בVivo siRNA Transfection וג'ין מציאה בחוט השדרה באמצעות ראפיד פולשנית מותני intrathecal זריקות בעכברים

1Institute for Pharmacology, University of Heidelberg
Published 3/22/2014
0 Comments
  CITE THIS  SHARE 
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

דו"ח זה מתאר טכניקה פשוטה ומהירה של נקב מחט intrathecal עבור transfection מקומי של siRNA בחוט השדרה המותני בעכבר תחת הרדמה קצרה אור בר קיימא.

Cite this Article

Copy Citation

Njoo, C., Heinl, C., Kuner, R. In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice. J. Vis. Exp. (85), e51229, doi:10.3791/51229 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

דו"ח זה מתאר את מדריך צעד אחר צעד לטכניקה של הזרקות מחט intrathecal חריפות בצורה לא פולשנית, כלומר העצמאית של השתלת קטטר. המגבלה הטכנית של טכניקה ניתוחית זו נעוצה בעידון של הידיים. הזריקה היא מהירה, במיוחד עבור הנסיין מיומן, וכן שיבוש רקמות עם טכניקה זו הוא מינימאלי, זריקות חוזרות ונשנות אפשריות; תגובת יתר על כן חיסון לכלים זרים (. למשל קטטר) אינה מתרחשת, ובכך נותנת ספציפי טוב יותר ויותר לקרוא את של אפנון חוט השדרה. מאז היישום של החומר מוגבל במידה רבה לאזור היעד של חוט השדרה, תרופות לא צריכה להיות מיושמות במינונים גדולים, ואת השפעות חשוב יותר לא רצויות ברקמות אחרות, כפי שנצפתה עם משלוח מערכתי, יכולה לעקוף 1, 2. יתר על כן, אנו משלבים בטכניקה זו עם transfection vivo של חומצות גרעין בעזרת polyethylenimine (PEI) מגיב 3, המספק גמישות עצומה ללימוד פונקציות השדרה באמצעות משלוח של סוכנים תרופתיים כמו גם גנים, RNA, ומאפנני חלבון.

Introduction

חוט השדרה הוא מרכז חשוב מאוד במגוון רחב של תהליכים ביולוגיים מרכזיים ופונקציות פיסיולוגיות, לרבות עיבוד והעברה של תשומות כואבות (nociceptive) 4-7. ניסיוני בטכניקות שונות פותחו כדי להקל על אפנון תרופתי של חוט השדרה, כגון השתלה כרונית של צנתרים intrathecal 8, microinjection חוט השדרה, והזרקת מחט intrathecal 9. לכל אחד יש טכניקת יתרונות משלה וחסרונות, ובהתאם לפרדיגמה ניסוי טכניקה אחת יכולה להיות מתאימה יותר מאשר לאחרים. ואילו השתלה כרונית של צנתרים intrathecal אינה ריאלי בקלות בחולדה, בשיטה זו קשה מאוד בעכבר, בהתחשב במגבלות גודל. שיעור הצלחה הוא נמוך מאוד וליקויים מוטוריים מתרחשים לעתים קרובות בשל נוכחותם מגושמת של קטטר בחלל subdural מוגבל קשות בעכבר. יתר על כן, מסירה ארוכת טווח של תרופות שניתנו עקב קרישה תכופהשל כרוני מושתל צנתרים. לבסוף, תגובות חיסוניים נפוצות.

ניתן לעקוף בעיות אלה תוך שימוש בשיטה של הזרקת intrathecal האקוטית באמצעות מחט בהעדר קטטר preimplanted, המאפשר יישום מהיר ואנטומית מוגבל של תרופות וחומרים כימיים למייתרי השדרה בעכברים. שיטה זו שומרת באופן מלא את היתרונות של משלוח intrathecal על פני מסלולים אחרים מערכתיים משלוח (לדוגמא: דרך הפה, דרך הווריד, החדרה לקרום בטן, וכו ') כגון הספציפיות של אפנון בעמוד השדרה, המאפשר מינונים מופחתים ותופעות לוואי גבול, כמו גם יכולת לספק חומרים לא בדרך כלל לא חוצה את מחסום דם במוח מאז במהלך הזרקת intrathecal, המחט מוחדרת בין מאטר הדורה וחוט השדרה. חשוב לציין עם זאת, בהשוואה לשיטות אחרות של משלוח intrathecal, שיטת הזרקת מחט intrathecal היא פחות פולשנית, המאפשר יישומים רביםאותו בעל חיים מבלי לגרום כל נזק לרקמות משמעותיות או לעורר תגובה חיסונית עקב השתלה של חומר זר. עם זאת, זה דורש מיומנות טכנית למיקוד מדויק מאוד של המחט על מנת לאפשר יעילות.

הנה, אנחנו מבחינה ויזואלית להדגים את השיטה להשגת שיעור אופטימלי של הצלחה עבור במיוחד מיקוד בעמוד השדרה המותני. אתר הזרקה שנבחרה בניסוי הזה הוא החריץ בין L5 והעמודה L6 חוליות, סמוך למקום שבי חוט השדרה מסתיים, כדי למזער את האפשרות של פגיעה בעמוד השדרה. יתר על כן, אנחנו מדגימים את השימוש בטכניקה זו כדי להפיל גנים בחוט השדרה באמצעות siRNAs.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

כל נהלי השימוש בבעלי החיים היו בהתאם לקווים מנחים אתיים שנקבעו על ידי גוף שלטוני המקומי (Regierungspräsidium קרלסרוהה, קרלסרוהה, גרמניה).

1. הכנת מורכבת siRNA / PEI


הפתרון המורכב siRNA / PEI מוכן באמצעות הוראות יצרן כדלקמן:

  1. פתרון: לדלל את הכמות הרצויה של siRNA עם מים סטריליים (במידת צורך) עד רבע לסוף הנפח ולדלל עוד יותר את זה עם 10% פתרון גלוקוז עד מחצית מסוף הנפח. מערבולת בעדינות או מערבב על ידי pipetting למעלה ולמטה. הכמות האופטימלית של siRNA צריכה להיקבע באופן אמפירי אבל 1 מיקרוגרם siRNA ב10 פתרון μl מורכב לכל בעל חיים הוא נקודת התחלה טובה לאופטימיזציה.
  2. פתרון ב ': לדלל את הנפח הדרוש של מגיב PEI עם מים עד סטרילי כדי רבע מסוף הנפח ולדלל את זה עוד יותר עם 10% פתרון את הגלוקוז למחצית מסוף הנפח. ורטקס gently או מערבב על ידי pipetting למעלה ולמטה.
    הערה: הכמות של מגיב PEI קובעת את האיזון היוני במתחם, המשפיע על היעילות של transfection. כמו כן את הכמות האופטימלית של פתרון PEI צריכה להיקבע באופן אמפירי. בידיים שלנו, את הכמות האופטימלית היא 0.12 μl של פתרון PEI לכל מיקרוגרם siRNA 1.
  3. מערבבים את הפתרון עם הפתרון B בבת אחת, מערבולת בעדינות.
  4. דגירה הפתרון המשולב ל15 דקות ב RT לפני השימוש. קומפלקס זה הוא יציב לשעה 2 ב RT ול24 שעות ב 4 ° C.

2. הזרקת intrathecal

  1. להרדים את העכבר עם isoflurane 3%, עד שהוא לא מראה סימנים של ליישר רפלקס. בנוסף, בדוק אם זנב ו / או רפלקס קמצוץ כפה על מנת להבטיח המצב של הרדמה נוספת.
  2. לגלח סביב 2 סנטימטר 2 של פרווה בקצה האחורי של החיה ליד בסיס הזנב כדי להקל על ויזואליזציה טובה יותר במהלך החדרת מחט.
  3. מקם את עכבר בחרטומו לממשל isoflurane המשיך במהלך ההליך, להפחית isoflurane 1.5%, ולכסות את עיניו של העכבר עם חומר סיכה העין.
  4. הכן את מוכן לשימוש פתרון מעורב siRNA באמצעות 25 μl המילטון מזרק המצורף ל30 G 0.5 במחט.
  5. אתר את תהליך spinous של L6, שאמורה להיות הבולט אחד ולתקן את עמודת חוליות באזור זה על ידי לחיצה עליו בעדינות.
  6. בזהירות להכניס את המחט בין החריץ של L5 וL6 חוליות ולבחון לקפיצי זנב כסימן זה מצביע על כניסה מוצלחת של המחט בחלל intradural.
    טיפ: השימוש בציפורן, אחד צריך להיות מסוגל לאתר את הגרוב גם כן.
  7. ברגע שהינף זנב הוא ציין, באופן מיידי, אבל בזהירות, להבטיח את מיקום המחט ביד אחת ולהזריק את הנפח הרצוי של חומר ביד השנייה באיטיות.
    טיפ: נפח בין 5-10 μl הוא אופטימלי כנפח פחות מ 5 &181 #; l הוא לא אמין ונפח גדול יותר מ10 μl מוביל ליותר מדי לחץ.
  8. ברגע שההזרקה מתבצעת, הזז את העכבר חזרה לכלוב להתאושש מהרדמה.
  9. חזור על הפעולה הזרקה זה לפחות 2 יותר פעמים בכל שעה 24 להשיג downregulation האופטימלי של הגן הממוקד.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

כדי להמחיש זריקה מוצלחת, ביצענו בטכניקה זו משתמשת בצבע מהיר גרין FCF בעכברי C57BL6 מבוגר (8-10 שבועות של גיל). בעלי החיים הורשו להתאושש במשך כמה דקות לאחר ההזרקה על מנת לספק מספיק זמן לצבע להתפשט ולאחר מכן נהרג עם מנת יתר של CO 2. בהמשך לכך, בעמודת החוליות הייתה גזור ואת חוט השדרה נחשף. Puncta הכחול תואם לצבע מתפזר, סימן את אתר ההזרקה. אין סימן לפגיעה בחוט השדרה ניתן הייתה לראות, המאשרת את הטבע פולשנית של טכניקה זו (איור 1 א). הצבע המוזרק מתפזר מאתר ההזרקה rostrally, והגיע עד לאזור בית החזה של חוט השדרה, רק כמה לאחר ההזרקה (איור 1 ב) דקות. יתר על כן העירוי המוצלח של הצבע בחלל האפידורלי יכול להיות מוכח על ידי פני השטח המוכתם של חוט השדרה, אך לא את הפנים (תרשים 1C).

ass = "jove_content"> יתר על כן, בטכניקה זו, בשילוב עם ערכה מגיב PEI, אפשר siRNA יעיל מאוד בtransfection vivo אל חוט השדרה. לאחר לידת intrathecal siRNA (3x, פעם אחת בכל שעה 24), הביטוי של החלבון הממוקד (כאן WAVE1) על lysates נגזר מגב רקמות בעמוד השדרה L3-L5 הופחת לכ -70% ברמת חלבון (איור 2 א, n = 20) כמו גם ברמת ה-mRNA (איור 2, n = 6). יתר על כן downregulation בסדר גודל דומה יכול גם לראות בlysate של סעיף הגחון (איור 2C, n = 4). מעניין, downregulation אפילו קצת יותר חזק, היה לראות גם בlysate של חוט השדרה הצווארי (איור 2 ד, n = 4). אבל, למרות העובדה ששיטה דומה כבר בשימוש לdownregulate הגנים ברקמות מחוץ לחוט השדרה 10, בידיים שלנו זה downregulation לא נצפה בlysate של המוח (איור 2E, n = 4) ולא DRGs (איור 2F, n = 4).

איור 1
איור 1. חוט השדרה גזור מתחת למיקרוסקופ לאחר הזרקה שאינה פולשנית, חריפה intrathecal עם צבע ירוק מהיר. , אין שום סימן נראה לעין של פגיעה ברקמות שניתן לראות באתר של הזרקה, שסומן על ידי puncta הצבע. ב ', נכרת בעמוד השדרה כמה לאחר ההזרקה מראה דיפוזיה ההדרגתית של הצבע בכיוון מקורי דקות. קופסא לבנה מסמנת את האזור המותני, והכוכב מסמן את הזריקה. C, מכתים ספציפי על פני השטח של חוט השדרה (מגזר L3-L5), אבל לא את הפנים של חוט השדרה. r = מקורי, ג = הזנב, cc = תעלה מרכזית. לחץ כאןלצפייה בתמונה גדולה יותר.

איור 2
איור 2. . Downregulation המוצלח של החלבון הממוקד (כאן WAVE1) בחוט השדרה לאחר לידת siRNA intrathecal עכברים הוזרקו intrathecally או עם siRNA שליטה או siRNA ממוקד נגד WAVE1 מעורבב עם מגיב PEI במשך 3 פעמים ברציפות בכל שעות 24; לאחר מכן, הגב וגחון קטע של חוט השדרה המותני (קטע 3-5), כבל צוואר הרחם השדרה, המוח וDRGs היו נכרת, lysed והנתון מערבי סופג וqRT-PCR. AB, מערבי סופג (n = 20) וqRT-PCR (n = 6) כימות מlysate סעיף גב של עמוד השדרה המותני, כימות סופג CF המערבי מlysate של חוט הגחון L3-L5 בעמוד השדרה, חוט השדרה הצווארי, במוח וrespe DRGctively (n = 4). ניתוח היה על ידי מבחן t מזווג של הסטודנט (* P ≤ 0.05, ** P ≤ 0,005). לחץ כאן לצפייה בתמונה גדולה יותר.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

לכן, השיטה שתואר לעיל של זריקות מחט intrathecal היא יעילה, מהירה, במיוחד-מקומי, ולא הורסות. מבחינה טכנית, ההיבט הקריטי ביותר של הליך זה הוא נקודת החדרת מחט לתוך החריץ. זה חיוני כי הליך זה נעשה עם ידיים וסבלנות מאוד רגועות. כמו רבים הליכים כירורגיים, אימון משפר את קצב הזריקה מוצלחת. זה חשוב גם כי במהלך ניסוי בפועל, טכניקה זו אינה מספקת אינדיקציה ברורה על מנת לאשר באופן ישיר אם זריקה היא מוצלחת או לא. המחוון הגלוי רק של החדרת מחט הנכונה הוא קפיצי הזנב שהוא ציין כמו רפלקס.

שיטה זו שומרת באופן מלא את היתרונות של משלוח intrathecal על פני מסלולים אחרים systemical משלוח (לדוגמא: דרך הפה, דרך הווריד, החדרה לקרום בטן, וכו '), כמו הספציפיות של אפנון בעמוד השדרה, המאפשר מינונים מופחתים ותופעות לוואי גבולות; פרווהthermore, זריקות intrathecal לאפשר משלוח של חומרים שהם בדרך כלל לא מחסום דם מוח צלב מאז במהלך הזרקת intrathecal, המחט מוחדרת בין מאטר הדורה וחוט השדרה. חשוב לציין, עם זאת, בהשוואה לשיטות אחרות של משלוח intrathecal, שיטת הזרקת מחט intrathecal היא פחות פולשנית, המאפשר יישומים רבים באותה החיה מבלי לגרום כל נזק לרקמות משמעותיות או לעורר תגובה חיסונית עקב השתלה של חומר זר.

בסך הכל, בדוח זה, שהראינו מדריך הבסיסי לא רק צעד אחר צעד להזרקת מחט intrathecal חריפה, אלא גם לדווח דוגמא לאלתור של טכניקה, זה שבו בvivo מציאה transfection וגן הספציפי siRNA בשדרה ניתן להשיג כבל. לצד המשלוח של חומרים כימיים תרופתיים ומשלוח siRNA הקל-PEI, שיטת הזרקת מחט intrathecal יכולה לשמש גם כדי להקל על otסוגיה של העברת גנים, כגון משלוח בתיווך הגן נגיפי 11. ברגע שהמומחיות מספקת כבר צברה, הליך זה יכול גם להתבצע ללא הרדמה בעכברים ער, nonanesthetized 4,12. זה מאפשר, למשל, ללמוד השפעות חריפות של סוכנים תרופתיים בפרדיגמות התנהגותי עכברים סיפקו הם preacclimatized כדי למנוע לחץ מופרז.

לפיכך, זריקות intrathecal חריפות מהוות כלי מאוד שימושי עבור מחקרים על הקרן הגבית השדרה ואת הרבגוניות של הטכניקה מאפשרת הנסיינים כדי להתאים אישית ולאלתר כדי שיתאימו למטרות שלהם.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים מצהירים שום אינטרסים כלכליים מתחרים.

Materials

Name Company Catalog Number Comments
In Vivo-jetPEI Polyplus 201-10G  
WAVE1 siRNA Santa Cruz sc-36832  
Control siRNA-A Santa Cruz sc-37007  
Anti-ß-Tubulin III antibody Sigma T2200  
Anti-WAVE1 antibody R&D Systems AF5514  
Fast green dye Sigma F-7252  
Isoflurane Baxter  
Isoflurane setup Dräger Lübeck  
Shaver Wella  
Hamilton syringe Gastight 1702 Hamilton  
30 G 1/2 in 13 mm Needle BD Microlance 304000  
Microscope Leica MS5 Leica  
WAVE1 forward primer for qRT-PCR Sigma cacagagcctcaggacagg
WAVE1 reversed primer for qRT-PCR Sigma cttttcaccaacggcatctt
FastStart Essential DNA Green Master Roche 6402712001  

DOWNLOAD MATERIALS LIST

References

  1. Hylden, J. L., Wilcox, G. L. Intrathecal morphine in mice: a new technique. Eur. J. Pharmacol. 67, 313-316 (1980).
  2. Stokes, J. A., Corr, M., Yaksh, T. L. Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling. Neurosci. Lett. 504, 215-218 (2011).
  3. Goula, D., et al. Polyethylenimine-based intravenous delivery of transgenes to mouse lung. Gene Ther. 1291-1295 (1998).
  4. Fairbanks, C. A. Spinal delivery of analgesics in experimental models of pain and analgesia. Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).
  5. Hohmann, A. G., Tsou, K., Walker, J. M. Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2. Neurosci. Lett. 257, 119-122 (1998).
  6. Song, Z. H., Takemori, A. E. Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice. J. Pharmacol. Exp. Ther. 254, 363-368 (1990).
  7. Trang, T., Sutak, M., Jhamandas, K. Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance. Neuroscience. 1275-1288 (2007).
  8. Yaksh, T. L., Rudy, T. A. Chronic catheterization of the spinal subarachnoid space. Physiol. Behav. 17, 1031-1036 (1976).
  9. Tappe, A., et al. Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain. Nat. Med. 677-681 (2006).
  10. Bourinet, E., et al. Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception. EMBO J. 24, 315-324 (2005).
  11. Wang, X., et al. Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves. Mol. Ther. 12, 314-320 (2005).
  12. Wigdor, S., Wilcox, G. L. Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways. J. Pharmacol. Exp. Ther. 242, 90-95 (1987).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats