. Bayraklı dosyaları "Build İfade Profil" sekmesini kullanarak ve segmentasyon yöntemi olarak tercih edilen "Sabit Radius" seçeneğini segmente. Yarıçapı istenilen boyuta kuruldu ve "Update Data" tıklandığında. Daire ızgara alanı (sarı kare) içinde kalır emin olmak için, yukarıdan aşağıya doğru kaydırıldığını ve soldan sağa ve bir kez kontrol "İfade bilgileri oluşturma" seçildi.
  5. Işaretleme sonra kalan noktaların her biri için Yeşil floresan oranları: segmentasyon sırasında, yazılım, Kırmızı hesaplanır. "İfade" sekmesinde, "Veri işleyin" Transform "seçildi. "Transform Veri" iletişim kutusu "logb işlevi (x)" seçeneği, b = 2 girilmiş olduğu ortaya çıktı. "Çalışma İfade Dosya", "İfade" sekmesinden araştırılmıştır. Vahşi tip Cy3 (yeşil) yakalama sırasını aldı ve mutant Cy5 (kırmızı) yakalama dizisi aldığı bir deney için, günlük dönüştürülmüş oranları değer bastırılmış genler için uyarılan ve negatifti genler için pozitiftir.
  6. Son olarak, belirli bir faktör tarafından uyarılan ya da bastırılmış genler "İfade" sekmesi altında "Araştır" ı seçerek analiz edildi. "Keşfetmek" iletişim kutusunda, bir "Max değeri> X kaynaklı genlerin (pozitif sayı)" veya "Min değeri <X (bastırılmış genler için negatif bir sayı)" genler için kuruldu "Kriterleri Eşleştirme Genler bul" # 5 açıklanan biri olarak deneyler. Fold-ifade 'x' seçim kriterleri girilen sayı değeri olduğu, 2x eşit.

9 - cDNA Sentezi ve Real-Time PCR

  1. Total RNA daha önce açıklandığı gibi izole edilmiştir. RNA izole kalite ve miktar tespit edilmiştir sonra, cDNA iScript cDNA Sentezi Kiti (BioRad), yabani tip ve mutant ve üretici önerilir protokolleri izole edilen 500 ng / ul toplam RNA kullanılarak sentezlenmiştir.
  2. Gerçek zamanlı PCR reaksiyonlar iQ SYBR Green Supermix (BioRad), 100-500 nmoles gen spesifik primerler (Tablo 1) ve bir önceki adımda tarafından üretilen 4 ul cDNAs kullanarak kuruldu. 10 ul reaksiyonlar PCR CFX96 Real-Time Sistemi (BioRad) kullanarak çalışacak.
  3. PCR ilk 3 dakika süreyle 95 ° C kadar ısıtılır. Bu 5 saniye boyunca 95 ° C'de adım ve 58 ° C 'de 30 saniye süreyle izledi. Bu döngü toplam kırk kez tamamlandı ve 0.5 derecelik bir degrade ile 65-95 ° C erime eğrisi de takıldı. ΔΔCT değerleri kontrol grubu olarak üç temizlik genler (hareket-1, cdc-42, ve pmp-3) kullanılarak hesaplanmıştır.
GEN İLERİ PRIMER TERS PRIMER
gst-5 CTGCTCCATTCGGACAACTT TCCGTTGAGCTTGAACTCAC
gst-9 GGAAGACAACTGGCACAATC ACCGAGAGCATCAACTTGAG
kcnl-1 TACGCTCGGCATGTGTTGTATC CCAATCATCGGCTCCACTATCT
KSR-2 CGAACTGCTGCTGGAATGCT GTGCTGCGTCTCTTCTGCTT
sınırlarımı 9 CTCATCGAGTGGCTCAATCT CACCTTGCTCCATCTTCAAC
lpr-6 CAGCAGTCACTTCTGTTCAC TCTCCAATAGCGGTACTCC
mesajı 6 TTGTTCCGTTGGCTCACGTACAG CGACAGACGCAGATACACGATCA
MSP-32 GCCGCACAGGTATGATCCAG ATCCAATACGGCGAGCCGAG
MSP-142 GATCCACCATGTGGAGTTCT GATTCTTGCGACGGACCATA
MSP-38 GCCTTCGGACAAGAGGATACC CCATACCGTCTCCTTGGAACC
MSP-45 TCACCGTTGAGTGGACCAAT ACGAACCAACCGTCTCCTT
MSP-49 CGACGACAAGCACACCTACCACATCAA TCGAGGACTCCACATGGTGGATCAACT
MSP-56 CGAAGATCGTCTTCAATGCGCCATAC TCCACATGGTGGATCAACTCCAAGTC

İleri Tablo 1 ve Real-Time PCR Primer Diziler Ters

10 Temsilcisi Sonuçlar:

RNA izolasyonu ve analizi

Presinaptik sitelerde aktif bölge habercisi veziküller Fusion sinaptogenez sırasında zorunlu bir adım (3). VSM-1, kısa bir süre önce tespit v-SNARE ana protein, belirsiz bir mekanizma (4, ve yayınlanmamış çalışma) nematod maya ve sinaptogenez vezikül füzyon (bkz. Şekil 1) inhibe ettiği öne sürülmüştü. Altında yatan moleküler yol daha iyi anlamak için VSM-1 nematod yönetmelik ve sinaptogenez alana biraz ışık getirmek, bir genom-geniş ekran başladı ve büyük sperm protein genleri (msp), tamamen fonksiyonel VSM-1 yokluğunda indüklenen olduğu belirlenmiştir .

C. VSM-1 (ok1468) mutant suşu indüklenen genleri araştırmak için elegans, bir mikroarray gen analizi gerçekleştirilmiştir. Bu vahşi tip izole transkript ve VSM-1 mutant suşu test ve zenginleştirme belirlenmesi tarafından yapıldı. Özellikle, ilk olarak senkron L4 ve L3 vahşi tip ve VSM-1 mutant larvaları nematod total RNA izole. Sonra, biz, DNaz I ile elde edilen total RNA tedavi edilen ve agaroz jel elektroforez kullanılarak çıkarılan RNA kalitesini inceledi. Şekil 2'de gösterildiği bir deneyde, bir merdiven standartları baz çifti sayısını temsil etmek için ilk şerit kullanılmıştır. Vahşi tip örnekleri ile tedavi öncesi ve sonrası DNaz ile tedavi, 2 ve 4 şeritli yüklü ve VSM-1 mutant örnekleri ön-tedavi ve sırasıyla 3 ve 5 şeritli yüklenen DNaz sonrası tedavi edildi . RNA jel elektroforez analizi, sağlam ve kaliteli olduğunu vahşi tip ve VSM-1 mutant RNA örnekleri gösterdi . Bu iki grup ribozomal RNA iki alt temsil gözlemleyerek tespit edildi.

Mikroarray hibridizasyon

RNA kalitesini tespit edilmiştir sonra, cDNA sentezi ile devam etti. Bunu yapmak için, mRNA transkripsiyonu ters bir yakalama sırası ve kuyruk eklendi. Üretilen cDNAs Cy3 ve Cy5 için yakalama dizileri içeren slayt mikroarray melezleşmiştir ve tarama için gönderdi. Mikroarray görüntüler daha sonra MAGICTool denilen bir Davidson College'da Laurie Heyer ve onun lisans öğrencileri tarafından geliştirilen açık kaynak kodlu bilgisayar yazılımı programına girildi. Bu yazılımı kullanarak, Cy3 ve Cy5 görüntüler, ızgara mikroarray'ler overlaid ve analiz floresan profilleri (bkz. Şekil 3). Bir kez gridding her bir kare tüm basılı oligonükleotid incelenmektedir emin olduktan sonra bölümlenmiş tamdı. Sonra biz kaynaklı oranlarının analiz ve MSP aile kodlayan genlerin gelişmiş sinaptogenez ile nematod indüklenen olduğunu gösteren genetik profiline ifadeler yarattı. (Tablo 3).

Doğrulama ve gerçek zamanlı PCR kullanarak gen ekspresyonu ölçümü.

MSP aile üyeleri için kod gerçek zamanlı PCR kullanarak VSM-1 mutant genetik profilini anlamak için bir dizi gen analiz. İlk olarak, toplam RNA vahşi tip ve VSM-1 (ok1468) mutant suşları izole edilmiştir. RNA örnekleri daha sonra ters cDNAs transkripsiyonu ve gerçek zamanlı PCR analizi için kullanılır. Gerçek zamanlı PCR ifade profillerinin değerlendirilmesi MSP ailesinin bir üyesi VSM-1 (ok1468) mutantlar indüklenen gibi görünüyor gösterdi. Ayrıca, gerçek zamanlı PCR veri bulguları doğrularmikroarray'ler gelen ve bir msp gen aday (Şekil 4) arama daralmış.

Şekil 1
Şekil 1 A. UNC-17 immün VSM-1 mutantlar dorsal sinir kordon boyunca yüksek sinaptik yoğunluk gösterdikleri tespit edilmiştir. Görüntüler vulva posterior 63x büyütme, (sağda) analiz edildi. WT ve VSM-1 (ok1468) B. Analizi mutant sinaps VSM-1 mutant (** p <0.01) istatistiksel olarak anlamlı gelişmiş sinaptik yoğunluğu ifade etti. Yirmi nematod her genotip için görüntüleri vardı.

Şekil 2
Şekil 2 çıkarılan RNA kalite agaroz jel elektroforezi kullanılarak tespit edildi. DNaz I tedavi öncesi ve sonrasında sağlam iki ribozomal alt ünitelere varlığı Yabani Türü ve VSM-1 (ok1468) örnek çıkarılan RNA belirgin oldu.

Şekil 3
Şekil 3 A. Mikroarray görüntü kontrolü kırmızı (Cy5) etiketli bir deney ve VSM-1 mutant yeşil (Cy3) etiketli oldu. B. mikroarray ortalama analiz 48 ızgaraları 1 gösteren Temsilcisi görüntü. Her bir küçük kare bir ızgara üzerinde tek bir basılı oligonükleotid temsilcisi ve 22 satır ve 22 sütun tarafından her bir ızgara oluşur.

Tablo 2
Tablo 2. Larva 4 (A) ve (B) Larva 3 C izole transkript. Mikroarray analizi elegans nematod en büyük sperm proteinleri kodlayan genlerin gelişmiş sinaptogenez mutantlar indüklenen olduğunu gösterdi. Vurgulanan genler hem Larva 3 ve Larva 4 indüklenen genler gösterir.

Şekil 4
Şekil 4. Msp gen ailesi, msp -32 üyesi VSM-1 (ok1468) mutantlar neden olduğunu göstermiştir Real-Time PCR analizi. Temsilcisi normalize kat ifade grafik vms-1 vahşi tip (WT) ve üç temizlik genler karşılaştırıldığında msp-32 ΔΔCT değerleri anlamlı derecede farklı (ok1468) (hareket-1, cdc-42 ve PMP normalleşmesi için kullanılacak olduğunu gösterir -3). Standart sapma - üç kopyaları ortalama + / çizilir.

Discussion

Bu çalışmada, çeşitli biyolojik olayların altında yatan belirlenen gen ekspresyon profilleri için kullanılabilir, kolay, kullanıcı dostu protokol geliştirmiştir. Bu protokolde, toplam RNA ilk olarak izole ve RNA izolasyon yöntemi dramatik fenol ekstraksiyon atlayarak ve 5,6 kadar temizlemek için yakınlık reçine kullanılarak basitleştirilmiş oldu DNaz I. kullanılarak tedavi edildi . Kısaca, C. elegans derisinden köklerine ve hücre zarları, sıvı azot ve moleküler reçine ile taşlama ile dondurma nematod kırık açık . Ardından, çıkarılan RNA, cDNA sentezi önce DNaz I ile tedavi edildi. Sonraki adım belirsiz döllemeler en aza indirmek için eklendi; genomik DNA ile kontamine RNA örnekleri girişime tanıtmak ve birçok yanlış pozitif üretebilir. Sonra, vahşi tip ve VSM-1 (ok1468) mutant cDNAs Cy3 ve Cy5 yakalama dizileri ile etiketlenmiş ve C üzerine melezleşmiştir elegans mikroarray'ler GCAT programı aracılığıyla elde edilmiştir. Bu sistem, benzer ürünlere göre daha daha duyarlı olup, iki renkli tasarımı, daha fazla zaman ve maliyet verimliliği 7,8, gerekli dizilerin sayısı azalır. Ayrıca, bu sistem diğer benzer sistemleri, özel ekipman gerektirmez, bu nedenle, bu yordamı herhangi bir standart laboratuvar ortamında 7 başarılı olabilir. Üçüncü olarak, floresan melezleşmiş dizi görüntüleri, açık kaynak kodlu yazılım MAGICTool kullanılarak analiz edildi ve gen ekspresyon profilleri oluşturuldu. MAGICTool lisans, doktora sonrası, tüm deneyim seviyesindeki kişiler tarafından kolay kullanılır bir kullanıcı dostu bir programdır. Ancak, optimal performans, geniş bellek kullanımını gerektirir. Son olarak, aday genler, gerçek zamanlı PCR ile valide mikroarray analizi kullanılarak elde edilmiştir.

Genomik yaklaşımı biyolojik olgunun eğitim için etkili bir yöntem olmasına rağmen, dikkate alınması gereken bazı sınırlamalar vardır. İlk basılı oligonükleotid korunmuş dizileri alınırsa, bu mikroarray protokol özgüllüğü rağmen, bir aile içinde transkript birbirinden ayırt edilemez. Gerçek zamanlı PCR bir gen ailesi içinde benzerlikler dengeler ve hatta aynı genin belirli izoformları arasındaki farkı ayırt edebilir. Ancak, gerçek zamanlı PCR ile eşit bir organizmanın ömrü boyunca ifade doğrudur denetimlerini bulmak için bir meydan okumadır. Bu nedenle, sonuç bağlı olacaktır. Proteomik yaklaşım, bizim teknik bir alternatif. Bireysel proteinler 2D jel elektroforezi ve kütle spektrometresi ile özdeşleşmiş kullanılarak izole olabilir.

Çalışmalarımız özellikle gelişmiş sinaptik yoğunluğu ile VSM-1 mutant nematod indüklenen Binbaşı Sperm Protein (MSP) ailesinin birçok üyesi olduğunu göstermektedir. MSP C'ye kadar özeldir elegans ve oosit olgunlaşma ve yumurtlama için sorumludur. Chai 1 meyve sinekleri nöromüsküler kavşakta presinaptik bouton sayısını ve boyutunu düzenlenmesi büyük olasılıkla Binbaşı Sperm protein etki alanı içeren moleküller tarafından kontrol edildiğini göstermiştir . Tsuda ve arkadaşları tarafından yapılan çalışmalar, 2 Binbaşı Sperm protein etki reseptör tirozin kinaz sinyalizasyon kaskadlar tetikleme, Ephrine reseptörler için ligandlar olarak hizmet verebilir göstermiştir. Ayrıca, gerçek zamanlı PCR analizi, doğrulanmış ve mikroarray sonuçları, msp-32 msp ailesinin bir üyesi aşağı daralmış. Birlikte ele alındığında, burada sunulan iş merkezi bir nörobilim ikilem bir genom analiz gibi bilimsel çaba içinde lisans araştırma gücünü temsil eder.

Disclosures

Çıkar çatışması ilan etti.

Acknowledgments

Bu çalışma, Weatherford Tamam Güneybatı Oklahoma State University'de lisans öğrencileri tarafından yapıldı. Bu çalışma, NSF RUI-0963258, NIH OK-INBRE 2P20RR016478, GCAT ve OCAST HR09-137S tarafından desteklenen oldu.

Vsm1 (ok1468) mutant Oklahoma Gen Nakavt Konsorsiyumu tarafından izole edilmiştir.
Yazarlar, Dan Stefanovic ve Tanner Wheeler, projenin yürütülmesi sırasında değerli yardım için teşekkür ederim.

Materials

Name Company Catalog Number Comments
RNA Later Ambion AM7020
Molecular Grinding Resin G-Biosciences 786-138
RNeasy Mini Kit Qiagen 74104
Rnase-free Agarose LE Ambion AM9040
NorthernMax Gly 10X Gel Prep/Running Buffer Ambion 8678
RNA Millenium Marker Ambion AM7150
Glyoxal Sample Loading Dye Ambion 8551
DNase set Qiagen 79254
RNeasy MinElute Kit Qiagen 74204
RT Enzyme and 5X Reaction Buffer Genisphere RT300320
Array 350 Genisphere W300180
QIAquick PCR Purification Kit Qiagen 28104
20X SSC VWR international 82021-4846
Sheared Salmon Sperm DNA Ambion AM9680
SDS Solution Promega Corp. V6551
DTT EM VWR international 3860
iScript cDNA Synthesis Kit Bio-Rad 170-8890
iQ SYBR Green Supermix Bio-Rad 170-8880

DOWNLOAD MATERIALS LIST

References

  1. Chai, A., Withers, J., Koh, Y. H., Parry, K., Bao, H., Zhang, B., Budnik, V., Pennetta, G. hVAPB, the causative gene of a heterogeneous group of motor neuron diseases in humans, is functionally interchangeable with its Drosophila homologue DVAP-33A at the Neuromuscular Junction. Hum Mol Genet. 17, 266-280 (2008).
  2. Tsuda, H., Han, S. M., Yang, Y., Tong, C., Lin, Y. Q., Mohan, K., Haueter, C., Zoghbi, A., Harati, Y., Kwan, J., Miller, M., Bellen, H. J. The Amyotrophic Lateral Sclerosis 8 protein VAPB is cleaved, secreted, and acts as a ligand for Eph receptors. Cell. 133, 963-977 (2008).
  3. Dresbach, T., Torres, V., Wittenmayer, N., Altrock, W. D., Zamorano, P., Zuschratter, W., Nawrotzki, R., Ziv, N. E., Garner, C. C., Gundelfinger, E. D. Assembly of Active Zone Precursor Vesicles. Journal of Biological Chemistry. 281, 6038-6047 (2005).
  4. Lustgarten, V., Gerst, J. E. Yeast VSM1 Encodes a v-SNARE Binding Protein That May Act as a Negative Regulator of Constitutive Exocytosis. Molecular and Cellular Biology. 19, 4480-4494 (1999).
  5. Viñuela, A., Snoek, L., Riksen, J., Kammenga, J. Genome-Wide Gene Expression Analysis in Response to Organophosphorous Pesticide Chlorpyrifos and Diazinon in C. elegans. PloS one. 5, 1-8 (2010).
  6. Niwa, R., Hada, K., Moliyama, K., Ohniwa, R., Tan, Y., Olsson-Carter, K., Chi, W., Reinke, V., Slack, F. C. elegans sym-1 is downstream target of the hunchback-like-1 developmental timing transcription factor. Cell Cycle. 8, 4147-4154 (2009).
  7. Kershner, A., Kimble, J. Genome-wide analysis of mRNA targets for Caenorhabditis elegans FBF, a conserved stem cell regulator. PNAS. 107, 3963-3941 (2010).
  8. Hammock, E., Eagleson, K., Barlow, S., Earls, L., Miller, D., Levitt, P. Homologs of genes expressed in Caenorhabditis elegans GABAergic neurons are also found in the developing mouse forebrain. Neural Development. 5, 1-14 (2010).

Comments

2 Comments

  1. Thanks for the informative material. Could you post something about RealTime PCRs and Traditional PCRs.

    Reply
    Posted by: Anonymous
    February 29, 2012 - 7:20 AM
  2. Thanks for the informative material. Could you post something about http://www.fluoresentric.com/">RealTime PCTR and Traditional PCRs.

    Reply
    Posted by: Anonymous
    February 29, 2012 - 7:20 AM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics